ID: 968872592

View in Genome Browser
Species Human (GRCh38)
Location 4:3249308-3249330
Sequence CTGGGGAGACACGAGGTAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968872592_968872596 -8 Left 968872592 4:3249308-3249330 CCGGCTACCTCGTGTCTCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968872596 4:3249323-3249345 CTCCCCAGGCGGAGAAGCACCGG 0: 1
1: 0
2: 0
3: 7
4: 205
968872592_968872607 27 Left 968872592 4:3249308-3249330 CCGGCTACCTCGTGTCTCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968872607 4:3249358-3249380 TGGACGGACGCCGAGATGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
968872592_968872604 11 Left 968872592 4:3249308-3249330 CCGGCTACCTCGTGTCTCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968872604 4:3249342-3249364 CCGGCGGGCCCGCAACTGGACGG 0: 1
1: 0
2: 1
3: 7
4: 43
968872592_968872601 -4 Left 968872592 4:3249308-3249330 CCGGCTACCTCGTGTCTCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968872601 4:3249327-3249349 CCAGGCGGAGAAGCACCGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 140
968872592_968872599 -5 Left 968872592 4:3249308-3249330 CCGGCTACCTCGTGTCTCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968872599 4:3249326-3249348 CCCAGGCGGAGAAGCACCGGCGG 0: 1
1: 0
2: 2
3: 6
4: 145
968872592_968872602 7 Left 968872592 4:3249308-3249330 CCGGCTACCTCGTGTCTCCCCAG 0: 1
1: 0
2: 2
3: 15
4: 209
Right 968872602 4:3249338-3249360 AGCACCGGCGGGCCCGCAACTGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968872592 Original CRISPR CTGGGGAGACACGAGGTAGC CGG (reversed) Exonic
900184842 1:1328215-1328237 CTGGGCAGACACGGGGTCCCAGG - Exonic
900293940 1:1939312-1939334 CTGGGGCCACACAAGGTAGCTGG - Intronic
901160371 1:7172721-7172743 CTGGGGAGACAGGAGGACACTGG + Intronic
901443861 1:9295074-9295096 CTGGGGAGACACGAAGTGCCTGG - Intronic
904287186 1:29460328-29460350 CTGAGGAGACAAGAGGAACCAGG + Intergenic
907422090 1:54354428-54354450 CAGGAGAGACACGAGGCAGTGGG + Intronic
907441272 1:54480072-54480094 CTGAGGAGACAAGAGTGAGCAGG + Intergenic
910843028 1:91578950-91578972 CTGGGGAGAAAGGAGGCAGAAGG - Intergenic
911434913 1:97844848-97844870 GTGGGGAGAGACCAGGTAGTGGG - Intronic
916426792 1:164688559-164688581 CTAGCGAGCCATGAGGTAGCTGG + Intronic
917042359 1:170819828-170819850 CTGAGGAGACAAGAGGAATCGGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
922357730 1:224792463-224792485 CTGGGGAGACAAGAAGAATCAGG - Intergenic
923942991 1:238849907-238849929 CTAGGGAGACATGAGGCAGTTGG + Intergenic
1062996843 10:1874103-1874125 GTGGGGAGAGAGGAGGTAGCAGG + Intergenic
1066454860 10:35564358-35564380 CTGGGGAGACATGAAGCTGCTGG - Intronic
1066952726 10:42137487-42137509 GTGGGGAGACAAGAGGGAGAGGG - Intergenic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1069878235 10:71576169-71576191 AGGGGGAGACACGAGGGGGCTGG - Intronic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1070813825 10:79311378-79311400 CTGGGGGGACAGGAGCCAGCAGG - Intronic
