ID: 968876476

View in Genome Browser
Species Human (GRCh38)
Location 4:3270360-3270382
Sequence GGCCTCGGGGTCCAAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968876476_968876483 7 Left 968876476 4:3270360-3270382 CCTGGACTTTGGACCCCGAGGCC 0: 1
1: 0
2: 0
3: 20
4: 478
Right 968876483 4:3270390-3270412 TACCCCTGCAATGCAGCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968876476 Original CRISPR GGCCTCGGGGTCCAAAGTCC AGG (reversed) Intronic
900654222 1:3747142-3747164 GGCCCCGGGGACCCAAGGCCGGG + Intergenic
901063667 1:6485209-6485231 GGCCGCGGGGCCCATAGTCACGG + Intronic
901318595 1:8325070-8325092 GGCCTTAGGGTCCAAAGTGGAGG + Intronic
901697593 1:11020657-11020679 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
902374684 1:16024817-16024839 GGCCACAGGGTACACAGTCCAGG - Exonic
902379631 1:16046589-16046611 GGCCACAGGGTACACAGTCCAGG - Exonic
902531501 1:17093658-17093680 GCCCTCGGGGCCCCAGGTCCAGG + Exonic
902578795 1:17395450-17395472 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
902730839 1:18367851-18367873 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
904667422 1:32133789-32133811 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
904763739 1:32825023-32825045 GGCATGGGAGTCCAAAGACCTGG - Intronic
905277255 1:36826417-36826439 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
905434132 1:37945488-37945510 AGCCTCGTGGTCCAAATGCCTGG - Intronic
905569040 1:38989746-38989768 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
905661756 1:39732656-39732678 TGCCTCGGCTTCCAAAGTGCTGG + Intronic
905856559 1:41318385-41318407 GGCCTTGGGGTCCAGCATCCAGG - Intergenic
907471517 1:54677087-54677109 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
907474613 1:54697480-54697502 GGCCTTGGGGTCGGGAGTCCTGG + Intronic
908243165 1:62205100-62205122 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
909067331 1:70950962-70950984 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
912359832 1:109086227-109086249 TGCCTCGGGCTCCAAAGTGCTGG - Intergenic
913091871 1:115481617-115481639 GGCCTTGGGCTTCAAAATCCTGG + Intergenic
913447025 1:118960715-118960737 GGCTTCGTGTTCCAAAGTCCAGG + Intronic
914729493 1:150358066-150358088 AGCCTCGGCCTCCAAAGTGCTGG + Intergenic
914809643 1:151017501-151017523 GGGCTCGAGATCCAAAGTGCTGG - Intronic
914853003 1:151328553-151328575 GGCCTCAGGTACCAAAGTGCTGG + Intergenic
915110246 1:153559893-153559915 CGCCTCGGGTTCTAAAGTGCTGG - Intergenic
915155236 1:153870197-153870219 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
915181626 1:154066361-154066383 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
915357887 1:155267337-155267359 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
915400412 1:155617733-155617755 GCCCTCGGCCTCCAAAGTACTGG - Intergenic
918227833 1:182502329-182502351 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
918425476 1:184405442-184405464 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
918602416 1:186379192-186379214 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
919637835 1:200020629-200020651 GGCCTCGGCTCCCAAAGTGCTGG - Intergenic
919892048 1:201982741-201982763 GGCCTCGGCCTCCAACTTCCGGG + Exonic
920096904 1:203492290-203492312 GGCCTCTGGCTGCAAAGCCCAGG + Intergenic
921259038 1:213369421-213369443 GCCCTATGGGGCCAAAGTCCTGG + Intergenic
921861947 1:220049810-220049832 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
922173559 1:223177560-223177582 CCCCTCAGGGTCCAAAGGCCAGG + Intergenic
922954941 1:229591272-229591294 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
923185382 1:231568209-231568231 GGCCTCGGCCTCCCAAGTGCTGG - Intronic
923328330 1:232899788-232899810 TGTCTGGGGGTCTAAAGTCCAGG + Intergenic
923634898 1:235685595-235685617 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
923684572 1:236145002-236145024 GGCCCAGGGGCCCAAAGTCACGG + Intronic
924148796 1:241106463-241106485 GGCCTCGGCTTCCCAAGTGCTGG - Intronic
924633660 1:245765135-245765157 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
924729700 1:246699961-246699983 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1063613397 10:7582121-7582143 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1064107647 10:12513535-12513557 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1065553017 10:26888005-26888027 GGCCTCTGCATCCAAAGACCAGG - Intergenic
1066356743 10:34691981-34692003 TGCCTCGGCCTCCAAAGTACTGG - Intronic
1066382250 10:34911635-34911657 TGCCTCGGGTCCCAAAGTGCTGG - Intergenic
1066581445 10:36886664-36886686 GGCCTCTGCATCCAAAGGCCAGG - Intergenic
1068182977 10:53546200-53546222 GGCCTTGGCTCCCAAAGTCCTGG - Intergenic
1068851741 10:61750325-61750347 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1068901691 10:62276981-62277003 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1069162778 10:65111260-65111282 AGCCTCTGGGGTCAAAGTCCTGG + Intergenic
