ID: 968879474

View in Genome Browser
Species Human (GRCh38)
Location 4:3291968-3291990
Sequence GCTGCCAAGAAACCATGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879468_968879474 18 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879474 4:3291968-3291990 GCTGCCAAGAAACCATGGGGCGG No data
968879469_968879474 10 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879474 4:3291968-3291990 GCTGCCAAGAAACCATGGGGCGG No data
968879467_968879474 21 Left 968879467 4:3291924-3291946 CCTCCTGGGATCCAAACTAATCA No data
Right 968879474 4:3291968-3291990 GCTGCCAAGAAACCATGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879474 Original CRISPR GCTGCCAAGAAACCATGGGG CGG Intergenic
No off target data available for this crispr