1074554419 10:114475152-114475174 CAGGTGAGAGACGAGGTAGGAGG - Intronic
1075262305 10:120973806-120973828 CTGGGGAGACCTGAGGTTACTGG - Intergenic
1075398075 10:122142200-122142222 CTGTGGAGCCCCGAGGGAGCAGG + Intronic
1075745932 10:124727512-124727534 CAGGTGGAACACGAGGTAGCAGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1079243885 11:18739505-18739527 CTGGGGCCACACGAGGTAAGGGG + Intronic
1081317177 11:41644794-41644816 CTGGGTAGACACCAGGTAGCGGG + Intergenic
1081709669 11:45208768-45208790 CTGGGGAGCCAGGAGGCACCTGG - Intronic
1083933874 11:65860426-65860448 CTGGGGTGACAGGAAGGAGCCGG + Exonic
1084586556 11:70065882-70065904 GTGGGGAGACACGACGTGGGTGG - Intergenic
1084887502 11:72220799-72220821 GGGGAGAGACACGAGGTGGCAGG + Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085479660 11:76810684-76810706 CTGGGAAGACACCAGGAAGGAGG + Intergenic
1086249235 11:84794669-84794691 GTGGGGAGAGACCAGGGAGCGGG - Intronic
1088881608 11:113977409-113977431 CTGGGGAGCAACAAGGAAGCTGG - Intronic
1088921030 11:114259882-114259904 CTGGGAAGACATGAGGGAACGGG - Intronic
1088958896 11:114640459-114640481 CTGGGTAGACACCAAGTAGTGGG + Intergenic
1089952384 11:122541175-122541197 CTGGGTAGATACCAGGTAGTGGG + Intergenic
1090070779 11:123543135-123543157 GTGGGAAGACACCAGGGAGCAGG + Intronic
1091323377 11:134667021-134667043 CTGGGGAGACACGAGCATCCAGG - Intergenic
1091409141 12:227805-227827 CTGGGGTGAGCAGAGGTAGCAGG - Intronic
1091690177 12:2590630-2590652 CTGGGGAGAAGCAAGTTAGCTGG - Intronic
1091816330 12:3441526-3441548 CTGGGGAGACACAGGGTATGAGG - Intronic
1091829749 12:3541063-3541085 CTGGGGAGAGACACGGGAGCTGG - Intronic
1092148181 12:6229167-6229189 CTGGAGGGACACCAGGGAGCTGG - Intronic
1092297577 12:7212832-7212854 CTGGGGGATCACGAGGCAGCTGG + Intronic
1096365852 12:51027524-51027546 CTGGGGAGAATCGAGTCAGCTGG - Intronic
1096494176 12:52029800-52029822 CTGGAGAGACATGAGGCAGGCGG - Intronic
1096963930 12:55609294-55609316 CTGGGGAGACACCCAGTAGTGGG + Intergenic
1102346287 12:112163304-112163326 CTGGGGAGGCACTGGGTAGGTGG - Intronic
1102744620 12:115239565-115239587 CTGGAGAGACGCAAGGTTGCTGG - Intergenic
1103056818 12:117828007-117828029 CTGGGGAGAAAAAATGTAGCAGG + Intronic
1104038438 12:125114451-125114473 CAGGGGAGACACGGGGGAGCGGG - Intronic
1117861053 14:60092835-60092857 CTGGAGAGACAAGAGGTTGTGGG - Intronic
1118236755 14:64012210-64012232 CTAGGAGGAGACGAGGTAGCGGG - Intronic
1118722608 14:68604986-68605008 CTGAGGAGCCACAAGGTTGCTGG - Intronic
1119126009 14:72126961-72126983 CTGGGGAGGCATGAGGTTGGGGG + Intronic
1119448111 14:74683601-74683623 GTGGGGAGAGAGGAAGTAGCTGG + Intronic
1121444809 14:93972176-93972198 CTGGGGACACACGAGGAGTCAGG + Intronic
