ID: 968879462

View in Genome Browser
Species Human (GRCh38)
Location 4:3291901-3291923
Sequence AAACCAATGGCATTCTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879462_968879470 18 Left 968879462 4:3291901-3291923 CCCACTGAGAATGCCATTGGTTT 0: 1
1: 0
2: 0
3: 13
4: 169
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879462 Original CRISPR AAACCAATGGCATTCTCAGT GGG (reversed) Intergenic
900739091 1:4319624-4319646 AAACCCATGGCATACTAGGTAGG - Intergenic
901173943 1:7284987-7285009 AAACCAATGGGTTTCCCAGAGGG - Intronic
902183070 1:14704378-14704400 ACACCAATGGCATTCCAAATTGG - Intronic
902459883 1:16566273-16566295 AAACCAACAGCAATGTCAGTAGG + Intronic
902693309 1:18123974-18123996 GCACCAGTGGCATTTTCAGTGGG - Intronic
903152894 1:21425336-21425358 AAACCAATAGCAATGTCAGCAGG + Intergenic
903153056 1:21426880-21426902 AAACCAATAGCAATGTGAGTAGG + Intergenic
903160072 1:21481101-21481123 AAACCAATAGCAATGTGAGTAGG - Intronic
903160237 1:21482645-21482667 AAACCAATAGCAATGTCAGCAGG - Intronic
904564094 1:31417093-31417115 AAACGAATGGCATTGTCAGAAGG + Intronic
911880326 1:103229493-103229515 AAACAAATGGCAATTTCAGGAGG + Intergenic
912579951 1:110711567-110711589 GAAAAAATGGCATTCTCATTGGG - Intergenic
912752653 1:112298551-112298573 AAAACCATGGCATTCTCACCTGG + Intergenic
913642390 1:120825030-120825052 AAACCAACAGCAATGTCAGTAGG - Intronic
913642569 1:120826570-120826592 AAACCAACAGCAATGTCAGTAGG - Intronic
913642749 1:120828110-120828132 AAACCAACAGCAATGTCAGTAGG - Intronic
913642941 1:120829928-120829950 AAACCAACAGCAATGTCAGTAGG - Intronic
913643709 1:120836681-120836703 AAACCAACAGCAATGTCAGTAGG - Intronic
913989332 1:143595927-143595949 AAACCAACAGCAATGTCAGTAGG + Intergenic
913989485 1:143597455-143597477 AAACCAACAGCAATGTCAGTAGG + Intergenic
914210890 1:145577877-145577899 AAACCAACAGCAATGTCAGTAGG + Intergenic
914269650 1:146068637-146068659 AAACCAACAGCAATGTCAGTAGG + Intronic
914270189 1:146073365-146073387 AAACCAACAGCAATGTCAGTAGG + Intronic
914270727 1:146078101-146078123 AAACCAACAGCAATGTCAGTAGG + Intronic
914271264 1:146082831-146082853 AAACCAACAGCAATGTCAGTAGG + Intronic
914271798 1:146087558-146087580 AAACCAACAGCAATGTCAGTAGG + Intronic
914272336 1:146092276-146092298 AAACCAACAGCAATGTCAGTAGG + Intronic
914272874 1:146096998-146097020 AAACCAACAGCAATGTCAGTAGG + Intronic
914273412 1:146101720-146101742 AAACCAACAGCAATGTCAGTAGG + Intronic
914273951 1:146106438-146106460 AAACCAACAGCAATGTCAGTAGG + Intronic
914274488 1:146111146-146111168 AAACCAACAGCAATGTCAGTAGG + Intronic
914275021 1:146115864-146115886 AAACCAACAGCAATGTCAGTAGG + Intronic
914275559 1:146120590-146120612 AAACCAACAGCAATGTCAGTAGG + Intronic
914276093 1:146125330-146125352 AAACCAACAGCAATGTCAGTAGG + Intronic
914485715 1:148107576-148107598 AAACCAACAGCAATGTCAGTGGG + Intronic
914532487 1:148535318-148535340 AAACCAACAGCAATGTCAGTAGG + Intronic
914533026 1:148540044-148540066 AAACCAACAGCAATGTCAGTAGG + Intronic
914533561 1:148544758-148544780 AAACCAACAGCAATGTCAGTAGG + Intronic
914534096 1:148549466-148549488 AAACCAACAGCAATGTCAGTAGG + Intronic
914534631 1:148554174-148554196 AAACCAACAGCAATGTCAGTAGG + Intronic
914535166 1:148558886-148558908 AAACCAACAGCAATGTCAGTAGG + Intronic
914535702 1:148563631-148563653 AAACCAACAGCAATGTCAGTAGG + Intronic
914536237 1:148568347-148568369 AAACCAACAGCAATGTCAGTAGG + Intronic
914537133 1:148576275-148576297 AAACCAACAGCAATGTCAGTAGG + Intronic
915639925 1:157216642-157216664 AAACCAACATCATGCTCAGTAGG + Intergenic
915957219 1:160231501-160231523 AAACCAAAGAGATTCTCATTTGG + Intronic
917048316 1:170888776-170888798 AAACCAATAGCATTCACATCTGG - Intergenic
917325451 1:173826980-173827002 ACCCAAATGTCATTCTCAGTAGG + Intronic
918410103 1:184249618-184249640 AAACAAATGGCATGCTCAAAAGG + Intergenic
919098378 1:193063721-193063743 AAATTAATGGCATTCTTAGTGGG - Intronic
920597285 1:207284986-207285008 AAAGCAATGGAATTGTTAGTGGG + Intergenic
921840625 1:219824389-219824411 AACCCAGTAGAATTCTCAGTGGG + Intronic
922660495 1:227425580-227425602 CCACCAATGGAAATCTCAGTTGG - Intergenic
1068535570 10:58237424-58237446 AAACAAATGGTATGCTCTGTTGG - Intronic
1068996127 10:63206641-63206663 AACCCAATGGAGTTCTCAGCAGG - Exonic
1069042252 10:63708198-63708220 AGACCAATCTCATCCTCAGTAGG + Intergenic
1070429803 10:76326307-76326329 AAAATAATGGCTTTCTCACTTGG - Intronic
1071199718 10:83206460-83206482 AAATTAAAGGCATTATCAGTTGG - Intergenic
1077202579 11:1318751-1318773 AAGCCGATGGCATACTCAGAAGG + Intergenic
1079806119 11:24932728-24932750 AACCCAATTGCCTTTTCAGTGGG - Intronic
1083175963 11:60950828-60950850 AAACCGATGGCAACCGCAGTGGG - Intronic
1088238126 11:107747062-107747084 AAAACACTGGCATTATAAGTGGG - Intergenic
1088976393 11:114820073-114820095 GATAAAATGGCATTCTCAGTAGG + Intergenic
1088976397 11:114820120-114820142 GATAAAATGGCATTCTCAGTAGG + Intergenic
1089984200 11:122797779-122797801 GAGGAAATGGCATTCTCAGTGGG + Intronic
1091038402 11:132254447-132254469 AAACAAAGTGCATTCACAGTGGG - Intronic
1091850973 12:3696724-3696746 AGACATCTGGCATTCTCAGTGGG + Intronic
1092600117 12:10051559-10051581 AAACAAATGGCATACTCAAGGGG - Intronic
1096877261 12:54639650-54639672 AAACAAATGGCACACTCAGGAGG - Intergenic
1101163212 12:102000691-102000713 AAACATATGGCAGTCTCAATAGG - Intronic
1101204440 12:102471563-102471585 AAACGAATGGCATTCTTCATGGG - Intronic
1103464494 12:121131346-121131368 AAAGCAATGGCATACTCAAGTGG + Intergenic
1104605056 12:130182021-130182043 AAAACCATGGCTTTCACAGTCGG + Intergenic
1111560856 13:89944738-89944760 AAAGCAATTGAATTCTCTGTGGG + Intergenic
1114186769 14:20408544-20408566 AAATCATTGGCATTATCAGGAGG - Intronic
1114331616 14:21642721-21642743 AAACCCGTGGATTTCTCAGTAGG + Intergenic
1119517201 14:75257609-75257631 AAATGAATGGCATTCGGAGTTGG - Intronic
1120252209 14:82071681-82071703 AAACCTGTGAGATTCTCAGTAGG + Intergenic
1120644214 14:87053004-87053026 GAACAGATGGCATTTTCAGTGGG - Intergenic
1120804273 14:88729103-88729125 AAATAACTGCCATTCTCAGTTGG - Intronic
1121003660 14:90471996-90472018 AAATAAATGGCATTTTCAGAAGG - Intergenic
1122014660 14:98784382-98784404 CAACCACTGGCATTCCCAGGAGG - Intergenic
1124910919 15:33919679-33919701 AAGCCAAAGGCATTTTCTGTAGG + Intronic
1127183505 15:56451691-56451713 AAACCATATGCATTCACAGTAGG + Intronic
1127850936 15:62911237-62911259 GAACCAATGACAGTCTCAGTGGG + Intergenic
1128815169 15:70602949-70602971 AAAGGAATAGCATTCTCAGGAGG + Intergenic
1129948488 15:79562969-79562991 AGACCAATGGGAATTTCAGTGGG + Intergenic
1130144319 15:81261708-81261730 AAACAAAAGGCACACTCAGTTGG - Intronic
