ID: 968879797

View in Genome Browser
Species Human (GRCh38)
Location 4:3293040-3293062
Sequence GCGCGCGCGGGCGGTGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 9, 3: 93, 4: 613}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879790_968879797 -9 Left 968879790 4:3293026-3293048 CCGAGGCGACCGTTGCGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879785_968879797 16 Left 968879785 4:3293001-3293023 CCTCGACCCCGGGGGGCGGTGGC No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879775_968879797 26 Left 968879775 4:3292991-3293013 CCCGCCCTCGCCTCGACCCCGGG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879788_968879797 8 Left 968879788 4:3293009-3293031 CCGGGGGGCGGTGGCTGCCGAGG 0: 1
1: 0
2: 3
3: 48
4: 638
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879782_968879797 21 Left 968879782 4:3292996-3293018 CCTCGCCTCGACCCCGGGGGGCG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879786_968879797 10 Left 968879786 4:3293007-3293029 CCCCGGGGGGCGGTGGCTGCCGA No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879773_968879797 27 Left 968879773 4:3292990-3293012 CCCCGCCCTCGCCTCGACCCCGG 0: 1
1: 0
2: 1
3: 61
4: 443
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879787_968879797 9 Left 968879787 4:3293008-3293030 CCCGGGGGGCGGTGGCTGCCGAG 0: 1
1: 0
2: 3
3: 114
4: 4478
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879777_968879797 25 Left 968879777 4:3292992-3293014 CCGCCCTCGCCTCGACCCCGGGG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879781_968879797 22 Left 968879781 4:3292995-3293017 CCCTCGCCTCGACCCCGGGGGGC No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879797 Original CRISPR GCGCGCGCGGGCGGTGGCGC GGG Intronic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900166614 1:1246544-1246566 GGACGCGCTGGCGGTGGCGTTGG + Exonic
900240776 1:1616237-1616259 ACGCGCACGGGCGCCGGCGCAGG - Intronic
900629240 1:3624994-3625016 GCGCGGCCGGGTGGTGGCGGTGG + Exonic
901057622 1:6456009-6456031 GCGGGCGGGGGCGGCGGCGGCGG - Intronic
902476739 1:16692469-16692491 GGGCGGGCGGGCGGTGGCGGCGG + Intergenic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
903034583 1:20485791-20485813 GCGAGTGCGGGCGGCGGCGCCGG + Exonic
903193478 1:21669144-21669166 GCGCGGGCGGGCGGGGACGGAGG - Intronic
903597019 1:24502809-24502831 GGGCGCGCGCACGGCGGCGCAGG - Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903828606 1:26161807-26161829 GCGCGCGCTGGTGGAGGTGCTGG + Exonic
904181377 1:28668921-28668943 GCGAGGGCGGGCGGGCGCGCAGG + Intronic
904236731 1:29121729-29121751 GCGGGCGCCGGCGGCGGCCCAGG + Exonic
904485941 1:30824610-30824632 GCCCGCCCCGGCGGGGGCGCCGG - Intergenic
904528844 1:31155123-31155145 TCGGGCGCGGGCGCGGGCGCGGG + Intergenic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
904769069 1:32870914-32870936 CCGCGCGGCGGCGGTGGCGGCGG + Intronic
905107744 1:35574207-35574229 GTGGGCGCGGGCGGCTGCGCGGG - Exonic
905308539 1:37034590-37034612 GCGCGGGCGGCGGGCGGCGCGGG - Intergenic
905714026 1:40132833-40132855 GCTGGCGTGGACGGTGGCGCTGG - Intergenic
905862630 1:41361458-41361480 GCAGGCGCGGGAGCTGGCGCTGG + Intergenic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
906524322 1:46485681-46485703 GCGCGCGCTGACGGCGGCCCCGG - Intergenic
906637213 1:47417320-47417342 GCGCTCGAGGGCGGCGCCGCAGG - Exonic
906640804 1:47439312-47439334 ACGGACGCGGGCGGTGGTGCAGG + Exonic
907408437 1:54268305-54268327 GCGCTGGCGAGCGGTGGCGGAGG - Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
910288200 1:85577104-85577126 GGGCGCGCGGGCGGGGTGGCCGG + Intronic
912685005 1:111755576-111755598 CGGCGAGAGGGCGGTGGCGCCGG + Exonic
913962991 1:143353793-143353815 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
914057346 1:144179378-144179400 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
914121800 1:144786988-144787010 GGGCGCGCGGGCGGAGGTGCGGG - Intergenic
914803169 1:150974779-150974801 GCGGGCGGCGGCGGCGGCGCCGG - Exonic
915557495 1:156668675-156668697 GGGCGGGCGGGGGGTGGCGGGGG - Intergenic
916100484 1:161389854-161389876 GCACGCGCGGGCTGTGACGAGGG - Intergenic
916651666 1:166839609-166839631 GTGCGCGCGGGCGGGGGCGGCGG + Intronic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
918282960 1:183023577-183023599 TCCGGCGCGGGCGGTGGCGGCGG - Exonic
918365652 1:183805132-183805154 GCGCGCACCGGCGGCGGCGGGGG + Intronic
918511368 1:185317248-185317270 GCGCGAGCGGTCGGCGGCGGCGG - Exonic
920171532 1:204074941-204074963 GCTGGCGCTGGCGCTGGCGCTGG + Intronic
921060108 1:211578447-211578469 GCTGGCGCTGGTGGTGGCGCTGG - Exonic
921384072 1:214551815-214551837 GCGCGCGCCGGGGGCGCCGCGGG + Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
921603983 1:217135524-217135546 GCGCGCGGCGGCGGCGGCGGCGG + Intronic
922196475 1:223364194-223364216 GAGCGCGCGGGCGGGGGAGCTGG - Intronic
922958553 1:229625807-229625829 GCGCGGGCGGGCGGGGGCCGGGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923008004 1:230067377-230067399 GGGGGCGCGGGCGGCGGCGCCGG + Exonic
923055897 1:230425931-230425953 GGGCGCGCGGGCGGCGGCCGGGG - Intergenic
923171678 1:231422333-231422355 GCGCGCGAGGGCGGAGGGGGCGG + Exonic
923299737 1:232630147-232630169 GGGCGGGCGGGCGGTGGCATCGG - Intergenic
923372660 1:233328344-233328366 GGCCGCGAGGGCGGCGGCGCGGG - Exonic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
923684139 1:236142391-236142413 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
923684149 1:236142411-236142433 GGGCGCGCGGGCCGGGGCGGGGG + Intergenic
924289659 1:242524518-242524540 GCGGGCGGGGGCGGGGGCGGGGG + Exonic
1062874126 10:931588-931610 GCGCGAGCTGGCGGCGGCGGCGG + Exonic
1063449993 10:6144895-6144917 GCGCCTGCGGGCGGCGGGGCGGG - Intergenic
1064086530 10:12349762-12349784 GCGCGCTGGGGAGGGGGCGCCGG - Exonic
