ID: 968879466

View in Genome Browser
Species Human (GRCh38)
Location 4:3291914-3291936
Sequence GGATCCCAGGAGGAAACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879466_968879472 27 Left 968879466 4:3291914-3291936 CCATTGGTTTCCTCCTGGGATCC No data
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879466_968879471 26 Left 968879466 4:3291914-3291936 CCATTGGTTTCCTCCTGGGATCC No data
Right 968879471 4:3291963-3291985 GGAGAGCTGCCAAGAAACCATGG No data
968879466_968879473 28 Left 968879466 4:3291914-3291936 CCATTGGTTTCCTCCTGGGATCC No data
Right 968879473 4:3291965-3291987 AGAGCTGCCAAGAAACCATGGGG No data
968879466_968879470 5 Left 968879466 4:3291914-3291936 CCATTGGTTTCCTCCTGGGATCC No data
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879466 Original CRISPR GGATCCCAGGAGGAAACCAA TGG (reversed) Intergenic
No off target data available for this crispr