1130389696 15:83444788-83444810 AAACCAAAGCCATACTCAGGAGG + Intergenic
1131976825 15:97955254-97955276 GAACCAAGGGCGGTCTCAGTGGG + Intergenic
1134008703 16:10835329-10835351 AGACCAAGGGGATTCTCAGGAGG + Intergenic
1141877621 16:86836821-86836843 AAACCAATGTGTTTTTCAGTTGG - Intergenic
1142528370 17:561389-561411 AAAAAAATGGCATACTCAGCTGG - Intronic
1146141062 17:30368332-30368354 TAAACAGTGGCATTCTAAGTAGG - Intergenic
1149094164 17:52820576-52820598 CAACCAATGGCATATTTAGTTGG + Intergenic
1151328757 17:73394480-73394502 AAACCAAAGGCCATCTTAGTGGG - Intronic
1155747269 18:29372833-29372855 AAATTAATAGCATTGTCAGTGGG + Intergenic
1156586495 18:38437090-38437112 AAAATAAAGGCATTCTCTGTGGG + Intergenic
1156723987 18:40105368-40105390 AAAGCAATTGTATTCTCAGTAGG + Intergenic
1158412644 18:57221626-57221648 AAACCGATGGCATGCTCAATGGG + Intergenic
1159517501 18:69476494-69476516 AAATCGATGGCATTCTCAGAAGG + Intronic
1159826421 18:73217823-73217845 AAACTAATAGCATTCCAAGTAGG - Intronic
1159994874 18:74954859-74954881 AAATAAATGACATTATCAGTAGG + Intronic
1162597645 19:11641433-11641455 AACCCAAAGACATTCTCAGAAGG - Intergenic
1163194924 19:15710944-15710966 AAACCAATGCCATTTACATTAGG + Intergenic
1165822238 19:38683927-38683949 AAACCAAGGGCAGTCCCAGGAGG - Intronic
1202676315 1_KI270711v1_random:10005-10027 AAACCAACAGCAATGTCAGTAGG + Intergenic
925743158 2:7022731-7022753 AAATCAAAGTCATTCTCAGAAGG + Intronic
926175053 2:10583466-10583488 AAACCAATGGCAGTGTCCATCGG - Intronic
926294493 2:11559070-11559092 AACTCTATGGCATTCTAAGTGGG - Intronic
928087632 2:28355850-28355872 ACACCATTGCCATCCTCAGTGGG - Intergenic
928831585 2:35492361-35492383 ATACAAAAGGGATTCTCAGTAGG + Intergenic
932406670 2:71517434-71517456 ATACAAATGTCATTCTCAGGAGG - Intronic
933517651 2:83326188-83326210 TGACAAATGGCATTCTTAGTGGG - Intergenic
935064298 2:99634536-99634558 AAACCCATGGCATACAAAGTTGG + Intronic
941408508 2:165122563-165122585 AAACCAATTGCATGCTCTATAGG - Intronic
942331493 2:174829384-174829406 AAACTGAAGTCATTCTCAGTTGG + Intronic
942332765 2:174845206-174845228 ACTCAAATGGCATTCTTAGTAGG + Intronic
944603660 2:201330014-201330036 AACCCAATGGCAATTTCATTAGG + Intronic
945745178 2:213712023-213712045 ACACAAATGGCATTCTCAGGAGG + Intronic
945779708 2:214154094-214154116 AAACATATGGCATTTTGAGTAGG - Intronic
945972072 2:216240694-216240716 AAACCAATAGTACTCTCATTTGG + Intergenic
1169034738 20:2440361-2440383 AAAGCAGTGGCAGTCTAAGTTGG + Intergenic
1170173011 20:13436296-13436318 AAAATAATGGCATTCTTAGCAGG - Intronic
1174907197 20:54563934-54563956 AAAGCAATGGTATTCCCAGGAGG + Intronic
949654859 3:6206312-6206334 AACCAAATGGTACTCTCAGTAGG + Intergenic
951582902 3:24184730-24184752 GAATCACTGGCACTCTCAGTTGG + Intronic
951881172 3:27483304-27483326 AAATCAAAGCCAGTCTCAGTAGG + Intronic
951996981 3:28741766-28741788 CAACAAATGGCAATCTCAGGTGG - Intergenic
952143993 3:30511621-30511643 ATAAGAATGGCATTCTCGGTCGG - Intergenic
952315776 3:32231048-32231070 AAACCAATGTCCATCTCACTTGG + Intergenic
955340389 3:58120900-58120922 TAACCAATGGCTTTCACAGATGG - Intronic
955429283 3:58825811-58825833 AGGCCAATGGATTTCTCAGTAGG + Intronic
955776517 3:62439639-62439661 CATCAAAGGGCATTCTCAGTAGG + Intronic
963634079 3:147771757-147771779 AAGCCCATGGCAGGCTCAGTTGG + Intergenic
963707058 3:148699910-148699932 AAACCAATTTTATTCTGAGTTGG - Intronic
