ID: 968879484

View in Genome Browser
Species Human (GRCh38)
Location 4:3291985-3292007
Sequence GGGCGGTGGCGGGGACGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879469_968879484 27 Left 968879469 4:3291935-3291957 CCAAACTAATCACACAAGACTAG No data
Right 968879484 4:3291985-3292007 GGGCGGTGGCGGGGACGGAGGGG No data
968879476_968879484 -10 Left 968879476 4:3291972-3291994 CCAAGAAACCATGGGGCGGTGGC No data
Right 968879484 4:3291985-3292007 GGGCGGTGGCGGGGACGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879484 Original CRISPR GGGCGGTGGCGGGGACGGAG GGG Intergenic
No off target data available for this crispr