ID: 968879467

View in Genome Browser
Species Human (GRCh38)
Location 4:3291924-3291946
Sequence TGATTAGTTTGGATCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879467_968879471 16 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879471 4:3291963-3291985 GGAGAGCTGCCAAGAAACCATGG No data
968879467_968879478 28 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879478 4:3291975-3291997 AGAAACCATGGGGCGGTGGCGGG No data
968879467_968879477 27 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879477 4:3291974-3291996 AAGAAACCATGGGGCGGTGGCGG No data
968879467_968879470 -5 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data
968879467_968879472 17 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879467_968879474 21 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879474 4:3291968-3291990 GCTGCCAAGAAACCATGGGGCGG No data
968879467_968879473 18 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879473 4:3291965-3291987 AGAGCTGCCAAGAAACCATGGGG No data
968879467_968879475 24 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879475 4:3291971-3291993 GCCAAGAAACCATGGGGCGGTGG No data
968879467_968879479 29 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879479 4:3291976-3291998 GAAACCATGGGGCGGTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879467 Original CRISPR TGATTAGTTTGGATCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr