ID: 968874203

View in Genome Browser
Species Human (GRCh38)
Location 4:3256734-3256756
Sequence AGGTTGTGATAAGTGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968874199_968874203 18 Left 968874199 4:3256693-3256715 CCATGCGGGGAAGACACATGGGT 0: 1
1: 0
2: 0
3: 5
4: 106
Right 968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 195
968874197_968874203 19 Left 968874197 4:3256692-3256714 CCCATGCGGGGAAGACACATGGG 0: 1
1: 0
2: 0
3: 4
4: 94
Right 968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968874203 Original CRISPR AGGTTGTGATAAGTGCTGGA AGG Intronic
901186697 1:7378167-7378189 AGCTTTACATAAGTGCTGGAGGG + Intronic
907769190 1:57442998-57443020 GGGTTGAGAGAAGTGCTGGTGGG - Intronic
907965089 1:59321246-59321268 AAGTTGTGATGAGTGCTGTAAGG - Intronic
908795032 1:67822507-67822529 TGATTGAGATAAGTGCTAGAAGG + Intronic
910680556 1:89859770-89859792 AGCTTGTGATCAGTCCTGCACGG + Intronic
913706940 1:121434640-121434662 AGCTTGTGATAAATGCTGCCTGG - Intergenic
916078608 1:161218090-161218112 AGGGTGGGGTAAGGGCTGGAAGG + Intronic
916517345 1:165532117-165532139 AGGTAGTGCTAAGTGCTGTGAGG + Intergenic
918559487 1:185847559-185847581 AGGATAGGATAGGTGCTGGATGG - Intronic
921092982 1:211860460-211860482 AGGTGGTGAGAAGTGAGGGATGG + Intergenic
921503151 1:215931619-215931641 AGGTTGAGATGAGGCCTGGAGGG + Intronic
922572788 1:226643729-226643751 AGGAGGTGATGAGGGCTGGAGGG + Intronic
923262651 1:232282261-232282283 AGGAGGTGATAACTGCTGGCTGG - Intergenic
1063590236 10:7388268-7388290 AGATGGTGATAAGTGCTATAGGG + Intronic
1064913956 10:20435510-20435532 AGGTTTTAAAAAGTGCTGAAGGG - Intergenic
1070337171 10:75466256-75466278 AGGTAGTGTAAAGTGTTGGATGG + Intronic
1075302207 10:121335039-121335061 AGGTAGTGATAAGTGCTATGGGG - Intergenic
1075573608 10:123562714-123562736 AGGTGGTGATAAGAGCTAGGCGG - Intergenic
1078662476 11:13298462-13298484 AGATGGTGATAAGTGCTAGGAGG - Intronic
1079120317 11:17678895-17678917 ATATTGTGCTCAGTGCTGGATGG - Intergenic
1080645293 11:34183610-34183632 AGGTAGGGCTGAGTGCTGGAGGG - Intronic
1083903683 11:65656227-65656249 AGGATGTGAGCAGTGCAGGAAGG - Intronic
1085050323 11:73376868-73376890 AGGTTGTGGTGCGGGCTGGACGG + Intronic
1086725293 11:90174905-90174927 AGTTTGTGTTAAGTGCTATAAGG - Intronic
1087476306 11:98639380-98639402 TGGTTGTGATAAGTTCTACATGG - Intergenic
1089523389 11:119080695-119080717 AGGTGGTGATAAGTTCTGAGTGG + Intronic
1090406836 11:126481160-126481182 AGGTGTTGATAAGTACTAGAAGG + Intronic
1095328917 12:40933151-40933173 ACATTGTGATCAGTGCTGCATGG - Intronic
1096237213 12:49937739-49937761 AGGTAGAGACAAGGGCTGGAGGG + Intergenic
1099757580 12:86873763-86873785 AGGTTGTGATGAATAGTGGATGG - Intergenic
1099764131 12:86960679-86960701 AGGTTGTGGTAAACGCTGGCAGG + Intergenic
1100593117 12:96047762-96047784 AGGTTTTGATAAGTGCTTGCAGG + Intergenic
1100875745 12:98959774-98959796 AGCTTGTGATGAATGCTGGCAGG - Intronic
1101127090 12:101647265-101647287 ACATTGTGAAAAGAGCTGGAGGG + Intronic