1064179186 10:13100177-13100199 GCGGGCGGCGGCGGTGGCGGAGG - Exonic
1064443228 10:15371423-15371445 GCGCGCCGGGGCAGTGTCGCCGG - Intergenic
1064552781 10:16520451-16520473 GCGCGGGCGGGCGGCGGGGAGGG - Intronic
1065520573 10:26567291-26567313 GCGGGCGCGGGCGGCGGCGGCGG - Exonic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1065712826 10:28533498-28533520 GGGCGCGCAGGCGGCGGCGGCGG - Exonic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1066370608 10:34815467-34815489 GCCCCCGAGGGCGGTGGCGGGGG - Intergenic
1067060857 10:43077246-43077268 GCGCGCACGGGCGATGGCGAAGG + Exonic
1067227404 10:44385007-44385029 GCGCGGGCGGGCGGGCGGGCGGG + Exonic
1067453767 10:46398358-46398380 GCGCGCGGGGGCGGGCGCGCGGG + Intergenic
1067583460 10:47461388-47461410 GCGCGCGGGGGCGGGCGCGCGGG - Intronic
1067633464 10:47986736-47986758 GCGCGCGGGGGCGGGCGCGCGGG - Intergenic
1068538642 10:58267951-58267973 GCGGGAGGGGGCGGGGGCGCAGG - Intergenic
1068763041 10:60733511-60733533 GCCCGCGCGGGCCGGTGCGCCGG + Intergenic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071086829 10:81875254-81875276 CCGGGCGCGGGCGCGGGCGCGGG - Intergenic
1072249009 10:93567176-93567198 GCGGGCGCGGGCAGTGCTGCTGG + Exonic
1072719365 10:97771276-97771298 GCGCGCGGGGACGGCGGCGGCGG + Intronic
1073147952 10:101292610-101292632 GCGGGCGCGGGCGCGGCCGCGGG - Intergenic
1073478762 10:103772365-103772387 GGGCGCGGGGGCGGTGAGGCAGG + Intronic
1074829882 10:117241009-117241031 GCGCGGGCGGGCGGAGGCCGGGG + Intergenic
1076792879 10:132786103-132786125 GGGCGGGCGGGCGGCGGCGGCGG + Intergenic
1076793405 10:132787901-132787923 GCGCGCGCGGGCGGAACGGCGGG + Intergenic
1077048050 11:554923-554945 GCGCGGGCGGGCGCCGGGGCTGG - Exonic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077107894 11:849811-849833 GCGCGCGGGGTCGGGGGCGCGGG + Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077419933 11:2445288-2445310 GCGGGCGCGGCCGGGGACGCAGG - Exonic
1077886375 11:6390706-6390728 GCTGGCGCTGGCGCTGGCGCTGG + Exonic
1077886376 11:6390712-6390734 GCTGGCGCTGGCGCTGGCGCTGG + Exonic
1077886377 11:6390718-6390740 GCTGGCGCTGGCGCTGGCGCTGG + Exonic
1078180089 11:9004064-9004086 GCGCGCGCGGGGGGCGGGGCCGG + Intergenic
1080283595 11:30585377-30585399 GCGCGCGCGGGCGGCCCCGGGGG + Intronic
1080385807 11:31810554-31810576 GCCCGCGCTGGCGCTGGCGCTGG + Intronic
1080385810 11:31810560-31810582 GCTGGCGCTGGCGCTGGCGCTGG + Intronic
1080503771 11:32893168-32893190 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1080914145 11:36638142-36638164 ACTCGGGCGGGCGGTGGGGCGGG - Intronic
1081575567 11:44316851-44316873 GCGGGCGCGGGCGGCGGGGTTGG - Intergenic
1082810478 11:57476508-57476530 GCGCTCCGGGGGGGTGGCGCAGG - Exonic
1083272956 11:61581189-61581211 GCGGGCGCAGGCGGTGGCTGTGG - Intergenic
1083657001 11:64234604-64234626 GGGCGGGCGGCCGGTGGCGGCGG - Exonic
1083766671 11:64844711-64844733 GGGCGCGCTGGCGGCGGCGGAGG - Intergenic
1084146155 11:67266435-67266457 GGGCGCGCGGGCGGCGGCGGCGG + Exonic
1084598624 11:70132002-70132024 GCTGGCGCGGGCCGTGGCGCAGG - Exonic
1084935778 11:72585886-72585908 GTGCCTGCGGGCAGTGGCGCGGG + Intronic
1086887744 11:92224602-92224624 GGGCGCGCGGGAGGGGGCGGCGG - Intergenic
1086888228 11:92226701-92226723 GCGTGGGCGGCCGGTGGCTCTGG + Intergenic
1090699332 11:129279692-129279714 GCGCGCGCGGCCGAGGGGGCGGG + Intergenic
1091680469 12:2523143-2523165 GAGGGCGGGGGCGGTGGTGCTGG + Intronic
1091869262 12:3873493-3873515 ACGCGCGCGGGCGGTCGTCCTGG + Intergenic
1093894694 12:24562752-24562774 GGGCGCGGGGGCGGTGCCGGGGG + Intergenic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094025801 12:25958830-25958852 GCCCGCGGCGGCGTTGGCGCTGG + Intergenic
1094682626 12:32679541-32679563 GCGGGAGTGGGCGCTGGCGCGGG - Intronic
1096073570 12:48788938-48788960 GCCCGCGGGGGCGGCGGGGCGGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096264343 12:50111501-50111523 GCGAGGGCGGGAGGGGGCGCTGG - Intergenic
1096459480 12:51814366-51814388 GGGCACGCGGGCGGCGGCGCCGG + Intergenic
1096460876 12:51821001-51821023 GCGCGCGCCCTCGGCGGCGCCGG + Intergenic
1096482413 12:51951576-51951598 GCGCGCGGCGGCCGCGGCGCCGG + Intergenic
1096495458 12:52037164-52037186 GCGCGGGCGGCCGCGGGCGCGGG + Intronic
1096647586 12:53047175-53047197 ACGGGCGCGGGCGCGGGCGCGGG + Intronic
1096769762 12:53927724-53927746 GGGCGGGCGGGCGGTGGCTAGGG - Intergenic
1096774400 12:53955356-53955378 GCGGGCGGCGGCGGTGGCGACGG + Exonic
1096814919 12:54195998-54196020 GCGGGCGGGGGCAGTGGGGCCGG - Intergenic
1097033226 12:56104549-56104571 GAGCGCGCGGGCTGAGGCGCAGG - Exonic
1101493995 12:105236283-105236305 GCGAGCGCAGGCGGAAGCGCGGG - Intronic
1102501856 12:113358648-113358670 GCTGACGCGGGCGCTGGCGCTGG + Exonic
1102501857 12:113358654-113358676 GCGGGCGCTGGCGCTGGCCCTGG + Exonic
1103308988 12:119989624-119989646 GCGCGCGCGGGAGGAGGGGGTGG - Intergenic
1103364015 12:120369339-120369361 GCCCGCGGAGGCGGCGGCGCCGG + Intergenic
1103433065 12:120904240-120904262 CCGCGCTCGGGCGGCGGCGGCGG + Exonic
1103800319 12:123533632-123533654 GCGGGCGCGGGCGCGGGCACGGG + Exonic
1103800323 12:123533644-123533666 GCGGGCACGGGCGGCGGCGCGGG + Exonic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105026312 12:132851588-132851610 CCGCCTGCGTGCGGTGGCGCGGG + Intronic
1105472504 13:20705304-20705326 GCGAGCGGGGGCGGTGGGGGTGG + Intronic
1106340130 13:28819842-28819864 GCGCGCGCAGGAGCGGGCGCAGG + Intergenic
1107467544 13:40664816-40664838 GCGGGCGGTGGCGGTGGCGGTGG - Intronic
1107467546 13:40664822-40664844 GCGGGCGCGGGCGGTGGCGGTGG - Intronic
1108484463 13:50910149-50910171 GCGCGCCCGGGCGGCGGGGTCGG + Intronic
1108518191 13:51222292-51222314 GCGGGCGCGGGCGCAGGCGCGGG + Intergenic
1108542073 13:51453637-51453659 GCGCGAGCGGGCGCGGGCGGGGG + Intronic
1110443373 13:75549748-75549770 GCGCGCGTGGGCGGAAGCGGCGG + Intronic
