ID: 968879586

View in Genome Browser
Species Human (GRCh38)
Location 4:3292384-3292406
Sequence GGGCCCCGGGACGCCCGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879586_968879600 22 Left 968879586 4:3292384-3292406 CCTTCGCGGGCGTCCCGGGGCCC No data
Right 968879600 4:3292429-3292451 TGTCCCCGTGGCTTCGCCGCGGG No data
968879586_968879595 -2 Left 968879586 4:3292384-3292406 CCTTCGCGGGCGTCCCGGGGCCC No data
Right 968879595 4:3292405-3292427 CCGGAGGGAACGGCCTTTCCTGG No data
968879586_968879599 21 Left 968879586 4:3292384-3292406 CCTTCGCGGGCGTCCCGGGGCCC No data
Right 968879599 4:3292428-3292450 CTGTCCCCGTGGCTTCGCCGCGG No data
968879586_968879596 10 Left 968879586 4:3292384-3292406 CCTTCGCGGGCGTCCCGGGGCCC No data
Right 968879596 4:3292417-3292439 GCCTTTCCTGGCTGTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879586 Original CRISPR GGGCCCCGGGACGCCCGCGA AGG (reversed) Intergenic
No off target data available for this crispr