ID: 968879463

View in Genome Browser
Species Human (GRCh38)
Location 4:3291902-3291924
Sequence GAAACCAATGGCATTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879463_968879470 17 Left 968879463 4:3291902-3291924 CCACTGAGAATGCCATTGGTTTC No data
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879463 Original CRISPR GAAACCAATGGCATTCTCAG TGG (reversed) Intergenic
No off target data available for this crispr