1069456843 10:68560628-68560650 GGCCCCGGGCTCCAAAGTTGTGG + Intergenic
1069494844 10:68894305-68894327 TGCCTCGGCTTCCAAAGTGCTGG + Intronic
1069715463 10:70518149-70518171 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1070134254 10:73677632-73677654 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1070780645 10:79135706-79135728 GGCTTTGGGGTCCAAGGGCCAGG + Intronic
1073239442 10:102046402-102046424 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1073476536 10:103757332-103757354 GGCCTGGGTCTCCAGAGTCCTGG - Intronic
1074259849 10:111840825-111840847 GGCTTCTGGGTCCTGAGTCCTGG + Intergenic
1074352123 10:112747946-112747968 GGTCTAGGAGTCCAACGTCCAGG - Intronic
1074591222 10:114815547-114815569 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1075148750 10:119907046-119907068 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1075430498 10:122375493-122375515 GGCCTCGGCGTCGAAAGACCTGG - Intronic
1076295558 10:129381087-129381109 GGCCTGGAAGTCCAAGGTCCAGG - Intergenic
1077348982 11:2081833-2081855 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1077594017 11:3516022-3516044 GACCTCGGGGTCAGAAGTCGAGG + Intergenic
1078199083 11:9163553-9163575 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1079097784 11:17522079-17522101 GGCCTCGACCTCCAAAGTGCTGG + Intronic
1080476424 11:32596341-32596363 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1080570800 11:33555030-33555052 GGCCTACGGGTTCAAAGTCATGG - Intronic
1080946476 11:36980104-36980126 AGCCTCAGCCTCCAAAGTCCTGG + Intergenic
1081886312 11:46499899-46499921 TGCCTCGGCCTCCAAAGTACTGG + Intronic
1083599953 11:63940389-63940411 TACCTCGGGCTCCAAAGTCAGGG - Intronic
1083836209 11:65270078-65270100 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1083931148 11:65846319-65846341 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1084391548 11:68880555-68880577 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1084653625 11:70502812-70502834 GTCGTCGGGGTCCAGATTCCTGG + Exonic
1085053379 11:73390963-73390985 GGCCCCAGGATCCAGAGTCCTGG - Intronic
1085184984 11:74568233-74568255 GGCCTCTGGGTCCAGGGTTCAGG + Intronic
1085187195 11:74585685-74585707 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1085453523 11:76653231-76653253 GACCTCAGGGTCCAGAGTTCAGG + Intergenic
1085533929 11:77207052-77207074 GGCCTTGGCGTCCAGAGTCCTGG - Intronic
1085632827 11:78133650-78133672 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1086268777 11:85034322-85034344 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1087450204 11:98311132-98311154 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1087680744 11:101216303-101216325 AGCCTCAGGGGTCAAAGTCCTGG + Intergenic
1088280592 11:108130638-108130660 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1088882293 11:113981707-113981729 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1088919001 11:114248146-114248168 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1089015270 11:115160213-115160235 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1089431647 11:118429979-118430001 GGCTTCGGCTTCCAAAGTGCTGG - Intronic
1091459278 12:631608-631630 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1092278305 12:7079727-7079749 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1094253345 12:28392757-28392779 GGCCTCAAGCTCAAAAGTCCAGG + Intronic
1095443455 12:42260832-42260854 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1096051624 12:48614769-48614791 TGCCTCAGCCTCCAAAGTCCTGG + Intergenic
1096432505 12:51558502-51558524 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1096710102 12:53449197-53449219 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1098144466 12:67484634-67484656 GGCCCCAGAGTCCAGAGTCCTGG - Intergenic
1098681692 12:73364264-73364286 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1098987547 12:77028720-77028742 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1100613397 12:96210983-96211005 GGCATCTGGCTCCAAAGTCCAGG - Intronic
1101142928 12:101814446-101814468 TGCCTCGGCTTCCAAAGTGCGGG - Intronic
1101167164 12:102050367-102050389 GGCCTCGGCCTCCCAAGTGCTGG - Intronic
1101501635 12:105309584-105309606 AGCCTCAGGGGTCAAAGTCCTGG - Intronic
1101918570 12:108914924-108914946 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1102059397 12:109921424-109921446 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1102085100 12:110130614-110130636 CACCTCGGGTTCCAAAGTGCTGG + Intronic
1102105051 12:110314078-110314100 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1102181667 12:110917343-110917365 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1102376405 12:112425100-112425122 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1103623694 12:122203877-122203899 GGCCGCGGGGTGCAAAGGCACGG - Intronic