1125728253 15:41879145-41879167 ATGGGGAGACAACAGGTAGGAGG - Intronic
1128192405 15:65714931-65714953 CTGGAGAGAGAGGAGGTAGTAGG - Intronic
1128708174 15:69852383-69852405 CTGGGAAGACTCGAGGAGGCTGG + Intergenic
1130707416 15:86246350-86246372 CTGGGGAGCCTGGAGGTGGCAGG + Intronic
1130826077 15:87547607-87547629 CTAGGGAGGGAGGAGGTAGCAGG + Intergenic
1131508833 15:93037769-93037791 CTGGGGAGAGCTGAGGGAGCAGG + Intronic
1131758977 15:95599023-95599045 CTGGGGAGAGACTTGGTAACGGG - Intergenic
1132143068 15:99410589-99410611 CTGGGGAGAGGGGAGGGAGCTGG - Intergenic
1132538647 16:496726-496748 CTGTGGAGATACGAGGTGGGCGG - Intronic
1132804174 16:1768114-1768136 GTGAGGGGACACGAGGTGGCTGG - Intronic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1138470752 16:57233889-57233911 CTGGGGAGGAACAAGGTAGAGGG - Intronic
1138595567 16:58027344-58027366 CTCGGGAGACACCATGGAGCTGG - Intronic
1139441446 16:66969757-66969779 CTGGTGAGACAAGAGGCAGGAGG + Exonic
1140959764 16:79900472-79900494 CTGGGGAGAGACGACAGAGCAGG + Intergenic
1141727555 16:85799750-85799772 CAGGTGAGACAGGAGGTGGCCGG + Exonic
1143443773 17:6995705-6995727 CTGGGGAGCCAGGAGGAAGTAGG - Intronic
1145093632 17:20006263-20006285 TTTGGGAGACAAGAGGTAGAAGG - Intergenic
1146211500 17:30946992-30947014 CTGGGCAGATAGGAGGGAGCTGG - Intronic
1147131920 17:38414887-38414909 CTGAGGAGCCACTAGGTGGCAGG - Intergenic
1147605061 17:41769718-41769740 CTGGGCAGACACTGGGGAGCAGG + Intronic
1147886761 17:43689525-43689547 CTGGGGAGACCCCAAGAAGCAGG + Intergenic
1148663983 17:49361580-49361602 CTGGGGCGGCACGGGTTAGCGGG - Intronic
1149640601 17:58200065-58200087 CTGGAGAGACATGAAGCAGCTGG - Intronic
1150833128 17:68541253-68541275 CTGTGGAGGGACGAGGAAGCAGG - Intronic
1151879754 17:76887908-76887930 CTGGGGGGCCATGAGGGAGCGGG - Intronic
1152794294 17:82299293-82299315 CTGGGAAGCCACGTGGGAGCTGG + Intergenic
1156338173 18:36187700-36187722 CTTGGGGGACACGAGGTTTCTGG + Intronic
1156448546 18:37253939-37253961 CTGGCGAGACACGAGGGACGAGG + Intronic
1157506151 18:48228151-48228173 CTGGGGAGACAGGACCTGGCTGG + Intronic
1158249631 18:55473201-55473223 CTCGGGAGAAAAGAGGTATCAGG - Intronic
1160350522 18:78174517-78174539 ACGGAGAGACACGAGGTGGCCGG + Intergenic
1160383874 18:78482092-78482114 ATGGGGAGCCCCGAGGTGGCAGG - Intergenic
1160812351 19:1018268-1018290 CTGGGGAGAGAGGAGGCGGCAGG - Intronic
1161357538 19:3827370-3827392 CTGGGGAGATCAGAGGGAGCTGG - Intronic
1162532826 19:11245713-11245735 CTGGGGACACCAGAGGCAGCTGG + Intronic
1162630825 19:11925535-11925557 CTGGGGAGACGCGGGGCTGCGGG - Intronic
1162635695 19:11965467-11965489 CTGGGGAGACGCGGGGCTGCGGG - Intronic
1162643926 19:12035260-12035282 GTGGGGAGACGCGGGGCAGCGGG + Intronic
1162646243 19:12052520-12052542 CTGGGGAGACGCGGGGCTGCGGG + Intronic
1162668692 19:12237194-12237216 CTGGGGAGACGCGGGGCCGCGGG + Intronic
1162687620 19:12400803-12400825 CTCGGGAGACGCGAGGCTGCGGG + Intronic