1101733451 12:107445205-107445227 AGGTTTTGCTAAGTGCTTGTGGG - Intronic
1103468457 12:121160937-121160959 AGGTTGTAAAAAGGGATGGATGG + Exonic
1106484887 13:30163283-30163305 AGGTTGTGATTAGTGATCGTGGG - Intergenic
1107364401 13:39655224-39655246 AGGTTGTGATGAGTGCTCAGGGG - Intergenic
1109649993 13:65312052-65312074 AAGTTGTGATAAGTGTTTCATGG - Intergenic
1110798193 13:79664722-79664744 AGATTCTGATGAGTGCAGGAGGG - Intergenic
1111925671 13:94460984-94461006 AGGTTGTGCTAAGTGTAGCATGG + Intronic
1112966467 13:105202561-105202583 AGCTTGTGATAAGGGGAGGAAGG + Intergenic
1113581655 13:111434368-111434390 AGGTTGTGCTAAGACCTAGATGG + Intergenic
1114883480 14:26816396-26816418 AGGTAGTGATAAGTGCTATGAGG - Intergenic
1116269435 14:42742237-42742259 AGGGGGTGATAAATGCTGGCTGG - Intergenic
1117795387 14:59388416-59388438 AGCTTATGATAAATGCTGCAAGG + Intergenic
1117981292 14:61344534-61344556 AGGTAGTGGAGAGTGCTGGATGG + Intronic
1119477246 14:74937958-74937980 AGCTGGTGGAAAGTGCTGGAAGG - Intergenic
1124413858 15:29458509-29458531 AGGCTTTGAGAAGAGCTGGAGGG - Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1126100706 15:45116722-45116744 ACGCTATGGTAAGTGCTGGAGGG + Exonic
1127396405 15:58546993-58547015 AGTTTGGGATGAGGGCTGGATGG - Intronic
1127921505 15:63497955-63497977 ACAGTGTGATAAGTGCTAGAAGG - Intergenic
1129930636 15:79407719-79407741 AAGTTGTGATAGGGGCTGTATGG + Intronic
1130333086 15:82936292-82936314 AGGTTGTGCTTAGTGCCAGAGGG - Intronic
1134570817 16:15289619-15289641 AGCTTCTTATAAGTGGTGGAGGG + Intergenic
1134691200 16:16191989-16192011 AGGTTGTGGGAAGTGCTGTGGGG + Intronic
1134731561 16:16466455-16466477 AGCTTCTTATAAGTGGTGGAGGG - Intergenic
1134935889 16:18245546-18245568 AGCTTCTTATAAGTGGTGGAGGG + Intergenic
1136276377 16:29181460-29181482 AGGTTCTGGTCAGTGCTGGGAGG + Intergenic
1136515466 16:30765514-30765536 AGGTTGTGAGAAGGGGTGGGAGG - Intronic
1137322725 16:47401575-47401597 AGGTTGTGAAAAGTTCTGGGAGG + Intronic
1137732564 16:50699486-50699508 AGGTTGTGAAATGTGCTCGCAGG + Exonic
1137778458 16:51076440-51076462 AGGTTTGGATTAATGCTGGACGG - Intergenic
1137927384 16:52553560-52553582 GGGTTGGGATAAGAGGTGGAAGG - Intergenic
1138223435 16:55272407-55272429 AGGCTGTGATTACAGCTGGAAGG + Intergenic
1138403135 16:56765418-56765440 AGGTTGTTTTAAGTCCAGGATGG - Intronic
1139603767 16:68003222-68003244 TTGTTGTGATAAGTGATGAAAGG + Intronic
1139710628 16:68773061-68773083 GGCTTGTTATAAGTGGTGGAAGG + Intronic
1140113480 16:72022640-72022662 ATGTTGGAATAAGTGCTTGAAGG + Intronic
1140527367 16:75634222-75634244 TCGTTGTGATAAGTGATGAAAGG + Exonic
1140856374 16:78981395-78981417 TGGATGTGATACGTGCTGCATGG - Intronic
1147291073 17:39443599-39443621 GGGTTGTGATGAGTTCTGGAGGG - Exonic
1150602950 17:66666263-66666285 GGGATGTGATAAATGTTGGATGG + Intronic
1151418108 17:73979897-73979919 AGGTACTAATGAGTGCTGGAGGG + Intergenic
1151898027 17:76993484-76993506 AGGTTGTGCTAAGAGATGGAAGG - Intergenic
1153979723 18:10298416-10298438 AGGCTGTGCTGAGGGCTGGATGG + Intergenic