1104494530 12:129224656-129224678 TGCCTCGACGTCCAAAGTGCTGG - Intronic
1104584401 12:130036441-130036463 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1104681181 12:130752940-130752962 GGCCTCGGGGACTTAAGGCCTGG - Intergenic
1106001744 13:25730039-25730061 CACCTCGGCCTCCAAAGTCCTGG - Intronic
1106079767 13:26490416-26490438 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1107897741 13:44983101-44983123 TGCCTCAGCCTCCAAAGTCCTGG + Intronic
1110195583 13:72784507-72784529 GGCCTCAGCATCCAAAGTGCTGG - Intronic
1112459575 13:99591701-99591723 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1113079518 13:106503537-106503559 GGACTCGAGGTCCTAAGTTCTGG + Intronic
1113990271 14:16023057-16023079 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1114063287 14:19038641-19038663 GTCCTCGGGAGCCACAGTCCAGG + Intergenic
1114098968 14:19361354-19361376 GTCCTCGGGAGCCACAGTCCAGG - Intergenic
1114357747 14:21931262-21931284 TACCTCGGCCTCCAAAGTCCTGG + Intergenic
1114585631 14:23810583-23810605 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1116828949 14:49698914-49698936 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1117523176 14:56571478-56571500 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1119087867 14:71753669-71753691 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1119510954 14:75210827-75210849 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1119531241 14:75362753-75362775 TGCCTCGGCTTCCAAAGTGCTGG + Intergenic
1121382010 14:93479880-93479902 TGCCTCAGGCTCCAAAGTGCTGG + Intronic
1121803997 14:96798052-96798074 GGCCTCGCGGTCCCCAGGCCTGG - Intronic
1122915786 14:104858070-104858092 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1123216929 14:106818587-106818609 AGCCTCGGCCTCCAAAGTGCCGG - Intergenic
1123493257 15:20799544-20799566 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1123549764 15:21368646-21368668 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1125857214 15:42961994-42962016 GACCTCGTGATCCAAAGTGCTGG + Intronic
1125918632 15:43511046-43511068 GGGCTGGGGCTCCGAAGTCCCGG + Intronic
1126640258 15:50817465-50817487 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1128329117 15:66744436-66744458 GGCCACCGGATCCCAAGTCCAGG + Intronic
1128908402 15:71490174-71490196 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1129409547 15:75341636-75341658 GGCCATGGGGTCCAGATTCCAGG - Intronic
1129534026 15:76296194-76296216 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1130053638 15:80504517-80504539 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1131032839 15:89200831-89200853 CGCCTCGGCCTCCAAAGTGCTGG - Exonic
1132064939 15:98723021-98723043 GGACTTGGGGTCCCAAGTCTAGG + Intronic
1132192098 15:99874166-99874188 GGCCTCTGGATTCAATGTCCAGG - Intergenic
1202958095 15_KI270727v1_random:95864-95886 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1132509718 16:333082-333104 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1132954411 16:2583869-2583891 GGCCCCGGGGTCCCACGTACGGG + Intronic
1132959934 16:2616294-2616316 GGCCCCGGGGTCCCACGTACGGG - Intergenic
1133816339 16:9200143-9200165 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1133817578 16:9209895-9209917 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1134130798 16:11648652-11648674 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1134539369 16:15052583-15052605 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1136477091 16:30520183-30520205 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1136909429 16:34134129-34134151 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1138014128 16:53413678-53413700 TGCCTGGTCGTCCAAAGTCCTGG - Intergenic
1138513206 16:57520689-57520711 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1138690425 16:58762806-58762828 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1138690443 16:58762940-58762962 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1139494576 16:67307005-67307027 GGGCTTGGGCTCCAGAGTCCTGG - Intronic
1139739011 16:69018672-69018694 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1140065871 16:71610721-71610743 TGCCTCAGCCTCCAAAGTCCTGG - Intergenic
1140327986 16:74024280-74024302 GCCCTAGGATTCCAAAGTCCAGG - Intergenic
1141402098 16:83757877-83757899 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1141519565 16:84569070-84569092 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1142196997 16:88743549-88743571 GGCCTCGGGGCGCAAACTCAGGG + Intronic
1142368736 16:89665829-89665851 TGCCTCGGCCTCCAAAGTGCCGG - Intronic
1142585701 17:971915-971937 CGCCTCGGCTTCCAAAGTGCTGG - Intronic
