ID: 968879468

View in Genome Browser
Species Human (GRCh38)
Location 4:3291927-3291949
Sequence GTGTGATTAGTTTGGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879468_968879477 24 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879477 4:3291974-3291996 AAGAAACCATGGGGCGGTGGCGG No data
968879468_968879470 -8 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data
968879468_968879471 13 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879471 4:3291963-3291985 GGAGAGCTGCCAAGAAACCATGG No data
968879468_968879481 30 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879481 4:3291980-3292002 CCATGGGGCGGTGGCGGGGACGG No data
968879468_968879472 14 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879468_968879478 25 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879478 4:3291975-3291997 AGAAACCATGGGGCGGTGGCGGG No data
968879468_968879475 21 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879475 4:3291971-3291993 GCCAAGAAACCATGGGGCGGTGG No data
968879468_968879474 18 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879474 4:3291968-3291990 GCTGCCAAGAAACCATGGGGCGG No data
968879468_968879473 15 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879473 4:3291965-3291987 AGAGCTGCCAAGAAACCATGGGG No data
968879468_968879479 26 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879479 4:3291976-3291998 GAAACCATGGGGCGGTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879468 Original CRISPR GTGTGATTAGTTTGGATCCC AGG (reversed) Intergenic
901740989 1:11341786-11341808 GTGTGGTTGGATTGGAGCCCAGG + Intergenic
903437478 1:23362076-23362098 GTGTGATGAGGTTGGAGCTCTGG + Exonic
903736011 1:25530277-25530299 CCGTGATCAGGTTGGATCCCGGG + Intergenic
909999207 1:82321911-82321933 GATTCATTAGTCTGGATCCCTGG + Intergenic
913016050 1:114736294-114736316 GTGTGATTGGTTTAGATCTTTGG - Intronic
916421205 1:164639507-164639529 GGATGATTTGTTTGGAACCCTGG + Intronic
918298889 1:183184538-183184560 GTGTAATTTGTTTGAATCCTGGG + Intergenic
921231874 1:213081443-213081465 GTGTGAGGTGTTTGGATCACGGG - Intronic
921601445 1:217110735-217110757 GTGGGATGTGTTTGGATCCTGGG - Intronic
1065563071 10:26982891-26982913 GAGTGGTTTGTTTGGATCCTGGG - Intergenic
1065564199 10:26992756-26992778 GAGTGGTTGGTTTGGATCCTGGG - Intronic
1071901936 10:90129847-90129869 CTGTGATGAGTTTGGTTCCTTGG - Intergenic
1081383746 11:42446639-42446661 GTGTGCTTAGATTTGAGCCCAGG - Intergenic
1081865143 11:46355646-46355668 GTGTGAGTAGTGTGGAAGCCTGG + Intronic
1086102129 11:83111864-83111886 GTGTTATTAGTTTTATTCCCAGG - Intergenic
1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG + Intergenic
1089137701 11:116262996-116263018 GTGTTCTTTGATTGGATCCCAGG + Intergenic
1092658351 12:10711886-10711908 CTGTGATTATTTTGACTCCCAGG - Intronic
1097020112 12:56014719-56014741 GTGGCATGAGTTTGGCTCCCGGG - Intronic
1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG + Exonic