1110706023 13:78602491-78602513 GCTGGCGCGGGCCGAGGCGCTGG - Exonic
1112344153 13:98576718-98576740 GCGGGCGCGGGCCGCGGGGCCGG - Intronic
1112344367 13:98577320-98577342 CCGCGGGCGGGCGGCGGGGCCGG + Intronic
1112505079 13:99970576-99970598 GCGGGCGCCGGCGGCGGCGGCGG + Exonic
1112652718 13:101416342-101416364 GTGCCCGCGGGCGGCGGCGGCGG + Exonic
1112752566 13:102597236-102597258 GCGCGGGCGGCCGGGGACGCGGG + Intronic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113541930 13:111115703-111115725 GGGGGCGCGGGCGGGGGCGCGGG - Intronic
1113653880 13:112056336-112056358 GAACGCGGGGGCGGGGGCGCGGG + Intergenic
1113655605 13:112066655-112066677 GCGCGCGGCGGCGGCGGCGGCGG - Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113660465 13:112103841-112103863 GGGGGCGGGGGCGGGGGCGCGGG + Intergenic
1113737643 13:112689919-112689941 GCGAGCGCGGGTGTGGGCGCGGG + Intergenic
1115399116 14:32938746-32938768 GCGGGGGCGGGTGGCGGCGCGGG + Intronic
1115474567 14:33800606-33800628 GGGGGCGGGGGCGGCGGCGCGGG + Exonic
1117253221 14:53955050-53955072 CCGGGCGCGGACGGTCGCGCAGG - Intronic
1117253236 14:53955104-53955126 GCCCGCCCCAGCGGTGGCGCGGG - Intronic
1117547838 14:56808031-56808053 GGGGGCGCGGGCAGTGGAGCGGG - Intronic
1117876032 14:60250055-60250077 GCCCGAGCGGGTGGGGGCGCGGG - Intronic
1118323162 14:64765048-64765070 GCGCGCGCGGGTGGTGGATGGGG + Intronic
1118621682 14:67619866-67619888 GGGCGGGCGGACGCTGGCGCGGG + Exonic
1118776848 14:68978826-68978848 GCGCGCACGGGAGGGGGCGGGGG - Intronic
1119319064 14:73718779-73718801 GCGGGCGCTGGCGGCGGTGCGGG + Exonic
1119330137 14:73787302-73787324 GCGCGCGGAGCCGGGGGCGCGGG - Intronic
1120809930 14:88792831-88792853 GCGTGCGCGGGCGGCGGCTGAGG - Intergenic
1120881459 14:89417507-89417529 GCGACCGTGGGCGGTGGGGCAGG + Intronic
1121477036 14:94218411-94218433 GCGCGCGCGTGCGGTGTCTAGGG - Intronic
1122582076 14:102777378-102777400 ACGCGCGCGGGCGGCGGGGGCGG + Intergenic
1122624160 14:103075663-103075685 GCGGCCGCGGGCGGAGGAGCCGG - Intergenic
1122625649 14:103084243-103084265 GCCCGCGCGGGTGCTGGCGCTGG - Intergenic
1122666679 14:103334702-103334724 GCGGGCGCGGGCCCGGGCGCCGG + Intronic
1122736601 14:103847268-103847290 GGGCGGGCGGGAGGTGGCGGCGG - Intronic
1122940378 14:104978458-104978480 GCGCTCGCGGGCGGTGCCGTCGG + Intergenic
1122960980 14:105093528-105093550 GCGCGCGGGGCCCGGGGCGCGGG - Intergenic
1122975296 14:105168447-105168469 CCGGGCGCGGGCGGCGGCGGCGG - Exonic
1123024041 14:105415228-105415250 AGCCGCGCGGGCGGGGGCGCGGG + Intronic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124129504 15:26971580-26971602 GCACGCGCGGTAAGTGGCGCGGG + Exonic
1124142287 15:27088249-27088271 GCGGGCGCGGGGGCGGGCGCGGG + Intronic
1124142293 15:27088261-27088283 GCGGGCGCGGGGGCGGGCGCGGG + Intronic
1124629395 15:31328037-31328059 GCGCGCTCGGGTGGGGCCGCGGG + Intronic
1124640361 15:31392820-31392842 GCGGGCGGGGGCGGGGGCGGGGG - Intronic
1125180673 15:36878614-36878636 GCGGGCGCGGGCGGCGGGGTAGG + Intergenic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125536252 15:40442208-40442230 GCGGGCGCAGGTGGTGGCGTCGG + Intronic
1125674168 15:41493807-41493829 GCGCGGGCGTGCAGCGGCGCAGG + Intronic
1125954031 15:43777032-43777054 GCGCTGGCGGGAGGTGGGGCCGG - Exonic
1126786203 15:52179638-52179660 CTGCTCCCGGGCGGTGGCGCGGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127867251 15:63042756-63042778 GCGCGGTCGGGCGGAGGAGCGGG - Exonic
1127906742 15:63381740-63381762 GCGGGCGCGGGCTGTGCCGGGGG + Exonic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1128547741 15:68579204-68579226 GCGTGCGGGGGCGGCGGCGGCGG - Exonic
1129334368 15:74843433-74843455 GAGGGCGCGGGCGGCGGAGCGGG + Intergenic
1129894188 15:79091414-79091436 GGGTGCACGGGGGGTGGCGCCGG - Intergenic
1130296163 15:82648067-82648089 GCGCGAGGGGGCGGAGGCGAGGG - Intronic
1130362963 15:83207689-83207711 GCGCGCGGCGGCGGCGGCGGCGG - Exonic
1131263740 15:90903440-90903462 GAGCCCGAGGGCGGTGGCGGCGG + Intronic
1131515351 15:93073166-93073188 GGGCGCGCGGGGGGCGGCGCGGG - Intronic
1131517483 15:93088942-93088964 CGGCCCGCGGGGGGTGGCGCTGG + Intronic
1132365173 15:101251702-101251724 GCGCGCGCTAGCGGCGGCTCGGG + Exonic
1132569211 16:636865-636887 GCGTGCGCCGCCGCTGGCGCCGG + Intronic
1132851519 16:2026964-2026986 CCGCCCGCGGGCAGGGGCGCGGG - Exonic
1132873232 16:2124752-2124774 GCCAGCGCGGGCGGGGGTGCCGG - Intronic
1132926005 16:2429415-2429437 GCGCGCTCCGGCCGGGGCGCGGG + Exonic
1132929397 16:2451222-2451244 GCGCGCGGGGCAGGTGGCGCGGG + Intronic
1132942412 16:2514583-2514605 CAGTGCGCGGGCGGCGGCGCGGG + Intronic
1132991754 16:2799010-2799032 CCGCGCGCGGGCGCTGGCCATGG + Intergenic
1133139631 16:3734680-3734702 GCGCGGGCAGGGGGTGGCGTGGG - Intronic
1133328628 16:4957814-4957836 GCATGCGCGGGCCGTGGGGCGGG + Intronic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134587909 16:15428042-15428064 GGGCTCGGGGGCGGTGGCGGGGG + Intronic
1134588649 16:15434499-15434521 GCGCTCCCGGGCGCTGGCGGCGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1135023840 16:18984148-18984170 GCGCGCGGGGACGGTGCCCCTGG + Intronic
1135335722 16:21599636-21599658 TCGAGCTCGGGCGGTGGCGGCGG + Exonic
1135521589 16:23182549-23182571 GCGCGGCCGGGCTGGGGCGCAGG + Intergenic
1135745840 16:25015405-25015427 GGGCGGGCGGGCGGTGCCACTGG - Intronic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1138196606 16:55056971-55056993 GCGGGCGGCGGCGGCGGCGCCGG - Intergenic
1138450776 16:57092572-57092594 GGGCGGGCGGGCGGCGGCGGCGG - Exonic
1139615443 16:68085751-68085773 GAGCCCGGGGGCGGCGGCGCCGG - Exonic
1139644311 16:68316984-68317006 GGGCGGGCGGGCGGTGGAGGGGG + Intronic
1139890642 16:70251474-70251496 GCGCGCGCGGGTAGCGGCCCAGG + Exonic
1140223189 16:73058441-73058463 CCGCGTCCGGGCGGTGGCGGCGG + Intronic
1141531243 16:84648478-84648500 GCGCGCGCGGCCAATGGCGGCGG - Intergenic