1143235689 17:5398150-5398172 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1143828249 17:9630327-9630349 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1144084690 17:11798182-11798204 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1144094546 17:11888230-11888252 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1144644923 17:16966003-16966025 CACCTCGGGCTCCAAAGTGCTGG - Intronic
1144776504 17:17787634-17787656 GGCCGCAGGGCCCACAGTCCAGG - Intronic
1145801739 17:27691085-27691107 AGCCTCAGGGATCAAAGTCCTGG + Intergenic
1146374796 17:32286846-32286868 GGCCTTGGTGGGCAAAGTCCGGG - Intronic
1146930692 17:36775756-36775778 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1147033210 17:37658543-37658565 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1147120253 17:38331342-38331364 GGCCTGGGGATCCTGAGTCCCGG + Exonic
1147754079 17:42756608-42756630 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1147788609 17:42998517-42998539 GGCTTGGGGGTCGAAGGTCCGGG + Exonic
1148199435 17:45740138-45740160 GGCCACAGGACCCAAAGTCCAGG - Intergenic
1148220019 17:45854542-45854564 TGCCTTGGGCTCCAAAGTGCTGG - Intergenic
1148485289 17:47987056-47987078 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1148757977 17:49984529-49984551 GGCCTCAAGGCCCAAATTCCTGG - Intergenic
1150408227 17:64920245-64920267 CGCCTCGGCCTCCAAAGTACTGG - Intergenic
1150591801 17:66569317-66569339 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1151307354 17:73271833-73271855 GCCCTCTGGCTGCAAAGTCCTGG + Intergenic
1151961881 17:77409859-77409881 CGCCTCGGGGCCCAAAGTGTGGG + Intronic
1152012631 17:77727744-77727766 GGCTTCTAGGTCCAATGTCCTGG + Intergenic
1152271724 17:79328897-79328919 GGACTCAGGGTCCGAGGTCCTGG + Intronic
1152619300 17:81353673-81353695 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1152650215 17:81489070-81489092 GCCCTCGGGGAGCAAAGTTCCGG - Intergenic
1154021668 18:10668830-10668852 AGCCGAGGGGCCCAAAGTCCTGG - Intronic
1154073378 18:11176104-11176126 GGCCTGGGGTTCCAGGGTCCAGG - Intergenic
1154450812 18:14474082-14474104 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1155060949 18:22227922-22227944 AGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1155526281 18:26719269-26719291 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1156585247 18:38424704-38424726 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1156876965 18:42026142-42026164 GACCTGGGAGCCCAAAGTCCTGG + Intronic
1156974815 18:43207595-43207617 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1157271592 18:46280415-46280437 GGCCTAGAGGTCCAGAGGCCTGG + Intergenic
1157642541 18:49232549-49232571 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1157703554 18:49781230-49781252 GGCCTTGGCCTCCAAAGTGCTGG + Intergenic
1158401266 18:57123333-57123355 GGCCACTGGGGCCAAAGTCCAGG + Intergenic
1159961326 18:74557694-74557716 GGGCTTGGGGTACAAAGTCCAGG - Intronic
1160717075 19:581295-581317 GGCCTAGGGGACCAAAGGCAAGG - Exonic
1161105165 19:2439979-2440001 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1161272150 19:3395908-3395930 GACCTCGGGTCCCAAAGTGCTGG + Intronic
1161369870 19:3905105-3905127 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1161428373 19:4216881-4216903 GGCCTCAGCTTCCATAGTCCTGG - Exonic
1161663224 19:5559986-5560008 GGTCTCTGGGGACAAAGTCCTGG + Intergenic
1161830759 19:6602510-6602532 CGCCTCGGCCTCCAAAGTGCAGG - Intronic
1162022343 19:7873604-7873626 GGCCTGGGGGTCAGAAGTCCAGG + Exonic
1162108704 19:8387947-8387969 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1162230544 19:9262373-9262395 GTCCTTGGAGCCCAAAGTCCTGG - Intergenic
1162525828 19:11205721-11205743 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1162841623 19:13360724-13360746 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1163014665 19:14447053-14447075 CGCCTCGGTTTCCAAAGTGCTGG - Intronic
1163770493 19:19188275-19188297 TGCCTCGGGCTCCAAAGTGCTGG + Intronic
1164378196 19:27708284-27708306 AGCCTCAGGGGTCAAAGTCCCGG + Intergenic
1164557057 19:29261456-29261478 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1164605887 19:29597890-29597912 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1165073372 19:33268172-33268194 GGCCCCGGGGAACAGAGTCCAGG + Intergenic
1165420579 19:35720167-35720189 CGCCTGGGGGTCCCAGGTCCTGG - Exonic
1165529570 19:36386686-36386708 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1165541582 19:36496504-36496526 CGCCTCGGGCTCCCAAGTGCTGG + Intergenic
1166043058 19:40214697-40214719 AGCCTCGGGGGCCAAAGCCCTGG - Intronic
1167019123 19:46861167-46861189 GGCCCCGGCCTCCAAAATCCCGG - Intergenic
1167130156 19:47580003-47580025 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1167315071 19:48758049-48758071 GTCCTCGGGGTGCAGGGTCCCGG - Exonic
1167432256 19:49461535-49461557 GGGCTGGGGGTCCAGATTCCTGG + Intronic
1167432683 19:49463121-49463143 GGGCTGGGGGTCCAGACTCCTGG + Intronic