964969641 3:162543598-162543620 AAGCCAATTACATTCTCAGGTGG - Intergenic
968879462 4:3291901-3291923 AAACCAATGGCATTCTCAGTGGG - Intergenic
971786457 4:31109785-31109807 GTACCAATGGCATTGTCTGTGGG - Intronic
972822216 4:42714759-42714781 TAACCAATGGAATTCTCTGGAGG - Intergenic
981756481 4:148145840-148145862 AAAACAATGGAAATCTCAGGAGG + Intronic
981765825 4:148248610-148248632 AATGCAACGGCTTTCTCAGTTGG + Intronic
982416697 4:155141919-155141941 AAACCAATGGCAATGGCAGTAGG - Intergenic
982854010 4:160358269-160358291 AAACTAATGACATTTTCACTGGG - Intergenic
983292690 4:165826205-165826227 AGATCAATGGCATTCTCATTAGG - Intergenic
986848551 5:11783438-11783460 TGACCAAAGGCATCCTCAGTGGG + Intronic
988274702 5:29065735-29065757 AAACCAATGTCAATCTTAGATGG - Intergenic
990759648 5:59114453-59114475 AAACCCATGGGATACTCAGTTGG + Intronic
990772666 5:59267193-59267215 TAACCAATGGCATTCTAACATGG - Intronic
992288682 5:75262496-75262518 AAACCAATGCCAGACTCAGAGGG - Intergenic
999376590 5:151091001-151091023 TAGCCCATTGCATTCTCAGTCGG + Intronic
1000562156 5:162803117-162803139 AATCCAATTGCATTCTGATTTGG + Intergenic
1000709479 5:164553726-164553748 AAACAAATGCCATTTTCAGTGGG + Intergenic
1001712383 5:173789194-173789216 AAACCAAGGGCATTTCCAGGCGG - Intergenic
1003636337 6:7835064-7835086 AAGACAATGGCATTGTCAATGGG + Intronic
1004645581 6:17557381-17557403 AAACCTAAGGCATTATCTGTTGG + Exonic
1005248034 6:23910947-23910969 AAACCAATAGATTTCTCAGGAGG + Intergenic
1012747645 6:103114834-103114856 AAAGCAATTCCATTCTCAGTAGG - Intergenic
1013456557 6:110334682-110334704 CAACCAATGACATATTCAGTGGG - Intronic
1016646664 6:146417437-146417459 AAACCAATACCTTTCTCAATAGG + Intronic
1018235548 6:161720071-161720093 AATCCAATGGTTTTCTCTGTTGG - Intronic
1022649517 7:32261582-32261604 AAACCATTGGGATTTACAGTGGG + Intronic
1024376147 7:48640518-48640540 AAATAAATGGCATTATCTGTAGG - Intronic
1024760187 7:52586900-52586922 AAACAAATGGCAAGCTAAGTCGG + Intergenic
1029908157 7:104113626-104113648 AACCTATTGGGATTCTCAGTGGG + Intergenic
1030669423 7:112318866-112318888 AAACCCATGAAATTATCAGTGGG - Intronic
1035141120 7:156762322-156762344 AAAACACTGACAATCTCAGTTGG - Intronic
1044504045 8:92996045-92996067 AAACAAATGGCATTCTAAACTGG - Intronic
1046810450 8:118527334-118527356 AAACACATTGCATTCACAGTTGG - Intronic
1047830105 8:128620077-128620099 AAAACAATCACATTCACAGTTGG + Intergenic
1055558377 9:77498723-77498745 AAACTCATGGCATCCTCAGCGGG - Intronic
1057067886 9:92072491-92072513 CAACCACTAGCATCCTCAGTGGG - Intronic
1057922369 9:99107447-99107469 AAGCAAATAGCATTCTCAGATGG - Intronic
1058246105 9:102627122-102627144 CAACCAATTGCCTTCTCAGGTGG + Intergenic
1060018506 9:120108082-120108104 AAAACAATGACAATATCAGTTGG + Intergenic
1060303515 9:122390544-122390566 GAACAAATGGCATTTTCAGTGGG + Intronic
1060674379 9:125499335-125499357 AAAACAATGTAATTCTTAGTTGG + Intronic
1188107574 X:26162748-26162770 AAACATATGGCATACTAAGTAGG - Intergenic
1188110965 X:26195977-26195999 AAACATATGGCATACTAAGTAGG - Intergenic
1194766345 X:97847694-97847716 AGACCCATGGGATTCTCGGTGGG + Intergenic
1195563501 X:106313766-106313788 AAACCAATGGTTTCCTCAGGTGG + Intergenic
1196255752 X:113516256-113516278 AAAACAATAGCATTCTTACTAGG - Intergenic
1198795845 X:140393269-140393291 AAAGAAATGGCCTTGTCAGTGGG - Intergenic