1141957643 16:87383378-87383400 GCGCGCGGGGGTGGCGGGGCCGG - Intronic
1141989638 16:87602659-87602681 GGGCCCGCGGGCGGCGGCGGCGG - Intronic
1142403666 16:89874027-89874049 ACGCGGGTGGGCGGTGGCGTGGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143183488 17:4997900-4997922 GCGAGCGCGCGCGGAGGGGCGGG - Intergenic
1144828695 17:18120414-18120436 GCGCGCGCTGGAGGTTGCGCTGG - Exonic
1144828769 17:18120733-18120755 CTGGGCGCGGGCTGTGGCGCGGG - Exonic
1146057697 17:29589432-29589454 GCGGGCCCGGGCGGCGGCGGCGG + Exonic
1146371110 17:32266046-32266068 GCGGGCGCGGGCTGCGGAGCGGG + Intergenic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147313084 17:39606466-39606488 CCGGGCGCAGGCGGTGGCGGTGG + Exonic
1147710317 17:42458832-42458854 GCGGGGGCCGGCGGCGGCGCAGG + Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147990005 17:44326802-44326824 GCACGCGCGGGCGGTGGCGGAGG + Intergenic
1147994632 17:44354049-44354071 GGGGGCGCGGGCGGCGGCGGCGG + Exonic
1148388565 17:47253916-47253938 GCGCTGGCGGGCGTTGGCGTAGG + Exonic
1148899601 17:50866109-50866131 GCGCGGCAGGGCGGGGGCGCGGG + Exonic
1149994770 17:61400598-61400620 GCGCGGGCGGGCGGGCGGGCTGG + Intronic
1151296904 17:73192823-73192845 GCGGGCGCGGGCGCGGGGGCGGG - Intronic
1151296908 17:73192829-73192851 GCGGGGGCGGGCGCGGGCGCGGG - Intronic
1152175161 17:78782349-78782371 GCGGGCGCAGGCGCAGGCGCGGG - Intergenic
1152357353 17:79813560-79813582 GGGCGGGCGGGCGCTGTCGCCGG + Intergenic
1152541914 17:80981135-80981157 GGGCGCGGGGGCGGGGGCACGGG - Intergenic
1152598942 17:81251914-81251936 GCGCACACGGGGGGCGGCGCGGG - Intronic
1152628853 17:81400585-81400607 GCGCGGGCTGGGGGTGGCGCGGG + Intronic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1152721890 17:81927487-81927509 GCGGGCCCGGGCGGTGGGGGCGG - Intronic
1152729194 17:81961467-81961489 GCGGGGGGGGGCGGCGGCGCCGG - Intronic
1152758864 17:82098126-82098148 GAGGGCGCGGGCGGCGGTGCGGG + Exonic
1152781506 17:82229126-82229148 TCGCGCGCGGGCCGGGGCCCAGG + Intronic
1153006228 18:500650-500672 GCGCGGGCCGGCGGCGGCGAGGG - Exonic
1153219379 18:2847961-2847983 GCGCGCCCGGGCCGGGGCGGTGG + Intronic
1154447988 18:14450366-14450388 ACGGGCGCGGGCGCGGGCGCGGG - Intergenic
1155284273 18:24272065-24272087 CCGCTGGCGGGCGGAGGCGCAGG + Intronic
1155570344 18:27185372-27185394 GCGGGCGGGGGCGGGGGCGCGGG - Intergenic
1155570348 18:27185378-27185400 GCCCGGGCGGGCGGGGGCGGGGG - Intergenic
1156099639 18:33578394-33578416 GCGCGCGACGGCGGCGGCGGCGG - Intergenic
1156099675 18:33578492-33578514 AGGCGCGCGGGCGGTGGCGGCGG - Intergenic
1156501996 18:37566082-37566104 GCGCGCGCGGAGGAGGGCGCGGG + Intergenic
1157794067 18:50559539-50559561 GCGCGCGCGGGAAGGGGCACTGG - Intergenic
1158954145 18:62523560-62523582 GGGCCCGCGGGCGGCGGCGGCGG - Exonic
1159489074 18:69106207-69106229 GCGCTGGAGTGCGGTGGCGCTGG + Intergenic
1159770370 18:72541726-72541748 GCGCGCGCGGGCTGGGGTTCAGG - Intronic
1159798101 18:72867774-72867796 GCGGGCGGCGGCGGCGGCGCCGG + Exonic
1159952709 18:74496596-74496618 GAGCGCGCGGTCGGGGGCGGAGG + Intronic
1160454726 18:78992544-78992566 GCGCGCGCGGCAGGCGGCTCGGG + Exonic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160500718 18:79400133-79400155 GCGCGAGGGGGCGGGGGCGGGGG + Intronic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160680346 19:409227-409249 TCCCGCGGGGGCGGGGGCGCGGG - Intergenic
1160719168 19:590015-590037 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1160719182 19:590054-590076 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1160739637 19:680006-680028 GTGCGCGCGGGCCGGGGCGGGGG - Intronic
1160745466 19:709160-709182 GCGCGCTCGGGCCGCGGGGCTGG + Intronic
1160795071 19:941419-941441 GCGGGCGCGTGAGGTGCCGCTGG - Intronic
1160822427 19:1064770-1064792 ACGCGGGCGGGGGGTGGCGGGGG + Intronic
1160907266 19:1457216-1457238 GGGCCCGAGGGAGGTGGCGCCGG + Exonic
1160909003 19:1466252-1466274 GCGCACGCGGGCGTCGGCGGAGG - Exonic
1160930569 19:1567943-1567965 GCGCCCTCGGGCGGGGGCGCAGG + Exonic
1160930620 19:1568094-1568116 GCGGGCGGCGGCGGCGGCGCGGG - Intergenic
1160948029 19:1652403-1652425 TCGCGCGTGGGCGGCGGCGGCGG + Intronic
1161031132 19:2058219-2058241 GTGAGGGCGGGAGGTGGCGCAGG - Intergenic
1161150030 19:2702693-2702715 GCGCTCGCGGGCCGGGGCGGAGG - Exonic
1161207206 19:3047301-3047323 GGGCGGGCGGGCGGAGGCGCGGG - Intronic
1161333817 19:3700393-3700415 CCGCGCGCGGACGGCGGCGGGGG + Exonic
1161388075 19:4007541-4007563 GCGAGCGGGGGGGGGGGCGCTGG + Intergenic
1161454138 19:4361803-4361825 GCGGGAGCGGGCTGTGGGGCTGG + Intronic
1161461559 19:4400567-4400589 GCGCGCGCGGGGGCCGGCACCGG - Intergenic
1161802579 19:6424394-6424416 GCGCGCGCAGGCGGGGGAGGGGG - Intronic
1162027707 19:7903917-7903939 GTGCGCGGCGGCGGTGGCGGCGG + Exonic
1162031154 19:7917771-7917793 ACCCGCGCCGGTGGTGGCGCTGG + Exonic
1162033161 19:7925937-7925959 GCGCGCCGGGGCGGGGGCGGTGG - Intronic
1162562409 19:11424214-11424236 GGGCGCGGGGGCGGTGGCTGTGG + Intronic
1162733790 19:12734587-12734609 GGCCCCGCGGGCGGTGGCGGTGG - Exonic
1162742692 19:12782655-12782677 GCGTGCGTGGGCGGTGGCGGGGG + Intronic
1162954504 19:14090787-14090809 GGGCGCGCGTGCGGCGGCGGCGG - Intronic
1163262175 19:16197981-16198003 GCGGCCGAGGGCGGTGGCGGCGG - Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163358304 19:16829424-16829446 GCGCACGCTGGCGGTGGCAGCGG + Exonic
1163427134 19:17245874-17245896 GCGCGCGGGGTCGGTGGCGGTGG - Exonic
1163708635 19:18832402-18832424 GCGGGCGCGGGCGCTGCGGCGGG + Exonic
1163720439 19:18895967-18895989 CAGCGCGCTGGCGGCGGCGCGGG - Exonic
1164155746 19:22596038-22596060 GCGGGCGGGGGCGGGGCCGCAGG - Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1165079997 19:33301681-33301703 GCGCCCGCGCTCGGTGCCGCCGG - Exonic