1167432776 19:49463376-49463398 GGGCTGGGGGTCCAGATTCCTGG + Intronic
1167432871 19:49463631-49463653 GGGCTGGGGGTCCAGACTCCTGG + Intronic
1167614214 19:50523030-50523052 GCCCTCTGGTTCCAGAGTCCTGG + Intronic
1168156294 19:54474705-54474727 TGCCTCGGCTTCCAAAGTGCTGG + Intergenic
1168235778 19:55062431-55062453 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1168266114 19:55224888-55224910 GGCCTGGGGGCCCGAACTCCTGG - Intergenic
1168283476 19:55319042-55319064 AGCCTCAGCCTCCAAAGTCCTGG + Intronic
1168514706 19:57001731-57001753 GGCCTCGGCCTCCCAAGTGCTGG + Intergenic
926037837 2:9648976-9648998 TGCCTCGAGGTCTAGAGTCCTGG - Intergenic
926398251 2:12467988-12468010 TGCCTCTGGGTCCAAAGCACTGG + Intergenic
927716692 2:25357803-25357825 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
928418718 2:31120803-31120825 GGCCTCGGCCCCCAAAGTGCTGG + Intronic
928610158 2:32984670-32984692 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
929120929 2:38483562-38483584 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
929654774 2:43719685-43719707 CGCCTCGGCCTCCAAAGTCCTGG + Intronic
929740599 2:44595352-44595374 CGCCTCAGCGTCCAAAGTGCTGG + Intronic
930073880 2:47391109-47391131 GGCCTCGGCCTCCAAAGTGCTGG - Intergenic
930215278 2:48689960-48689982 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
931599975 2:63993335-63993357 AGCCTCAGGGGTCAAAGTCCTGG - Intronic
932495701 2:72144836-72144858 GCGCTCGGGTTCCAAACTCCAGG - Intronic
933664232 2:84951697-84951719 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
933673196 2:85028735-85028757 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
933803298 2:85980113-85980135 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
934944562 2:98529485-98529507 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
935633378 2:105230952-105230974 GGCCTCTGAGACCAGAGTCCTGG + Intergenic
936390748 2:112071071-112071093 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
936698741 2:114984348-114984370 CGCCTTGGGTTCCAAAGACCAGG + Intronic
937134699 2:119542813-119542835 GGCCTCGGCTCCCAAAGTGCTGG - Intergenic
937869477 2:126777103-126777125 GGCCCCAGGGTCCACATTCCTGG - Intergenic
937978902 2:127600459-127600481 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
938128864 2:128693838-128693860 AGCCTCGGGAGCCAAAGGCCAGG - Intergenic
938219296 2:129551834-129551856 GGCCTCGGGGCTCCCAGTCCAGG + Intergenic
939311518 2:140483887-140483909 CGCCTCGGCGCCCAAAGTGCTGG + Intronic
940879991 2:158936871-158936893 TGCCTCGGCCTCCAAAGTACTGG + Intergenic
940919030 2:159287101-159287123 GGCCTCGGAGTACACAGTGCAGG - Intergenic
941173106 2:162163733-162163755 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
941395964 2:164972810-164972832 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
941416530 2:165228296-165228318 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
941802824 2:169679428-169679450 TGCCTCGGCTTCCAAAGTGCTGG - Intronic
942572064 2:177324632-177324654 CACCTGGGGCTCCAAAGTCCTGG + Intronic
943433565 2:187834356-187834378 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
944853730 2:203746291-203746313 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
945278661 2:208014393-208014415 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
946262219 2:218503465-218503487 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
947435576 2:230069245-230069267 GGCCTTGGCCTCCAAAGTGCTGG + Intergenic
948145383 2:235704397-235704419 GGCCTCGGCCTCCCAAGTGCTGG - Intronic
948456715 2:238107844-238107866 CGCCTCGGGCTGCAAAGTGCAGG - Exonic
948878055 2:240840754-240840776 TGCCTCGGGATCCACAGCCCAGG + Intergenic
949046603 2:241875092-241875114 GGCCTCGGGGGCCCAACTGCAGG + Intergenic
949046619 2:241875144-241875166 GGCCTCGGGGGCCCAACTGCAGG + Intergenic
949046635 2:241875196-241875218 GGCCTCGGGGGCCCAACTGCAGG + Intergenic
949046651 2:241875248-241875270 GGCCTCGGGGGCCCAACTGCAGG + Intergenic
1168969246 20:1919505-1919527 GGCCTCGGGGGCCAAGGTAGGGG + Intronic
1169658288 20:7950839-7950861 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1169889482 20:10436602-10436624 CGCCTTGGCCTCCAAAGTCCTGG + Intronic
1170183831 20:13564750-13564772 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1170885961 20:20340089-20340111 GGCCTCGGGGCCCAAGCTCCTGG - Intronic
1171563270 20:26149625-26149647 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1171771605 20:29326615-29326637 GGGCCCGGGGCCCACAGTCCTGG + Intergenic
1171780433 20:29411757-29411779 GAGCTCGGGGCCCAAGGTCCCGG + Intergenic
1172908563 20:38388423-38388445 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1173169555 20:40713024-40713046 CCCCTGGGGGTCCAAAGGCCAGG - Intergenic
1173605166 20:44326697-44326719 GGCCGCGGGGCCCTAACTCCCGG + Intergenic
1173645419 20:44630090-44630112 GGCCTGGGAGGCCAAAGTGCTGG - Intronic