1162691940 19:12440647-12440669 CTGGGGAGACCCGGGGCTGCGGG + Intronic
1162696982 19:12484372-12484394 CTGGGGAGACGCGAGGCTGCGGG + Intronic
1162966923 19:14160492-14160514 CTGGGGAGACATGGGCTGGCAGG - Intronic
1163851951 19:19669190-19669212 CTGGGGAGACGCGGGGCTGCGGG - Intronic
1165709891 19:38003618-38003640 CTGGGCAGCTACGAGGCAGCAGG - Intronic
1165996798 19:39849353-39849375 CTGGAGAGACAGGAGGTGACGGG - Intergenic
926287927 2:11505386-11505408 CTGGAGAGACAGGAAGGAGCTGG - Intergenic
926302769 2:11616451-11616473 CTGAGGAGACAGGAGGGAGTGGG - Intronic
926607340 2:14910535-14910557 CTAAGGAGACAAGAGGTAGTTGG + Intergenic
927352481 2:22133678-22133700 CTGGGAAGACAAGAGGAAGGAGG - Intergenic
927510844 2:23642857-23642879 GTGGGGAGGCACGTGGCAGCAGG - Intronic
927894711 2:26774339-26774361 CCCGGGAGACAGGAGGTAGGAGG - Intronic
931829653 2:66037655-66037677 CTGGGGAGACAGGAAGTGCCTGG + Intergenic
934558238 2:95298764-95298786 CTGGGGAGACTTGAGGTGACAGG - Intronic
936461020 2:112713842-112713864 CTGGGGAGACACGACCTGTCAGG + Intergenic
945065550 2:205944878-205944900 TTTGAGAGACACGAGGAAGCTGG + Intergenic
946197539 2:218044052-218044074 GTGGGGAGAGACCAGGCAGCAGG + Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
948098970 2:235358658-235358680 CTGAGGAGACACGGGGAAGAAGG - Intergenic
948155608 2:235778615-235778637 CAGGGGAGCCACATGGTAGCCGG - Intronic
948464392 2:238145277-238145299 ATGGGGTGCCACGAGGTTGCAGG + Intronic
1169016795 20:2298892-2298914 CCGGGCAGACAGGAGGCAGCTGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1170573458 20:17645954-17645976 CTGGGGAGTGACCAGGGAGCAGG + Intronic
1170683052 20:18543950-18543972 CTGGGGAGCCACGGTGCAGCAGG + Intronic
1171346542 20:24469954-24469976 CTTGGGAGACACGGGGTCGCAGG + Intronic
1172135407 20:32683365-32683387 CTGGGGAGACAGACAGTAGCTGG - Intergenic
1174889903 20:54380455-54380477 CTCGGGAGAGAGGAGGTGGCTGG + Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175414490 20:58792806-58792828 ATGGGGAGACAGGAGTTAACTGG - Intergenic
1175491377 20:59383125-59383147 ATGGGGACACAGGAGGTACCAGG - Intergenic
1175589551 20:60177718-60177740 CTGGGGTGACAGGTGGTAGAGGG + Intergenic
1178096171 21:29218056-29218078 CTGGGGAGACTGGAGGAAGTGGG - Intronic
1178625774 21:34217331-34217353 CTGGAGAGAGACTGGGTAGCTGG - Intergenic
1179967810 21:44817299-44817321 TTGGGGAGACACGAAGGAGAGGG + Intronic
1181008148 22:20024277-20024299 CTGCGGAGATAGGAGGGAGCAGG + Intronic
1181439988 22:22930800-22930822 CTGGGGAGACCACAGGCAGCAGG + Intergenic
1183253737 22:36747438-36747460 CTGTGGAGACATGAAGGAGCAGG - Intergenic
1183303532 22:37070094-37070116 GAGGTGTGACACGAGGTAGCAGG - Intronic
1183397422 22:37580036-37580058 GCGGGGAGACACAAGGTAGAAGG - Exonic
1184244459 22:43228875-43228897 CTGGGGAGACAAGGGGTAGCAGG - Intronic