1165349521 19:35268519-35268541 GCGCGCGGCGGCGGCGGCGGCGG - Intergenic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165349924 19:35269726-35269748 GGGCGGGCGGGCGGGCGCGCCGG + Intronic
1165745862 19:38229298-38229320 GCGCGGGCTGGGGGTGGCGGAGG - Intronic
1166347766 19:42177012-42177034 GCGCGGGCGGGCGGGCGGGCAGG + Intronic
1166371177 19:42302176-42302198 GGGGGCGCGGGGGGTGGCTCAGG - Intronic
1166754036 19:45179594-45179616 GAGCGCGCGGGGGCGGGCGCCGG - Exonic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167369657 19:49072839-49072861 GCAGGCGCGGGCGGCGGCGGCGG - Exonic
1168247035 19:55117589-55117611 GGGCGGGCGGGTGGTGGCGGCGG - Intergenic
1168305619 19:55433542-55433564 GCGCGCGCGCCTGGTGTCGCAGG - Exonic
1168315187 19:55481973-55481995 GCGCGGGCGGGCTGTGGGGCTGG - Exonic
1202696830 1_KI270712v1_random:132051-132073 GGGCGCGCGGGCAGAGGTGCGGG + Intergenic
1202710754 1_KI270714v1_random:18293-18315 GGGCGGGCGGGCGGGGGCGGCGG + Intergenic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
925609797 2:5693163-5693185 GGGAGCGCGGGCGGAGGCGCGGG + Exonic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927692227 2:25216204-25216226 GCGCGCGCATGCGTTGGGGCGGG + Intergenic
927714210 2:25341907-25341929 GGGCGCGCGGGCGGCGGCGGCGG - Intronic
927965085 2:27263189-27263211 GCGCTCCCGGGCTCTGGCGCGGG - Exonic
929808666 2:45169952-45169974 GGGCGTGCGGGCCGCGGCGCGGG - Intergenic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
934277986 2:91589065-91589087 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
934539084 2:95159672-95159694 GCGGACGCGGGGGCTGGCGCGGG - Intronic
934539093 2:95159695-95159717 GCGGACGCGGGGGCTGGCGCGGG - Intronic
934539102 2:95159718-95159740 GCGGACGCGGGGGCTGGCGCGGG - Intronic
934661310 2:96145081-96145103 GCTGGCGCGGGCCGTGGTGCTGG - Exonic
934763903 2:96869945-96869967 GCGCGGGCAGGCGGCGACGCGGG - Exonic
934966820 2:98730995-98731017 GCGGGGGCGGGAGGGGGCGCGGG - Intronic
936512163 2:113157340-113157362 AGGCGGGCGGGCGGCGGCGCAGG - Intronic
937134941 2:119544459-119544481 GCGGGCGCCGGCGCTGGCGCCGG + Exonic
937203895 2:120223583-120223605 GCGCGCGCGAGCAGAGGCGGTGG + Intergenic
937221734 2:120346046-120346068 GGGCGGGCGGGCGGAGGCCCGGG + Intergenic
937221740 2:120346062-120346084 GCCCGGGCGGGCGCGGGCGCGGG + Intergenic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
937296860 2:120814779-120814801 GCGGGGGCGGGGGGTGGGGCGGG - Intronic
937439826 2:121906302-121906324 GGGGGTGGGGGCGGTGGCGCGGG - Intergenic
938034867 2:128027626-128027648 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938338996 2:130523052-130523074 GGGGGCGCGGGAGTTGGCGCCGG + Intronic
938350842 2:130597698-130597720 GGGGGCGCGGGAGTTGGCGCCGG - Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938406245 2:131034878-131034900 GCGGGCGGGGGCGGCGGCGGCGG - Intronic
939153801 2:138501747-138501769 GCGCGCGGCGGCGGCGGCGGCGG - Intergenic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
939613035 2:144332596-144332618 GCGCGGGCGGGCCGAGGGGCGGG - Intergenic
941020932 2:160407550-160407572 GCGGGTGCGGGCGCGGGCGCGGG + Intronic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942046639 2:172102785-172102807 GCGAGCGCGGGCTCTGGCGGGGG + Exonic
943266561 2:185739123-185739145 GCGCCCGGGGGCGGTGGCGGTGG + Intronic
943669862 2:190649081-190649103 CGGCGCGCGGGCGGCGGCGGCGG - Intronic
945080930 2:206085674-206085696 GCGCCCGCGGGCGGCGACGGCGG - Intronic
946692432 2:222319542-222319564 GCGGGCGCGGGCAGGCGCGCGGG + Intergenic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
948046856 2:234951939-234951961 GGGGGCGGGGGCGGGGGCGCGGG - Intergenic
948115827 2:235493991-235494013 GCGGGCGCGGGCGCGGGCGAGGG + Intergenic
948115828 2:235493997-235494019 GCGGGCGCGGGCGAGGGCGAAGG + Intergenic
948140865 2:235670843-235670865 GCGCGCGCGGGCGGCGGCCGGGG + Intronic
948207218 2:236168558-236168580 GAGCGCGCGGGCCGGGGAGCCGG + Intergenic
948645226 2:239400436-239400458 GCCCGCCGGGGCGGGGGCGCGGG - Exonic
948645331 2:239400754-239400776 GCGCCGGCGGGTGGCGGCGCAGG - Exonic
948823244 2:240560843-240560865 GCGCGCGCGGGCCGGGCTGCTGG - Exonic
948945678 2:241217927-241217949 GCGCGCAGGGGCGGGGGCGGGGG + Intronic
949014529 2:241702016-241702038 GCGCGGGCGGGCGGTGCCGCGGG - Intronic
949014623 2:241702287-241702309 GCGGGCGCGGGGGGTCCCGCCGG + Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168795883 20:610041-610063 GCGGGCGGCGGCGGCGGCGCGGG - Exonic
1169262574 20:4149129-4149151 GGGCGCTCGGGCGGGGGTGCGGG + Intronic
1169278455 20:4248794-4248816 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1172083231 20:32358705-32358727 GCGGGCTGGGGCGGTGGCGCGGG - Exonic
1172274930 20:33674262-33674284 GCGCGAGCTGGGGGTGCCGCGGG + Exonic
1172404451 20:34677176-34677198 GCGCGCGCTGCCGCTGGCGCCGG + Intergenic
1172644601 20:36461752-36461774 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1173279982 20:41618791-41618813 GCGCGCTCGGGCGCCGGCGGGGG + Intergenic
1173454160 20:43189993-43190015 GCCCGGGCGGGCGGCGGCGGCGG - Intergenic
1173750061 20:45469700-45469722 GCGCGCGCGGGAGGGGGCGTGGG - Exonic
1173843658 20:46174837-46174859 GGGGGCTCGGGCGGGGGCGCGGG - Exonic
1174386612 20:50191337-50191359 GCGGGCGCGGGGGCGGGCGCGGG - Exonic
1175847094 20:62064978-62065000 GCGGGCGCGGGGGGTGGCGGGGG + Exonic
1176005715 20:62861396-62861418 GCGGGCCCGGGCGCAGGCGCGGG - Exonic
1176005862 20:62861919-62861941 GGGCGTGCGGGCGGTTGGGCGGG - Intergenic
1176131641 20:63498941-63498963 GCGCGCGCGGGGGCGGGTGCGGG + Intronic
1176549955 21:8216878-8216900 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176568881 21:8399912-8399934 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1176569428 21:8401994-8402016 GCGCGCGCGTGCGGGGGGCCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176576795 21:8444147-8444169 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1178534891 21:33403322-33403344 CCGCGCGGGGGCGGTGGCCTCGG + Exonic