1173726399 20:45301268-45301290 GCCCTCGGAGGCCACAGTCCAGG + Intronic
1173750352 20:45470799-45470821 GGCCGCGGGGAACAATGTCCCGG - Intronic
1173789802 20:45820888-45820910 TGCCTCGGCTTCCAAAGTGCTGG + Intergenic
1174204004 20:48826604-48826626 GACCTCGGCCTCCAAAGTGCAGG - Intronic
1174805601 20:53601929-53601951 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1176013091 20:62910998-62911020 GGCCTCGGAGCCCACAGTCTCGG + Exonic
1176445421 21:6816492-6816514 GTCCTCGGGAGCCAGAGTCCAGG + Intergenic
1176823589 21:13681525-13681547 GTCCTCGGGAGCCAGAGTCCAGG + Intergenic
1178244924 21:30941277-30941299 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1178593895 21:33935622-33935644 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1178775674 21:35548153-35548175 GGCCTCGGAACTCAAAGTCCAGG - Intronic
1179477252 21:41655012-41655034 TGCCTCGGGTCCCAAAGTGCTGG - Intergenic
1179787562 21:43738343-43738365 GGCACGGGGGTCCAAGGTCCAGG - Intronic
1180006350 21:45022769-45022791 AACCTGGGGGTCCAAAGCCCAGG + Intergenic
1180093942 21:45546049-45546071 GGCCTAGGGGCCCAAAGGTCTGG + Intergenic
1180317001 22:11284469-11284491 GGGCCCGGGGCCCACAGTCCTGG + Intergenic
1180338326 22:11599040-11599062 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1180481779 22:15761270-15761292 GTCCTCGGGAGCCACAGTCCAGG + Intergenic
1182548552 22:31089314-31089336 GGCCGCTGGGTCCACGGTCCTGG + Intronic
1182718066 22:32376066-32376088 GGGCTCTGGGAGCAAAGTCCTGG - Intronic
1184127320 22:42496865-42496887 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1184706694 22:46218911-46218933 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
952370359 3:32716896-32716918 TGCCTCGGCCTCCAAAGTACTGG + Intronic
952384856 3:32832922-32832944 TGCCTCGGCATCCAAAGTGCTGG - Intronic
952822314 3:37495953-37495975 GGCCTCAGGGAGCCAAGTCCAGG - Intronic
953265738 3:41385854-41385876 GGCCTAGGAGCCCAAAGCCCTGG - Intronic
954207781 3:49073290-49073312 GGCCTTGGCCTCCAAAGTACAGG - Intronic
955670257 3:61394479-61394501 GCCCTCTGGCTGCAAAGTCCTGG - Intergenic
956420860 3:69085274-69085296 GGCCTCGGGGTGCAAGATCCCGG + Intronic
956725182 3:72151128-72151150 GGCTCCAGGGTCCAATGTCCAGG + Intergenic
956823276 3:72973161-72973183 GGCTGATGGGTCCAAAGTCCTGG + Intronic
957084646 3:75668754-75668776 GAACTCGGGGCCCAAGGTCCCGG - Intergenic
957519573 3:81301224-81301246 GGCCTGAGTGTCAAAAGTCCAGG - Intergenic
960621978 3:119645987-119646009 GGACTGGGAGTCCAAAGTCCTGG - Intronic
961210875 3:125124573-125124595 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
961483930 3:127204260-127204282 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
961768954 3:129234193-129234215 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
961923086 3:130448325-130448347 AGCCTCAGGGGTCAAAGTCCTGG + Intronic
961941835 3:130646324-130646346 TGCCTCGGGCTCCCAAGTGCTGG - Intronic
963221917 3:142822163-142822185 TGCCTCGGCCTCCAAAGTACTGG + Intronic
963888312 3:150604785-150604807 AGCCTCGGCCTCCAAAGTGCTGG - Intronic
964487494 3:157200648-157200670 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
966409385 3:179632838-179632860 CGCCTCGGTCTCCAAAGTGCTGG - Intergenic
966861037 3:184230878-184230900 GGCGTCGGGGTCCCCAGCCCCGG - Exonic
967007003 3:185393704-185393726 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
967579608 3:191136816-191136838 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
967732668 3:192920172-192920194 CGCCTCGGCCTCCAAAGTACTGG - Intergenic
968119028 3:196111381-196111403 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
968141023 3:196256789-196256811 CGCCTTGGTGTCCAAAGTGCTGG + Intronic
968876476 4:3270360-3270382 GGCCTCGGGGTCCAAAGTCCAGG - Intronic
969044548 4:4327422-4327444 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
969745653 4:9069137-9069159 GACCTCGGGGTCAGAAGTCGAGG - Intergenic
970060470 4:12027438-12027460 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
970323906 4:14903321-14903343 GGCCTGTGGGTCCAGACTCCTGG - Intergenic
971384434 4:26130108-26130130 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
972335320 4:38102628-38102650 TGCCTCAGCCTCCAAAGTCCTGG - Intronic
972465707 4:39354831-39354853 TGCCTCGGCCTCCAAAGTGCCGG - Intronic
972642956 4:40942401-40942423 GTCCTCGGGCTCTAGAGTCCTGG + Intronic
973329074 4:48894240-48894262 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
973803466 4:54500938-54500960 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
974024387 4:56720372-56720394 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
974068059 4:57098589-57098611 GGCCTCTGGCTCCGAAGCCCTGG + Intronic
974531922 4:63119275-63119297 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
974605595 4:64146225-64146247 AGCCTCAGGGGTCAAAGTCCTGG + Intergenic
976237971 4:82921005-82921027 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
976768839 4:88628923-88628945 CGCCTCGGCCTCCCAAGTCCCGG - Intronic
977373709 4:96172419-96172441 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
978691529 4:111518497-111518519 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
980731087 4:136824757-136824779 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
982334794 4:154222329-154222351 TGCCTCGGCTTCCAAAGTGCTGG - Intergenic
985446326 4:190022819-190022841 GAGCTCGGGGCCCAAGGTCCCGG + Intergenic
987360611 5:17103133-17103155 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
987738174 5:21871482-21871504 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
988006358 5:25416718-25416740 CGCCTCAGCCTCCAAAGTCCTGG + Intergenic
989318433 5:40107913-40107935 AGCCTCAGGGGTCAAAGTCCTGG - Intergenic
991717052 5:69460872-69460894 TGCCTCGGCTTCCAAAGTGCTGG - Intergenic
991722999 5:69511329-69511351 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
992194571 5:74326544-74326566 GGCCTTGGCCTCCAAAGTGCTGG + Intergenic
992791716 5:80219957-80219979 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
993179612 5:84535235-84535257 TGCCTCGGCGTCCCAAGTACCGG + Intergenic
993858298 5:93102463-93102485 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
995487713 5:112655993-112656015 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
995497268 5:112759602-112759624 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
996708101 5:126517604-126517626 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
996719501 5:126616342-126616364 CGCCTCGGCGTCCAAAGTGCTGG + Intronic
997498998 5:134356523-134356545 TGCCTTGGGCTCCAAAGTGCTGG - Intronic
997751164 5:136347154-136347176 GGGCTAGAGGTCCAAAGTCAAGG - Intronic
998836630 5:146208201-146208223 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
999135775 5:149317868-149317890 GGTGTCGGGGCCCAAAGCCCGGG - Exonic
999254775 5:150204198-150204220 GGCCTTGTGATCCAGAGTCCTGG + Intronic
1000434252 5:161188379-161188401 CGCCTCGGCATCCAAAGTGCTGG + Intergenic
1000927967 5:167216675-167216697 GGCCTTGGCCTCCAAAGTGCTGG - Intergenic
1001830321 5:174781449-174781471 GGCCTCAGCCTCCAAAGTGCTGG + Intergenic
1002307784 5:178293908-178293930 GGCCACGGAGTCCAGAGGCCAGG + Intronic
1003150146 6:3541203-3541225 GGCCTCTGGGTCAGAAGTCCAGG - Intergenic
1004024141 6:11802872-11802894 TGCCTCGGTCTCCAAAGTGCTGG - Intronic
1004908120 6:20256374-20256396 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1005077255 6:21920338-21920360 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1005080623 6:21953237-21953259 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1005774512 6:29116218-29116240 CGCCTCGGCTTCCAAAGTGCTGG + Intergenic
1006051807 6:31351179-31351201 AGCCTCAGGGTCCAGTGTCCAGG + Intronic
1006905771 6:37532427-37532449 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1007310523 6:40942246-40942268 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1008089303 6:47277239-47277261 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1009405646 6:63309181-63309203 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1010033364 6:71291892-71291914 AGGCTCTGGGTCCCAAGTCCAGG - Intronic
1010379807 6:75211160-75211182 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1010492399 6:76491671-76491693 AGCCTCAGGGGTCAAAGTCCTGG + Intergenic
1010700293 6:79036671-79036693 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1012173055 6:96043297-96043319 CGCCTCGGGTCCCAAAGTGCTGG + Intronic
1013528433 6:110997048-110997070 CGCCTCGGCGTCCCAAGTGCTGG + Intronic
1013752769 6:113426296-113426318 GGCCTGGGGGTACAAAGCCCAGG - Intergenic
1016566065 6:145455604-145455626 CGCCTCGGCATCCAAAGTGCTGG + Intergenic
1017143696 6:151215135-151215157 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1017181906 6:151562633-151562655 GGGCTGGGGGTGCAGAGTCCTGG + Intronic
1017820304 6:158044261-158044283 GGACTCAGGGTCCCCAGTCCTGG + Intronic
1019413082 7:915012-915034 GGCCTCGGGCCCCAGAGCCCCGG - Intronic
1019562799 7:1666544-1666566 GCCCTAGGGGTCCGGAGTCCTGG - Intergenic
1020018219 7:4844195-4844217 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1020072975 7:5239650-5239672 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1021402015 7:20220110-20220132 GGCCGTGGGGTGCAGAGTCCAGG + Intergenic
1021635942 7:22693228-22693250 GGCCTCAGCCTCCAAAGTGCTGG + Intergenic
1023678691 7:42660095-42660117 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1025959365 7:66206205-66206227 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1026293663 7:69031178-69031200 TGCCTCGGCCTCCAAAGTACTGG - Intergenic
1026465446 7:70649774-70649796 CGCCTCGGTGTCCAAAGTGCTGG + Intronic
1026763793 7:73146570-73146592 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1026775081 7:73226267-73226289 GGGCTGGAGGTTCAAAGTCCTGG + Intergenic