1184338517 22:43870921-43870943 CTGGGTAGACACCCAGTAGCGGG + Intergenic
1184485807 22:44778529-44778551 CTGGGTAGACACCCAGTAGCGGG + Intronic
949190000 3:1240663-1240685 CTGGGTAGACACCAAGTAGTGGG - Intronic
950284144 3:11731779-11731801 CAGGGGAGACACGTGGAAGCTGG - Intergenic
954631405 3:52049644-52049666 CTGGGGAGACATTAGGTGGTGGG - Exonic
954707848 3:52490520-52490542 CAGGGGAGTCACCAGGTCGCTGG - Intronic
957787881 3:84905140-84905162 GTGGGGAGAGACCAGGCAGCAGG - Intergenic
958036173 3:88172737-88172759 GTGGGGAGACATGATGAAGCTGG + Intergenic
964998183 3:162914589-162914611 CTGGCCAAACACAAGGTAGCTGG - Intergenic
966724771 3:183099452-183099474 CTGGGGAGTCACGGAGTGGCCGG - Exonic
968359756 3:198138744-198138766 CTGGGGAGAGACGAGGGAGGAGG - Intergenic
968639412 4:1704622-1704644 CAGGGGAAGCACGAGGTTGCTGG - Intronic
968872592 4:3249308-3249330 CTGGGGAGACACGAGGTAGCCGG - Exonic
970586260 4:17517325-17517347 ATGGAGAGACACGAGGGAGAGGG + Intronic
972350135 4:38229100-38229122 TTTGGGAGACACCAGGTAGATGG + Intergenic
973965266 4:56155430-56155452 CTGGGGATACATGAGGAACCAGG + Intergenic
976700702 4:87966314-87966336 GTGGGGAGAGACCAGGCAGCAGG - Intergenic
981502973 4:145472644-145472666 CAGGGGAGAGACCAGGTAGGAGG - Intergenic
983468463 4:168125112-168125134 CTTGGGAGACATGAGGCAGAGGG + Intronic
984850170 4:184145719-184145741 CTGGGGAGGCAGGAGATGGCTGG - Intronic
985494671 5:197908-197930 AGGGGGAGACACGGGGCAGCAGG - Exonic
985505654 5:278820-278842 CTGGGGACACAGGAGGGTGCTGG + Intronic
985746893 5:1652903-1652925 CTGGGGGGACACGAGGAAGATGG + Intergenic
986503961 5:8430083-8430105 GTGGGGAGACGCCAGGCAGCAGG + Intergenic
990033614 5:51292223-51292245 GTGGGGAGACACGGAGTAACAGG + Intergenic
992186569 5:74250251-74250273 ATGGGGAGACACAAGGGTGCTGG + Intergenic
992379471 5:76223066-76223088 CTGGACAGACAAGGGGTAGCTGG - Intronic
995337993 5:111024577-111024599 CTGGGGAAAAAGGAGGTAGGAGG - Intergenic
996295883 5:121915975-121915997 CTGGGGAGAGACTTGGCAGCTGG - Intergenic
998049888 5:139023472-139023494 CTGAGGAGACACGTGGGAGAAGG + Intronic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
999734120 5:154499867-154499889 CTGGGGAGTCAAGGGCTAGCAGG - Intergenic
1000019323 5:157305254-157305276 CTGGGTAGACACCCGGTAGTAGG + Intronic
1000052702 5:157575924-157575946 CTGGCGAGACTCGGGGGAGCGGG + Intergenic
1002061883 5:176630205-176630227 CTGGGGCGACAGGAGGGAGCTGG - Intronic
1005097165 6:22129694-22129716 CTGGGCAGACACATGGTAGTGGG + Intergenic
1005218174 6:23555740-23555762 CTAGGGAGACACCTGGTAGGAGG - Intergenic
1005830428 6:29666818-29666840 TTGGGGAGACACTTGGTAGGAGG - Intronic
1005856030 6:29863965-29863987 CTGGGGAGGCAGGAGGTAAAGGG + Intergenic
1007393285 6:41562805-41562827 ATGGGGAGACAGGAGGGAGGGGG - Intronic
1013053861 6:106564133-106564155 CTGGGGAGAAAAGAGGGAGAGGG - Intronic
