ID: 968879738

View in Genome Browser
Species Human (GRCh38)
Location 4:3292909-3292931
Sequence CCGCCCCAACCCCACCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879719_968879738 25 Left 968879719 4:3292861-3292883 CCGACGCGAAGGCCCTCGCCCCG No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879729_968879738 -6 Left 968879729 4:3292892-3292914 CCCGCCCCCGCATCGCCCCGCCC 0: 1
1: 0
2: 35
3: 224
4: 1539
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879724_968879738 5 Left 968879724 4:3292881-3292903 CCGCCCCGTGCCCCGCCCCCGCA No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879723_968879738 6 Left 968879723 4:3292880-3292902 CCCGCCCCGTGCCCCGCCCCCGC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879726_968879738 1 Left 968879726 4:3292885-3292907 CCCGTGCCCCGCCCCCGCATCGC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879727_968879738 0 Left 968879727 4:3292886-3292908 CCGTGCCCCGCCCCCGCATCGCC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879720_968879738 13 Left 968879720 4:3292873-3292895 CCCTCGCCCCGCCCCGTGCCCCG No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879718_968879738 26 Left 968879718 4:3292860-3292882 CCCGACGCGAAGGCCCTCGCCCC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879725_968879738 2 Left 968879725 4:3292884-3292906 CCCCGTGCCCCGCCCCCGCATCG 0: 1
1: 0
2: 2
3: 26
4: 288
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879728_968879738 -5 Left 968879728 4:3292891-3292913 CCCCGCCCCCGCATCGCCCCGCC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879730_968879738 -7 Left 968879730 4:3292893-3292915 CCGCCCCCGCATCGCCCCGCCCC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879731_968879738 -10 Left 968879731 4:3292896-3292918 CCCCCGCATCGCCCCGCCCCAAC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879722_968879738 7 Left 968879722 4:3292879-3292901 CCCCGCCCCGTGCCCCGCCCCCG 0: 1
1: 4
2: 59
3: 480
4: 2324
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data
968879721_968879738 12 Left 968879721 4:3292874-3292896 CCTCGCCCCGCCCCGTGCCCCGC No data
Right 968879738 4:3292909-3292931 CCGCCCCAACCCCACCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879738 Original CRISPR CCGCCCCAACCCCACCCCCT TGG Intergenic
No off target data available for this crispr