1027015937 7:74779638-74779660 GGGCTGGAGGTTCAAAGTCCTGG + Intronic
1027040263 7:74956342-74956364 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1027072092 7:75166299-75166321 GGGCTGGAGGTTCAAAGTCCTGG - Intergenic
1027083375 7:75246014-75246036 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029262901 7:99315410-99315432 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1030091605 7:105863266-105863288 GGCCTCTGTGGCCAGAGTCCTGG - Intronic
1030485388 7:110159698-110159720 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1030985474 7:116237227-116237249 GCCCTCAGGGTCCTAAGTCAAGG - Intronic
1031033990 7:116767065-116767087 AGGCTGAGGGTCCAAAGTCCAGG - Intronic
1032128999 7:129213835-129213857 CGCCTCGGGCTCCAAAGGGCTGG + Intergenic
1032243870 7:130190267-130190289 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1033126329 7:138710436-138710458 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1034159878 7:148985665-148985687 AACCTCGGGCTCCAAAGTGCTGG - Intergenic
1034244944 7:149636949-149636971 TGTCTGGGGGTCCAAAGCCCAGG + Intergenic
1034483698 7:151342921-151342943 GGCCTCGGCCTCCCAAGTGCTGG + Intronic
1035105485 7:156438914-156438936 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1035221474 7:157408895-157408917 GGGCTCGGGGCCCGAAGTGCTGG + Intronic
1035461346 7:159041057-159041079 AGTCTCGGGATCCAAAGCCCAGG - Intronic
1036249308 8:7147973-7147995 GACCTCGGGGTCAGAAGTCGAGG + Intergenic
1038211426 8:25522273-25522295 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1038442181 8:27578977-27578999 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1040716094 8:50254595-50254617 GGCCTCAGTCTCCAAAGTGCTGG - Intronic
1041048779 8:53913212-53913234 CGCCTCAGGCTCCAAAGTGCTGG + Intronic
1041914312 8:63124880-63124902 CGCCTCGGCTTCCAAAGTGCTGG + Intergenic
1045338442 8:101230525-101230547 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1047387539 8:124424060-124424082 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1048180357 8:132188923-132188945 GGCCTAGGGGTCCAGACTCCAGG - Intronic
1049298626 8:141856990-141857012 TGCCTCTGGGGCCAAAGGCCAGG - Intergenic
1049446396 8:142633424-142633446 AGGCTGGGGGTCCAAACTCCGGG + Intergenic
1051459619 9:17296265-17296287 TGCCTCGGCCTCCAAAGTGCTGG + Intronic
1052531804 9:29694659-29694681 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1052687693 9:31775600-31775622 AGCCTCAGGGGTCAAAGTCCTGG - Intergenic
1052794898 9:32914308-32914330 TGCCTCGGTCTCCAAAGTGCTGG - Intergenic
1053241397 9:36498698-36498720 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1053279085 9:36805825-36805847 ATCCTCTGGGGCCAAAGTCCAGG + Intergenic
1055792552 9:79938094-79938116 TGCCTCGGCTTCCAAAGTACAGG - Intergenic
1056361673 9:85863879-85863901 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1057015776 9:91649931-91649953 TGCCTCGGCCTCCAAAGTGCTGG - Intronic
1058665711 9:107313471-107313493 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1058957104 9:109959394-109959416 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1059555132 9:115272920-115272942 CGCCTCGGCCTCCAAAGTGCTGG + Intronic
1059924692 9:119196771-119196793 GTCCTCTGGTTCCAAAGCCCAGG + Intronic
1062142716 9:134968614-134968636 GGACTGGGTGTCCAATGTCCAGG + Intergenic
1203523774 Un_GL000213v1:68033-68055 GTCCTCGGGAGCCAGAGTCCAGG - Intergenic
1185602089 X:1347195-1347217 CGCCTCGGCCTCCAAAGTGCTGG - Intronic
1186532094 X:10307317-10307339 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1187424209 X:19162519-19162541 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1188823205 X:34799581-34799603 AGCCTCAGGGGTCAAAGTCCTGG - Intergenic
1189429112 X:40931582-40931604 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1189822640 X:44885273-44885295 GGCCTTGGCCTCCAAAGTGCTGG + Intronic
1191125029 X:56945387-56945409 AGCCTCAGGGGTCAAAGTCCTGG - Intergenic
1192361911 X:70445654-70445676 GGGCTCGGGGTCCACAGGCTTGG - Intronic
1194616128 X:96105721-96105743 CGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1196704321 X:118703780-118703802 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1196794767 X:119493253-119493275 GGCCTGGGCCTCCAAAGTGCTGG + Intergenic
1197058434 X:122148274-122148296 GGCCTTGGGGGCCTAACTCCTGG + Intergenic
1197803320 X:130375047-130375069 CGCCTCAGCCTCCAAAGTCCTGG + Intergenic
1198052388 X:132961477-132961499 GGCCTGGGAGTCCAGAGACCTGG + Intergenic
1198835638 X:140802124-140802146 CGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1200820724 Y:7580225-7580247 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic
1202239582 Y:22752517-22752539 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1202392569 Y:24386279-24386301 TGCCTCGGCCTCCAAAGTGCTGG + Intergenic
1202478215 Y:25283838-25283860 TGCCTCGGCCTCCAAAGTGCTGG - Intergenic