1098917032 12:76268116-76268138 TTGGGATTTATTTGGATCCCAGG - Intergenic
1100934319 12:99646293-99646315 GTTTGATTATTTTGGATACTTGG - Intronic
1105026133 12:132850381-132850403 GAGTGAAGAGTTTGGATTCCTGG + Intronic
1108898324 13:55363892-55363914 TTACTATTAGTTTGGATCCCTGG - Intergenic
1110331797 13:74281406-74281428 GTGTGATAAGTGTGGATGCAAGG + Intergenic
1125117034 15:36106559-36106581 GACTCATTAGTTTGGATCTCTGG + Intergenic
1126257061 15:46640399-46640421 GTGTGACTAGTCTTGTTCCCAGG - Intergenic
1126876171 15:53044180-53044202 ATGTGATGAGTTTGGATACATGG - Intergenic
1138058598 16:53863372-53863394 GAGAGATTAGTATGGATTCCTGG + Intronic
1138672946 16:58629978-58630000 GTGTGATTGGTTTAAATCCGCGG - Intergenic
1140946574 16:79773906-79773928 GTGTGTTTAGTAAGCATCCCAGG + Intergenic
1148277119 17:46314813-46314835 ATGTCTTTAGTTTGGATACCAGG + Intronic
1148299235 17:46532389-46532411 ATGTCTTTAGTTTGGATACCAGG + Intronic
1148363854 17:47037595-47037617 ATGTCTTTAGTTTGGATACCAGG + Intronic
1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG + Intronic
1150403278 17:64876892-64876914 ATGTCTTTAGTTTGGATACCAGG - Intronic
1152260342 17:79263383-79263405 ATGTGATTTGTTTGGAACGCTGG + Intronic
1152458463 17:80429332-80429354 GTGTGGGCAGTTTGGATTCCAGG + Intronic
1156598768 18:38579029-38579051 TTGTGATAAATTTGGATCCAAGG - Intergenic
1162198739 19:9006217-9006239 CTGTGATCAGTTTAGGTCCCTGG + Intergenic
1168673808 19:58261860-58261882 GTGTAATAAGTTTGGATCTCTGG - Exonic
928112766 2:28523968-28523990 GTGTGATTTGTTTGTCTCCCTGG + Intronic
937685097 2:124687103-124687125 GTGTGATTAGTTGGGTACCTGGG + Intronic
938193057 2:129300353-129300375 ATGTGATAGGTTGGGATCCCTGG + Intergenic
945825807 2:214718407-214718429 TTCTTCTTAGTTTGGATCCCTGG - Intergenic
1168894534 20:1314116-1314138 GTGTGTTAATTTTGTATCCCAGG - Intronic
1170953648 20:20958534-20958556 GGATGATTAGATTGGATCCTTGG - Intergenic
1172557748 20:35857186-35857208 TTGTGATTATTTTAAATCCCTGG + Intronic
1173017502 20:39238876-39238898 GTGTGTTTATTTTGGACCACTGG + Intergenic
1175746254 20:61459394-61459416 GTGTGATCAGGTGGGAACCCCGG - Intronic
1176389219 21:6155030-6155052 GTGTGGATAGTGAGGATCCCGGG - Intergenic
1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG + Intergenic
1183792504 22:40084275-40084297 GTGTGATTATTTTAGCTCACTGG - Intronic
1184797887 22:46742326-46742348 GTGTGAATAGTCCTGATCCCTGG - Intergenic
951703530 3:25521360-25521382 GTGTGATGAGTTTGGATGGGAGG - Intronic
957668052 3:83262330-83262352 GTGTTACTAGTATGGAACCCTGG + Intergenic
959186546 3:103053509-103053531 CTGTGATAAGTGTGAATCCCAGG + Intergenic
960077606 3:113505514-113505536 TAGGGATTAGTTTGGATCTCAGG - Intronic
960940565 3:122930308-122930330 GAGTGACAAGTTTGGAGCCCAGG + Intronic
961429896 3:126874048-126874070 CTGTAATTACTCTGGATCCCGGG + Intronic
961718279 3:128873901-128873923 GAGTGTTTAGTCTGGATTCCTGG + Intergenic