1179197995 21:39183607-39183629 GCGCGGGCGGGCGGTGTAGAGGG - Exonic
1179243858 21:39613135-39613157 GCGCGCGGGGGCGTGGGTGCCGG + Intronic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1179457312 21:41508251-41508273 GCGGGCGGGGGCGGGGGCGGCGG + Intronic
1179563948 21:42234866-42234888 CCCGGCGCGGGCGGTGGCGGCGG - Intronic
1179796757 21:43789495-43789517 GTGCGCCTGGGCGGTGTCGCGGG + Exonic
1179893652 21:44350093-44350115 GCGGGCGCGGGACGCGGCGCGGG + Intergenic
1180086515 21:45510141-45510163 GCAGGCGCGGGCCGTGGGGCTGG + Exonic
1181017647 22:20080404-20080426 GCGCCCGCGGGCGGTTGGGCGGG + Intronic
1182149514 22:28018299-28018321 GCGCGCGCGGGGGGGGGGGCGGG + Intronic
1182222980 22:28773102-28773124 GCGGGCGCGGGCAGGGGCGCGGG + Intronic
1182237006 22:28883820-28883842 GGCCGCGGGGGCGGCGGCGCAGG - Exonic
1182532129 22:30968867-30968889 CGGCGCGCGGGCGGCGGCGGAGG - Intergenic
1182586322 22:31346092-31346114 GCGAGCCGGGGCGGGGGCGCCGG + Exonic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1182586369 22:31346229-31346251 GAGCGGGCGGGCGGCGGCGGCGG + Exonic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183441304 22:37824650-37824672 CCGGGCGCGGGACGTGGCGCGGG + Intronic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183486185 22:38088892-38088914 GAGCGCCCGGGCGGCGGCGGGGG - Exonic
1183683672 22:39349906-39349928 GCGCGCGCGGCCGGCGGCCCAGG - Intronic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184086630 22:42269908-42269930 GCGAGCGCGGCCGGTGCCCCCGG + Intronic
1184164857 22:42720989-42721011 GGGCGCGCGGGCGGGGTCGCGGG - Intronic
1184276481 22:43411949-43411971 GCGCGGGCGGGCGGCGGAGGGGG + Intronic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184523809 22:45009886-45009908 GCTCGCGCGGGAGGAGGCGGCGG - Intronic
1184663577 22:45976436-45976458 GGGCGCGCGGGCGGTCCGGCCGG - Intronic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1184680918 22:46071720-46071742 GCGCGCTCGGGCGGGGACGGCGG + Intronic
1185037912 22:48489404-48489426 GCGGGCGCGGGCGCGAGCGCGGG + Intergenic
1185055287 22:48575921-48575943 GCGAGCGCGGGCGGCGGAGGAGG + Intronic
1185055449 22:48576377-48576399 GCGCGAGCGGGCGGCCGCGGAGG + Intronic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185255206 22:49827766-49827788 GCGGGCGCGGGCGCGGGAGCGGG + Intergenic
1185296716 22:50058314-50058336 GCGCGGGCGGCGGGGGGCGCGGG + Intergenic
1185302541 22:50090035-50090057 GCGCGTGCGGGCGGCGGCAGCGG + Exonic
1185343051 22:50300061-50300083 GAGGGCGCGGGCGGTGGCCGTGG - Intronic
1185349398 22:50326773-50326795 GCGGGCGCGGGCGGGTGGGCAGG - Intronic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203254845 22_KI270733v1_random:133204-133226 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1203255058 22_KI270733v1_random:133692-133714 GCGCGCGGCGGCGGCGGCGGCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203262901 22_KI270733v1_random:178283-178305 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1203263114 22_KI270733v1_random:178771-178793 GCGCGCGGCGGCGGCGGCGGCGG + Intergenic
950345324 3:12287848-12287870 GCGGGGGCGGGCGCGGGCGCCGG - Intronic
950438520 3:12994257-12994279 CGGCGCACGGGCGGTGGGGCGGG - Intronic
950509990 3:13420285-13420307 GCGCGCGCGGGCGGGAGCGGAGG - Exonic
950729785 3:14947604-14947626 CAGCGCGCGGGCGGCGGCGGCGG + Intronic
951611170 3:24494529-24494551 GCGCGCGCGGGCGGGCAGGCGGG - Intronic
951907813 3:27721639-27721661 GCCGGTGCGGGCAGTGGCGCGGG - Exonic
952334303 3:32391808-32391830 GCGGGGGCGGGCGCTGGCGAGGG - Exonic
953705142 3:45225509-45225531 GGGCGCCCCGGCGGTGGCGGCGG + Exonic
954138960 3:48595267-48595289 GCGGGAGCGGGCGGACGCGCAGG - Exonic
954367815 3:50155520-50155542 GGGCGCCCGGGCGGCGGCGGCGG - Exonic
954539716 3:51385363-51385385 GCAGGGGCTGGCGGTGGCGCTGG + Exonic
956892355 3:73624901-73624923 GAGCGCGCGGGCGGCGTAGCCGG - Exonic
958779406 3:98522960-98522982 GTGGGGGCGGGCGGAGGCGCGGG - Intronic
960664122 3:120094037-120094059 GCGGGCGGTGGCGGTGGCGGCGG + Intronic
961545297 3:127629141-127629163 GGCCGCGCGGGCGGCGGCGGCGG - Intergenic
963168170 3:142225628-142225650 GCGCGCGCCGGCGGCCGCGCGGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964720752 3:159765213-159765235 CCGCGGGCGGGCGGGAGCGCAGG - Intronic
966182158 3:177197371-177197393 GCGCACGCGGCCGGCGGCGGGGG + Intronic
966182221 3:177197632-177197654 GAGCGGGCGGGCGGGCGCGCGGG + Intergenic
966594205 3:181711785-181711807 CCCCGCGCGGCCGGCGGCGCGGG + Intergenic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
968026045 3:195443139-195443161 GCGCCCGCAGGCGGTGCTGCCGG - Intergenic
968051463 3:195657912-195657934 GGACCCGCGGACGGTGGCGCTGG - Intergenic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968302654 3:197628011-197628033 GGACCCGCGGACGGTGGCGCTGG + Intergenic
968514715 4:1011351-1011373 GGGCGCGCGGGCGGGGCCGGGGG + Intronic
968518355 4:1024151-1024173 GCGCTGGCGGGCGGGGGTGCTGG + Intronic
968613886 4:1568778-1568800 GCGCGGGTGGGAGGCGGCGCGGG - Intergenic
968636570 4:1684108-1684130 GCGCGGGCGGTCGTGGGCGCGGG - Intronic
968641500 4:1717213-1717235 GCGTGCGCGGCAGGTGGGGCAGG + Exonic
968701208 4:2059100-2059122 ACGGGCGGGGGCGGCGGCGCGGG - Intergenic
968701434 4:2059841-2059863 GCGCGCGCGGGTGCTGCCGCAGG - Exonic
968831459 4:2934594-2934616 GGGCGCGCGGGGTGTGGGGCTGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
968965564 4:3767531-3767553 GCGGGCGCGGAGGGGGGCGCGGG + Exonic
969032751 4:4227271-4227293 GGGCGCGCGGGCGGAGGTGCGGG - Intergenic
969716893 4:8872050-8872072 GCGCAGGCGGGGGGTCGCGCCGG + Intergenic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972533051 4:39977569-39977591 GGGCGGGCGGGCGGCGGCGGCGG - Exonic
973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG + Intergenic
