ID: 968879470

View in Genome Browser
Species Human (GRCh38)
Location 4:3291942-3291964
Sequence AATCACACAAGACTAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879468_968879470 -8 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data
968879462_968879470 18 Left 968879462 4:3291901-3291923 CCCACTGAGAATGCCATTGGTTT 0: 1
1: 0
2: 0
3: 13
4: 169
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data
968879467_968879470 -5 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data
968879463_968879470 17 Left 968879463 4:3291902-3291924 CCACTGAGAATGCCATTGGTTTC No data
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data
968879466_968879470 5 Left 968879466 4:3291914-3291936 CCATTGGTTTCCTCCTGGGATCC No data
Right 968879470 4:3291942-3291964 AATCACACAAGACTAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879470 Original CRISPR AATCACACAAGACTAGATGA TGG Intergenic
No off target data available for this crispr