1155124517 18:22858735-22858757 AGGTTGTGATACTTTGTGGAAGG - Intronic
1158216623 18:55107023-55107045 TGGTTGTGATAATTGCTCTAAGG - Intergenic
1158222848 18:55168145-55168167 AGGTTGTGATGAGCTCTTGACGG - Intergenic
1159920401 18:74222309-74222331 AGGTTCTGATAAGCCCAGGAAGG + Intergenic
1160061162 18:75530311-75530333 AGCTTGTGAAAGGAGCTGGATGG + Intergenic
1162496500 19:11026057-11026079 AGGGTGTGAAGAGTGCTGTATGG + Intronic
1166079628 19:40435451-40435473 AGGTGGTGATAAATGCTGTGGGG - Intergenic
1166808272 19:45499692-45499714 AAGTATTGATTAGTGCTGGAAGG + Intronic
1167776778 19:51563780-51563802 AGGTTGTGATTAGGGTGGGAGGG - Intergenic
927212360 2:20646629-20646651 AGGTGGTGAAAAGTGCAGCAAGG + Intronic
929730943 2:44491241-44491263 AGGTTGTGCCAATGGCTGGAGGG + Intronic
930190363 2:48452876-48452898 ATGTTGAGAAAAGTGCTAGAGGG - Intronic
935543705 2:104378534-104378556 AGGTTTTTATAAGTCCAGGATGG + Intergenic
937099149 2:119255268-119255290 AGGTTGAGATGAGGGGTGGAGGG - Intronic
937440442 2:121910815-121910837 ATGTTATGCTAAGTGTTGGATGG - Intergenic
937658138 2:124400291-124400313 AGGTGGTGATAAATGTAGGAAGG + Intronic
939099924 2:137884077-137884099 AGGTTGTGATAAGGGCTATGAGG + Intergenic
947394205 2:229671461-229671483 AGGTAGTGAGAAGTGCTGTGCGG - Intronic
948555712 2:238809494-238809516 AGTTTGTGATAGGGGCTAGAAGG - Intergenic
948700163 2:239754629-239754651 AGATATTGATAAGTGGTGGATGG + Intergenic
948718743 2:239882963-239882985 AGATTGTGACAAGGGCTGGCAGG + Intergenic
1171070206 20:22061396-22061418 ATGTTGAGAAAAGTGCTAGAAGG - Intergenic
1172160500 20:32864687-32864709 AGGTTGTGATAATAGTGGGATGG + Intronic
1172419032 20:34798110-34798132 AGGTTGTGATGAATGCTGCCAGG - Intronic
1172829751 20:37823607-37823629 AGGTTTAGATCATTGCTGGAAGG + Intronic
1172895906 20:38299931-38299953 AGCTTGTGGTAGATGCTGGAGGG - Intronic
1174081109 20:47971403-47971425 AGGTTCTGACAAGTGATGAATGG - Intergenic
1174505252 20:51013508-51013530 ATGTTTTAATAGGTGCTGGAAGG + Intronic
1175641139 20:60631442-60631464 AGGGTGTGTTCAGTTCTGGATGG - Intergenic
1176451775 21:6869072-6869094 AGGTTGTGATAAGGGCTATGTGG + Intergenic
1176829947 21:13734123-13734145 AGGTTGTGATAAGGGCTATGTGG + Intergenic
1178413740 21:32387150-32387172 AGGTTGTATTAATTGCAGGAAGG - Intronic
1179403064 21:41102318-41102340 AGGCTGTGACAGCTGCTGGAAGG + Intergenic
1182160604 22:28117394-28117416 AGGCTGTGACAAGGGCTGGGAGG - Intronic
1183230270 22:36577836-36577858 TGGTTGTGATGACTTCTGGAGGG + Intronic
1185419745 22:50728779-50728801 AGGTGGTGGTGACTGCTGGAGGG - Intergenic
949801580 3:7910294-7910316 AGGTTGTGAGATGTTCTTGATGG - Intergenic
950434162 3:12968386-12968408 AGCTTGTCATAGGTGCTTGAAGG - Intronic
952673052 3:35994126-35994148 AGCTTGTGATAAATGCTGCCAGG - Intergenic
954540128 3:51387990-51388012 AGATGGTGCTAAATGCTGGAGGG + Intronic
955885663 3:63595671-63595693 AGTGTGTGATAAGTGCCTGATGG + Intronic
958693189 3:97494587-97494609 GTGTTCTGATAAATGCTGGATGG - Intronic
958847169 3:99278725-99278747 AGCAGGTGATGAGTGCTGGAAGG - Intergenic