974047129 4:56907836-56907858 GCGCGCGCGGGCGTCGGAGGGGG + Intergenic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
975778927 4:77819523-77819545 GGGCTCGCGGGCGGGCGCGCAGG + Intronic
975883643 4:78939521-78939543 GCGTGCGCTGGCGGCGGCCCGGG + Intergenic
977536328 4:98260452-98260474 GTGGGAGCGGGCGGTGGCCCCGG + Intergenic
977810042 4:101347426-101347448 GCGAGCGCGGGCGATCGCGGCGG - Exonic
978126842 4:105146191-105146213 GCGCGCGGGGGCGTGTGCGCGGG + Intronic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
983941477 4:173538214-173538236 GCCCTCGCGGCCGGCGGCGCGGG + Intergenic
983941619 4:173538839-173538861 ACGCGCGCGGGGGGAGGCGGCGG + Intergenic
984167590 4:176320558-176320580 GCCCAGGCGGGCGGCGGCGCCGG - Intronic
984778543 4:183504737-183504759 GCGGCCGCGGGCGGAGGGGCGGG + Intergenic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985512922 5:322137-322159 GCGGGTGCGGGCGGCGGAGCGGG + Intronic
985628933 5:1004962-1004984 GCGGGCGCGGGCGGCCGTGCCGG + Intergenic
986402792 5:7396050-7396072 CCGCGCGGTGGCGGTGGCGGCGG + Intergenic
987132454 5:14871977-14871999 GCACGCTCGGGCCGTGGGGCTGG + Intergenic
990376559 5:55176526-55176548 GCGGGAGCGGGCGCGGGCGCGGG - Intergenic
992473152 5:77077401-77077423 GCGCGAGCTGGCCGTGGAGCAGG - Exonic
992487596 5:77210887-77210909 GCGGGCGCGGGCGGGCGCGCGGG + Exonic
992866330 5:80960548-80960570 GCGCGCGGTGGCAGGGGCGCGGG - Intergenic
993519465 5:88883246-88883268 GCGCGCGAGGGGGGGGGCGCGGG + Intronic
993726949 5:91380226-91380248 GGGCGCGCGGGCGGCAGCGGCGG - Intronic
994367109 5:98928812-98928834 GCGCGCGACGGCGGCGGCGGCGG - Exonic
995354696 5:111224333-111224355 GCGAGCGCGGGCGGCGGCGGTGG + Exonic
996404296 5:123090644-123090666 GCGCCCGCCGGCGCCGGCGCCGG - Intronic
997470609 5:134115084-134115106 GAGGGCGCGGCCGGCGGCGCAGG + Exonic
997485265 5:134225901-134225923 CCGTGTGCGGGCGGCGGCGCGGG - Exonic
997900015 5:137755045-137755067 GTGCGGGCGGGAGGTGGGGCGGG - Intergenic
997963274 5:138338390-138338412 GGCCGCGCGGGCGGTCGGGCTGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999157237 5:149466791-149466813 GCGTGGGCGGGAGGTGGCACAGG + Intergenic
999252358 5:150190364-150190386 GGGCACGAGGGCGGGGGCGCTGG + Intronic
999696235 5:154190637-154190659 GGGCCCGGGGGCGGTGGCGGCGG + Intronic
999696309 5:154190887-154190909 GCTCCTGCAGGCGGTGGCGCTGG + Exonic
1001065049 5:168529523-168529545 TCGCGCGGGGGCGGTGGGGGCGG + Exonic
1002001517 5:176199022-176199044 GCGCCCGCGGGCAGCGGGGCTGG - Intergenic
1002186058 5:177455383-177455405 GCGTGCGCGTGCGGCTGCGCGGG - Exonic
1002277514 5:178113601-178113623 ACGCGGGCGGGCGCCGGCGCCGG - Exonic
1002455900 5:179345219-179345241 GCGTTCGCGGGCGGCGGCGGCGG + Exonic
1002638378 5:180619181-180619203 CCGCGGGCGGGAGGGGGCGCGGG - Intronic
1003175765 6:3751561-3751583 GGGCGGGCGGGCGGCGGGGCTGG - Exonic
1004561908 6:16760357-16760379 GCGGGTGCTGGCGGGGGCGCCGG + Intronic
1004627977 6:17394094-17394116 GGCCGGGCGGGCGGCGGCGCTGG - Intronic
1005875385 6:30006939-30006961 GCGGGCGCGGTGGGTGGAGCAGG + Intergenic
1006137145 6:31902042-31902064 GCGCGCGGCGGCGGCGGCGTCGG + Intronic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006472950 6:34238244-34238266 GCGCGCGGGGGGAGGGGCGCAGG - Intronic
1006606251 6:35259741-35259763 GGGCGGGCGGGCTATGGCGCAGG + Exonic
1006717594 6:36130451-36130473 CCGCGCGAGGGCGGGGGCCCCGG - Exonic
1006776166 6:36594208-36594230 GCGCGCTCTGGCGGTTGCGCCGG - Intergenic
1006922381 6:37635303-37635325 GCACGAGCGGGAGGTGGCGAAGG + Exonic
1007739634 6:44002763-44002785 GCGCGCGGCGGCGGCGGCGGCGG + Exonic
1008013246 6:46491008-46491030 GGGGGCGGGGGCGGTGGCGGGGG - Intronic
1010001937 6:70956889-70956911 TCGAGGGCGGGCGGCGGCGCTGG + Exonic
1010703455 6:79078342-79078364 GCGCCGGGGGGCGGGGGCGCGGG - Intergenic
1011226611 6:85114979-85115001 GGGGGCGGGGGCGGGGGCGCCGG + Intergenic
1013170831 6:107635083-107635105 GGGGGCGCGGGCGGCGGCGGCGG - Exonic
1016340919 6:143060816-143060838 CCGGGCGCGGGCGCGGGCGCGGG - Intronic
1017793622 6:157823030-157823052 GCGCCCGGGGGCGGCGGCGGCGG + Intronic
1018374239 6:163195828-163195850 GCGGGCGCGGGAAGGGGCGCAGG - Intronic
1018728001 6:166627977-166627999 GCGCCCGAGGGCGGGGGCTCAGG + Intronic
1019125719 6:169839064-169839086 GAGCGTGAGGGCCGTGGCGCAGG + Intergenic
1019298467 7:291038-291060 GCGCGCGCGGAGGGAGGGGCTGG - Intergenic
1019457471 7:1138045-1138067 GCGCGACCGGGCGGCGGCCCTGG - Exonic
1019474637 7:1238195-1238217 GCGGGCAGGGGCGGGGGCGCGGG - Intergenic
1019536116 7:1530722-1530744 GCGGGCGGGTGCGGTGGCGGCGG + Exonic
1020278307 7:6637512-6637534 GCGCTCGGGGGCGGCGGCGGCGG + Intronic
1021717311 7:23471295-23471317 GCGAGCGCAGGCGGAGGCGGAGG - Intergenic
1021719253 7:23490446-23490468 GCGGGCGCGGGCGGGCGGGCGGG + Intergenic
1021969376 7:25951404-25951426 GCGCGTGGGGGCGGGGGCGGGGG + Intergenic
1023810280 7:43906399-43906421 GCGCGAGCGGGCCGTGGGCCTGG + Intronic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1024043823 7:45574465-45574487 CGGGGCGCGGGCGGCGGCGCCGG - Intronic
1024089107 7:45921062-45921084 CCGCGGGCCGCCGGTGGCGCGGG - Exonic
1024965343 7:55018993-55019015 GCTCGCGCGGGCCGAGGCGCGGG - Intergenic
1025481897 7:60992751-60992773 GCGGCCGCGGAGGGTGGCGCAGG + Intergenic
1026017388 7:66682093-66682115 GCGTGCGCTGGCGGTGCCGGGGG + Intronic
1026772861 7:73213204-73213226 GCTCCCGCGGGGGGTGGGGCTGG + Intergenic
1027059361 7:75073459-75073481 GCGCGGTCGGGCGCCGGCGCGGG + Exonic
1027190821 7:75994632-75994654 GCGGACGGGGGCGGTGGCGGAGG - Exonic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029483723 7:100827219-100827241 GCGCGCGCGGGCGGCGGGCCCGG + Exonic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1029537020 7:101163070-101163092 GCGCGCGCAGGAGGAGGCGGAGG - Exonic
1029896402 7:103989364-103989386 GCGCGCGGCGGCGGCGGCGGCGG - Exonic