1013536348 6:111066482-111066504 CTGGGGAGGCTCCAGGAAGCAGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1017160715 6:151363096-151363118 CTGGGGAGACAGGAGTGACCGGG - Intergenic
1019260232 7:77906-77928 CTGGGGAGAGACGAGGGAGGAGG + Intergenic
1019537529 7:1537091-1537113 CTGCGGAGGCACACGGTAGCCGG - Intronic
1024350663 7:48359559-48359581 ATGGGGAGACAGGACATAGCTGG - Intronic
1025901903 7:65751359-65751381 CTGCGGAGCCCCGAGGCAGCGGG - Intergenic
1026068809 7:67099602-67099624 CTGGGGAGACAAGAAGCAGCAGG + Intronic
1026355416 7:69553097-69553119 CTGGGGAGGCTGGAGGTAGGAGG - Intergenic
1026708105 7:72712724-72712746 TTGGGGAGACAAGAAGCAGCAGG - Intronic
1033140468 7:138821888-138821910 ATGGAGAGACAGGAGGCAGCGGG + Intronic
1034958799 7:155351585-155351607 CTGGGGAGGCATGAGGAAGGCGG + Intergenic
1036076958 8:5512796-5512818 CTGGGGTGACAGGAGGTGGAAGG + Intergenic
1038219402 8:25593205-25593227 TTGGGAAGACAGGAGGTAGAAGG + Intergenic
1039799856 8:40944730-40944752 CTGGGGAGCCCTGAGGTCGCAGG - Intergenic
1039858554 8:41437060-41437082 CTGGGCAGACAGGAGGTAACTGG - Intergenic
1041638241 8:60167884-60167906 CTGGGTAGACACCTGGTAGTGGG - Intergenic
1042294464 8:67204389-67204411 ATGGGGAGGCACGGGGAAGCAGG - Intronic
1042616540 8:70655701-70655723 CTGGGTAGACACCCAGTAGCTGG + Intronic
1048339368 8:133526843-133526865 GTGGGGAGAGATGAGGAAGCAGG + Intronic
1048846285 8:138606288-138606310 CTGAGGACACAGGAGGTGGCAGG + Intronic
1049158726 8:141083974-141083996 CTGGGGAGGCCCCAGGAAGCTGG - Intergenic
1049814390 8:144591401-144591423 CTGGGGGGACCAAAGGTAGCAGG + Intronic
1056862852 9:90203142-90203164 CTGGGGAGAGAGCAGGCAGCAGG + Intergenic
1057751081 9:97793725-97793747 CTGGGATGAAAGGAGGTAGCAGG + Intergenic
1058510262 9:105710755-105710777 TTGGGGAGACGGCAGGTAGCGGG + Intronic
1059676345 9:116544222-116544244 CTGGGGAGAAATGAGGTATTTGG + Intronic
1060457134 9:123809066-123809088 GTGGGGAGACAGGAGGCAACAGG + Intronic
1061054573 9:128215575-128215597 CTGGGGAGGCAGCAGGCAGCTGG + Intronic
1062044688 9:134419590-134419612 CTGGGGAGAAACCAGGCACCAGG - Intronic
1062172680 9:135144221-135144243 CTGGGGGGACCCTAGGAAGCAGG - Intergenic
1062498342 9:136842016-136842038 CTGGGGACACAAGAGGCTGCAGG + Intronic
1062722572 9:138052020-138052042 CTGGGGGGCCACGTGGGAGCTGG + Intronic
1062744459 9:138202565-138202587 CTGGGGAGAGACGAGGGAGGAGG - Intergenic
1185933252 X:4226948-4226970 CTGGGTAGATACCAAGTAGCTGG - Intergenic
1188049953 X:25472838-25472860 CTGGGGATACAGGAGGCTGCTGG - Intergenic
1192481861 X:71492781-71492803 CTGGGGAGGCGTGAGTTAGCCGG - Intronic
1193467741 X:81868647-81868669 GTGGGGAGAAGCCAGGTAGCTGG + Intergenic
1194093250 X:89603619-89603641 CTGGGGTGATACAGGGTAGCAGG - Intergenic
1194892609 X:99398640-99398662 CTAGGGAGACATAAGCTAGCAGG - Intergenic
1199669017 X:150126506-150126528 CTGGGTAGATACCAAGTAGCGGG - Intergenic
1200445882 Y:3259722-3259744 CTGGGGTGATACAGGGTAGCAGG - Intergenic