ID: 968879482

View in Genome Browser
Species Human (GRCh38)
Location 4:3291983-3292005
Sequence TGGGGCGGTGGCGGGGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2170
Summary {0: 1, 1: 2, 2: 14, 3: 336, 4: 1817}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879469_968879482 25 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879482 4:3291983-3292005 TGGGGCGGTGGCGGGGACGGAGG 0: 1
1: 2
2: 14
3: 336
4: 1817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879482 Original CRISPR TGGGGCGGTGGCGGGGACGG AGG Intergenic
Too many off-targets to display for this crispr