ID: 968879481

View in Genome Browser
Species Human (GRCh38)
Location 4:3291980-3292002
Sequence CCATGGGGCGGTGGCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879469_968879481 22 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879481 4:3291980-3292002 CCATGGGGCGGTGGCGGGGACGG No data
968879468_968879481 30 Left 968879468 4:3291927-3291949 CCTGGGATCCAAACTAATCACAC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 968879481 4:3291980-3292002 CCATGGGGCGGTGGCGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879481 Original CRISPR CCATGGGGCGGTGGCGGGGA CGG Intergenic
No off target data available for this crispr