ID: 968879483

View in Genome Browser
Species Human (GRCh38)
Location 4:3291984-3292006
Sequence GGGGCGGTGGCGGGGACGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879469_968879483 26 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879483 4:3291984-3292006 GGGGCGGTGGCGGGGACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879483 Original CRISPR GGGGCGGTGGCGGGGACGGA GGG Intergenic
No off target data available for this crispr