959868501 3:111299918-111299940 AGTTTGTGATGAGTGCTGCCAGG + Intronic
960939012 3:122921688-122921710 AGGTACTGATAAGTGCTTTATGG + Intronic
960969865 3:123131698-123131720 TGCTTGCGATAAGGGCTGGAAGG + Intronic
962431694 3:135326221-135326243 AGGTTCTGATTTGTGCAGGAAGG + Intergenic
963179463 3:142338747-142338769 AGCTTGTGATAAATGCTGCCTGG - Intronic
963286801 3:143441549-143441571 AGGTTGTCCTAAATGCTTGAAGG - Intronic
963634307 3:147775213-147775235 GTTTAGTGATAAGTGCTGGAAGG - Intergenic
964253732 3:154750400-154750422 AGGTAGTGGTAAGTGCTGCCAGG - Intergenic
965099607 3:164278768-164278790 AGCTTGTGGTAAGTGCTGCCAGG - Intergenic
965644626 3:170867448-170867470 AAGCAGTGATAAGTGCTGTAAGG - Intronic
967551144 3:190796999-190797021 AGGTTGTGGTAAATGCTGCTTGG - Intergenic
968095186 3:195924816-195924838 AGGATGTGAGCAGTGGTGGAAGG - Intergenic
968874203 4:3256734-3256756 AGGTTGTGATAAGTGCTGGAAGG + Intronic
970113880 4:12670988-12671010 AGGGAGTGGCAAGTGCTGGAAGG + Intergenic
970380784 4:15505455-15505477 AGTTTCTCATAAGTGCTGGCTGG - Intronic
971010286 4:22426630-22426652 AGATTGTGATAACTGCTACAAGG + Intronic
972091666 4:35293985-35294007 TAGTTGTGATTTGTGCTGGAAGG + Intergenic
972158541 4:36195793-36195815 AGGTTGTGTTAAGTGCTATGAGG - Intronic
972343502 4:38173264-38173286 AGGTGGTGCTAAGTGCTGGGAGG + Intergenic
975835719 4:78420536-78420558 TGCTTGTGATAAATGCTGTAGGG - Intronic
975919616 4:79369599-79369621 AGGTTGGGAGAAGTGGAGGATGG + Intergenic
979688373 4:123536706-123536728 AGGTGGGGATAAGTTGTGGAAGG - Intergenic
980731723 4:136832666-136832688 ATGTTCTGATAAGTGCTGCCTGG + Intergenic
982435025 4:155375287-155375309 AGGTTATAATTAGAGCTGGAGGG + Intronic
982572353 4:157066203-157066225 AGGCCGTGATAAGGGCTGTAAGG + Intergenic
982932719 4:161429019-161429041 AGCTTGTGGTAAGTGCTGCTAGG - Intronic
983503558 4:168527797-168527819 CGGTTGGGCTAAGTCCTGGAGGG + Intronic
989970726 5:50521258-50521280 AGCTTGTGATAAATGCTGCCTGG + Intergenic
990801713 5:59611481-59611503 AGGTTGTGATGAGTGTTACAAGG - Intronic
993211549 5:84958758-84958780 AGGTTGTAACAAGTGCAGTAAGG + Intergenic
993794171 5:92246856-92246878 AGGTTGTCAGAAGTACTGGGTGG + Intergenic
994361530 5:98855144-98855166 TGGTGGTGGTAAGTGCTTGAGGG + Exonic
995354110 5:111218126-111218148 AGGAAGTGATAAATGCTTGAAGG - Intergenic
995487226 5:112651550-112651572 AGGTGGTGAGAAGTGAGGGATGG - Intergenic
995573127 5:113502716-113502738 AGCTTGTGATAAATGCTGCCAGG + Intergenic
996708480 5:126520824-126520846 AGGATGTGATCAGTACTGAATGG - Intergenic
997645454 5:135478748-135478770 AAGTTGGGATAAGTGGTGGCGGG + Intergenic
998505489 5:142668870-142668892 AGGTTGTGCCAAGGGCTGGGGGG + Intronic
1000751305 5:165099383-165099405 ATGTTGATATAAATGCTGGAAGG - Intergenic
1001061441 5:168493132-168493154 TGGTGGTGATGAGTGCTGGGAGG + Intronic
1001270680 5:170309435-170309457 AGGTCATGATAAATGCTGTAAGG + Intergenic
1002026700 5:176400710-176400732 AAGTTTTGATAAGTGCTTGAAGG - Intronic
1004089803 6:12489349-12489371 AGGCTGTGCTGAGTGCTGAAAGG - Intergenic
