ID: 968879472

View in Genome Browser
Species Human (GRCh38)
Location 4:3291964-3291986
Sequence GAGAGCTGCCAAGAAACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879469_968879472 6 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879467_968879472 17 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879466_968879472 27 Left 968879466 4:3291914-3291936 CCATTGGTTTCCTCCTGGGATCC No data
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data
968879468_968879472 14 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879472 4:3291964-3291986 GAGAGCTGCCAAGAAACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879472 Original CRISPR GAGAGCTGCCAAGAAACCAT GGG Intergenic
No off target data available for this crispr