962519807 3:136187996-136188018 GTGTGGAGAGTTTTGATCCCAGG - Intronic
966830734 3:184006135-184006157 GTGCGATTGGTGTGGAGCCCAGG - Intronic
968811906 4:2803912-2803934 GTGACAGTAGCTTGGATCCCGGG + Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
976205282 4:82618322-82618344 GAGTGACAAGTTTGGATTCCAGG + Intergenic
979911072 4:126366313-126366335 ATGTGATTATTTAGGATTCCTGG - Intergenic
981817420 4:148847102-148847124 GTGTGTTTTGTTTGAATCCATGG - Intergenic
982304359 4:153914506-153914528 ATGTGATTATTTTGGATCTTGGG + Intergenic
983755595 4:171330593-171330615 GTGTGGAAAGTGTGGATCCCCGG - Intergenic
985985952 5:3516480-3516502 GTGGGATTTGATTGGATCACGGG - Intergenic
988918408 5:35919198-35919220 GTGAAATTAGTTTGGATCTCAGG + Intronic
989247490 5:39270221-39270243 TTATGAGCAGTTTGGATCCCAGG - Intronic
996494574 5:124138978-124139000 ATGTACTTAGTTTGGATCCTAGG - Intergenic
999334467 5:150703738-150703760 GAGTGGTTGGTTTGGATCCTGGG - Intergenic
1001792621 5:174472233-174472255 GTGTTATTAGTGTGTATTCCAGG - Intergenic
1005145043 6:22679897-22679919 GTGTGGATACTTTGGTTCCCTGG - Intergenic
1013731750 6:113176404-113176426 GTGTGATTAGTTTTGGTCAAGGG - Intergenic
1017966594 6:159272168-159272190 GTGTGCATAGTATGTATCCCTGG - Intergenic
1023888130 7:44375188-44375210 CTGGGCTTAGTTTGGGTCCCTGG - Intergenic
1028187891 7:87810366-87810388 GTGTGATTAGTTTGCTGCCTAGG + Intronic
1028722320 7:94047804-94047826 CTGAGATGAGTTTGAATCCCAGG - Intergenic
1030164066 7:106535323-106535345 GTGTGGTAAGGCTGGATCCCTGG + Intergenic
1030577970 7:111313870-111313892 GTGGGAGGTGTTTGGATCCCAGG + Intronic
1031645130 7:124216316-124216338 GTGTAATCAGTTTGGATTACTGG - Intergenic
1035140695 7:156757628-156757650 GTGTGAGTAGTTTGGATGTGAGG - Intronic
1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG + Intronic
1044016573 8:87053715-87053737 GCGTGACTGGTATGGATCCCAGG + Intronic
1044825835 8:96195943-96195965 GTGAGATTAGGTTGGGTCCTAGG + Intergenic
1046393092 8:113602514-113602536 GTGTGATGAGTGTGGCTCACAGG - Intronic
1046589810 8:116192632-116192654 ATGGGTTTAGTTTTGATCCCTGG - Intergenic
1047294833 8:123561552-123561574 TTGTTATTATTTTGGAACCCAGG - Intergenic
1047742289 8:127816207-127816229 GTGTTCATAGTTTGGATCCTAGG - Intergenic
1048274083 8:133052804-133052826 GTATGATTTGTTTGGCTTCCTGG + Intronic
1053275283 9:36778856-36778878 GGGTGATTAGTTTGGCTGCACGG - Intergenic
1061459764 9:130727836-130727858 GTGGGATTACTTTGGTTCTCTGG - Intronic
1188400089 X:29733408-29733430 GTGTGATTGGTTTAAACCCCTGG - Intronic
1192064410 X:67865484-67865506 GTGGGATGTGTTTGGATCACAGG + Intergenic
1192343022 X:70279869-70279891 GTCTGCTTAGGTTGTATCCCAGG + Intronic
1193693629 X:84680094-84680116 TAGTGATTACTTTGGATCCTGGG + Intergenic
1194976226 X:100399037-100399059 GTTTTATTATTTTTGATCCCCGG + Intronic
1195327950 X:103773407-103773429 ATGTGATTATTTTGGCTTCCAGG + Intergenic
1199818084 X:151418068-151418090 GTGTGATTAGAATGGATCCTTGG + Intergenic