1009040235 6:58167256-58167278 AGGTAGAGATAAATGCTGTATGG + Intergenic
1009216132 6:60922115-60922137 AGGTAGAGATAAATGCTGTATGG + Intergenic
1010041298 6:71388134-71388156 AGGTGGTGACAACTGCTGCAAGG + Intergenic
1013296689 6:108764035-108764057 AGGTAGTGATAAGTGCTAAGAGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016057346 6:139592607-139592629 AGGAAGTGATAAATGCTGAAAGG + Intergenic
1021831167 7:24611761-24611783 AGGTGGTGGTAAGTGCAGGGAGG + Intronic
1022946024 7:35284386-35284408 AGGTTCTGAAAAGTCCTGCAGGG + Intergenic
1023760544 7:43461654-43461676 AGGTTATGAAGAGTGATGGATGG - Intronic
1024369079 7:48559374-48559396 AGCTTGTGATAAATGCTGCCAGG + Intronic
1028221466 7:88201938-88201960 AGGCTGTGATTTGTGTTGGATGG + Intronic
1030662594 7:112238018-112238040 AGGTGGGGATGATTGCTGGAGGG - Intronic
1030746285 7:113170510-113170532 AGATGGTGGTAAGTGCTGTAGGG - Intergenic
1031038847 7:116817649-116817671 AGCATGGGATAAGTGCTAGAAGG + Intronic
1033875434 7:145811255-145811277 AGCTTGTGGTGAGTGCTGCATGG - Intergenic
1035963073 8:4158707-4158729 GGGTTGTGATAAGGACTGAATGG - Intronic
1036505085 8:9347654-9347676 AGGTTGTGGTAGCTGATGGAAGG + Intergenic
1039664933 8:39515320-39515342 AGGTTGTTACAAATGATGGATGG + Intergenic
1039911949 8:41833177-41833199 AGGGTCTGATGGGTGCTGGAGGG - Intronic
1044085989 8:87942598-87942620 AACTTGTGATAAGCACTGGAGGG + Intergenic
1046090673 8:109499814-109499836 AGGATGTGATATGAGCTGAAGGG + Intronic
1047158328 8:122347644-122347666 AGGTAGTGAAAAGTGCTCTAAGG + Intergenic
1049526981 8:143131889-143131911 GGGTTGTGAGAAGTGGTGGCAGG - Intergenic
1054880649 9:70141503-70141525 AGGTTGTGGTAAGTGCTGTCAGG + Intronic
1059590438 9:115653778-115653800 AGCTTGTGTTAAGAGCTGCAAGG - Intergenic
1059744877 9:117190155-117190177 AGCTCCTGCTAAGTGCTGGAAGG + Intronic
1060443957 9:123670369-123670391 AGGTGGTGACAAGGGCTTGAGGG + Intronic
1203517406 Un_GL000213v1:15443-15465 AGGTTGTGATAAGGGCTATGTGG - Intergenic
1185725334 X:2416097-2416119 AGGTTGTGATGAGATCTGGTTGG - Intronic
1188341047 X:29002362-29002384 AGGTGGTAATTACTGCTGGAAGG + Intronic
1188707399 X:33352666-33352688 AGGTGGTGATAAGTGCTGAAAGG - Intergenic
1188876747 X:35440207-35440229 GGGTTGTGATAAGAGGTGGTAGG - Intergenic
1190458245 X:50645680-50645702 AGGTTGGGAGAGGTGGTGGAGGG + Intronic
1191029541 X:55953232-55953254 AGGTAGTGGTAAGTGCTGCAAGG + Intergenic
1191149226 X:57202990-57203012 AGCTTGTGCTAAATGCTGCATGG + Intergenic
1192605320 X:72510477-72510499 TGATGGTGAAAAGTGCTGGAAGG + Intronic
1192667312 X:73101559-73101581 AGGTTGTCATAAATGCTGCCTGG + Intergenic
1193396611 X:80991029-80991051 AGTTTGTGATAAATGCTGCCAGG - Intergenic
1193619867 X:83738432-83738454 AGCTTGTGTTAAATGCTGCATGG - Intergenic
1197126692 X:122955198-122955220 AGGTTGTGAGAAGGGGTGAAGGG - Intergenic
1198514136 X:137387461-137387483 AAATTCTGATAAGTGCTTGAAGG + Intergenic
1199193937 X:145004788-145004810 AGGTTGTGATAAGGGGTTGTGGG + Intergenic
1199324471 X:146481154-146481176 AGGTTGGGAAATGTACTGGAGGG - Intergenic