ID: 968879469

View in Genome Browser
Species Human (GRCh38)
Location 4:3291935-3291957
Sequence CTAGTCTTGTGTGATTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879469_968879477 16 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879477 4:3291974-3291996 AAGAAACCATGGGGCGGTGGCGG No data
968879469_968879484 27 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879484 4:3291985-3292007 GGGCGGTGGCGGGGACGGAGGGG No data
968879469_968879475 13 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879475 4:3291971-3291993 GCCAAGAAACCATGGGGCGGTGG No data
968879469_968879483 26 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879483 4:3291984-3292006 GGGGCGGTGGCGGGGACGGAGGG No data
968879469_968879471 5 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879471 4:3291963-3291985 GGAGAGCTGCCAAGAAACCATGG No data
968879469_968879478 17 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879478 4:3291975-3291997 AGAAACCATGGGGCGGTGGCGGG No data
968879469_968879479 18 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879479 4:3291976-3291998 GAAACCATGGGGCGGTGGCGGGG No data
968879469_968879474 10 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879474 4:3291968-3291990 GCTGCCAAGAAACCATGGGGCGG No data
968879469_968879472 6 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879469_968879482 25 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879482 4:3291983-3292005 TGGGGCGGTGGCGGGGACGGAGG 0: 1
1: 2
2: 14
3: 336
4: 1817
968879469_968879473 7 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879473 4:3291965-3291987 AGAGCTGCCAAGAAACCATGGGG No data
968879469_968879481 22 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879481 4:3291980-3292002 CCATGGGGCGGTGGCGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879469 Original CRISPR CTAGTCTTGTGTGATTAGTT TGG (reversed) Intergenic
No off target data available for this crispr