1030348222 7:108456357-108456379 GCGGGCGCGGGGGACGGCGCAGG - Exonic
1031043546 7:116862911-116862933 GCGACGGCGGGCGGGGGCGCGGG + Intronic
1031043548 7:116862917-116862939 GCGGGCGGGGGCGCGGGCGCGGG + Intronic
1031468523 7:122143468-122143490 GCTCGCGCGGGACGGGGCGCGGG - Intronic
1032119311 7:129144951-129144973 GCCCCCGGGGGCGGTGGCGGCGG + Exonic
1032298798 7:130668394-130668416 GCGCGCGCGGGCGCCGGGGCGGG + Intronic
1033299936 7:140176667-140176689 GCGCGGGCGGCCGGCGGCGGCGG + Intronic
1033595332 7:142854924-142854946 GCGCGCCGGGGCGGAGGAGCGGG + Intergenic
1034218125 7:149423101-149423123 GCGCCCGCGGGCGGCGACCCCGG - Intergenic
1034324614 7:150219786-150219808 TCTCCCGCGGGCGCTGGCGCTGG - Intergenic
1034418801 7:150978414-150978436 TCGGGCGCGCGCGGTGGGGCGGG - Intergenic
1034768580 7:153749445-153749467 TCTCCCGCGGGCGCTGGCGCTGG + Intergenic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1035021834 7:155805033-155805055 GAGCACACGGGCGGGGGCGCGGG - Intronic
1035221697 7:157410109-157410131 GCGGGCGTGGGCGGTCGGGCGGG + Intronic
1037361981 8:18083916-18083938 GCGGGCGCGGATGGAGGCGCAGG - Intronic
1037825302 8:22156823-22156845 GGGCGCGCGCGGGGCGGCGCGGG + Exonic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037901770 8:22692975-22692997 GCGAGCGGCGGCGGTGGCGGCGG - Exonic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038319440 8:26513974-26513996 GCGCGGGCGGGGCGCGGCGCCGG - Exonic
1039493587 8:37965336-37965358 GGCCGGGCGGGCGGCGGCGCAGG + Exonic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039903265 8:41767661-41767683 GCGCGCGGGGGCGCGGGCGGGGG + Intronic
1039918360 8:41875989-41876011 GCGCGCGCGGGGCCAGGCGCGGG - Intronic
1039948944 8:42153036-42153058 GCGCGCGCGGCGGGCGGGGCGGG + Exonic
1040032974 8:42842956-42842978 GGGCGCGCGGCCGGCGGGGCCGG - Intronic
1040471664 8:47739019-47739041 GCGGGCGCGGGAGCTGGCGGCGG - Exonic
1041068168 8:54101953-54101975 GCGCGCGCGGAAGGTAGCGCGGG - Exonic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1043502973 8:80874375-80874397 GCGCGCGCGGGCTCGGCCGCCGG - Intronic
1044692901 8:94896271-94896293 GGGCGCGCTGGCGGCGGCGGCGG - Intronic
1045488524 8:102653855-102653877 GGAAGCGCGGGCGGAGGCGCGGG + Intronic
1046871403 8:119208758-119208780 GAGGGCCCGGGCGGCGGCGCGGG - Intronic
1047097676 8:121641550-121641572 GCGCGGGCGGGCGGGCGAGCGGG + Intergenic
1047393704 8:124474954-124474976 ACGCGAGCGGGCGGCGGGGCTGG + Exonic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1049218196 8:141417383-141417405 GAGTGCCCGGGCGGTGGGGCTGG + Intronic
1049405318 8:142449706-142449728 GCGGGCGCAGGCGGCGGCGGCGG + Exonic
1049405892 8:142451704-142451726 GGCCGCGCGGGCGGAGGCGGGGG + Intronic
1049548537 8:143246097-143246119 GGGCGCGCACGCGGTGGCGGCGG + Intergenic
1049552625 8:143267489-143267511 GTGGGCGCGGGCGGCGGCGGCGG + Intronic
1049668806 8:143860555-143860577 GCGGGCGGCGGCGGTGGCGGCGG + Exonic
1049669221 8:143862157-143862179 GCGGGCGGCGGCGGTGGCGGCGG + Exonic
1049724225 8:144138068-144138090 GAGCGCGCGGGCGGCGTCCCGGG - Exonic
1049724286 8:144138329-144138351 GGGCGCGCGGGCGTTGTAGCCGG - Exonic
1049752429 8:144291550-144291572 GCTCGCGCCGGGGGTGACGCGGG + Intergenic
1049762196 8:144336651-144336673 GCCCCCGGGGGCGGCGGCGCCGG + Intergenic
1049762222 8:144336745-144336767 GCGCGCCCGGGCGCTGGCCGCGG - Intergenic
1049788672 8:144463082-144463104 GCCCACGCGAGCTGTGGCGCCGG + Intronic
1049879457 8:145052277-145052299 GCGCGGGCGGGGCGGGGCGCGGG - Intergenic
1051418810 9:16870806-16870828 GCGCGCGCGGGCGGGCGGGGAGG - Intronic
1052362214 9:27573444-27573466 GCCCGCGGCGGCGGAGGCGCAGG - Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053306143 9:36986086-36986108 GCGCGCCGGGGCGAGGGCGCCGG - Intronic
1057259744 9:93576934-93576956 GGGCGCGCAGCCGGGGGCGCGGG - Intronic
1057490473 9:95516301-95516323 GCGCGCCGGGGCCGTGGAGCCGG - Intronic
1057546223 9:96021773-96021795 GGGCGGGAGGGCGGAGGCGCCGG + Intergenic
1057596097 9:96417583-96417605 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1057832687 9:98419095-98419117 GCCCGGGGGGGCGGTGGAGCAGG + Intronic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1058885838 9:109320699-109320721 GCGCGCGGCGGCGGCGGCGGCGG - Exonic
1059470931 9:114504710-114504732 GCGGGCGGCGGCGGGGGCGCGGG - Exonic
1060087330 9:120714429-120714451 GCGCCCGGTGGCGGTGGCGGCGG - Exonic
1060283371 9:122228488-122228510 GCGCGCGCGAGCGGGGGGGGGGG - Intronic
1060477948 9:123999685-123999707 GCGCGTGCGGCCGGGGGCGGGGG - Intergenic
1060477963 9:123999732-123999754 GTGGGCGCGGGCCGCGGCGCGGG - Intergenic
1060514581 9:124257939-124257961 GCCCGCGCAGGCGGTGGCGGCGG + Intronic
1060599589 9:124869153-124869175 GCGCGCGGAGGCGGTGGAGGAGG + Exonic
1060629479 9:125143221-125143243 GCGCCTGCAGGCGGCGGCGCGGG - Intronic
1060856031 9:126915264-126915286 GCGGGCGCGGGGGGCGGGGCCGG + Intronic
1060979725 9:127785431-127785453 GAGCGGGCGGGCGGTGGCGGCGG + Intergenic
1060982723 9:127803020-127803042 GAGCGCGTGGCCGGTGCCGCAGG + Exonic
1061129846 9:128702737-128702759 GCGCGGACGGGAGGCGGCGCTGG + Exonic
1061208471 9:129177469-129177491 GCGGGCGCGGGCGGCGGCAGCGG + Exonic
1061415384 9:130444696-130444718 GGGCGCGCCGGCGGGGGCGCAGG - Intergenic
1061489799 9:130938672-130938694 GTGGGCGCGGGCGCGGGCGCGGG + Exonic
1061967751 9:134025613-134025635 GCGCGCGGGGTCTGGGGCGCGGG + Intergenic
1061976105 9:134068543-134068565 GCGCGCGCGGGGCGGGGGGCGGG + Intergenic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062346771 9:136118610-136118632 GGGCGCGCGGCTGGGGGCGCTGG + Exonic
1062360559 9:136186013-136186035 GCGGTGGCGGGCAGTGGCGCTGG + Intergenic
1062363556 9:136198593-136198615 GCGCGCGTCGGCGGGGTCGCAGG - Intronic
1062507619 9:136886227-136886249 GCGCGCCGGGGCGTTGGTGCGGG - Intronic
1062537650 9:137027946-137027968 GCGGGCGCTGGGGGCGGCGCGGG - Intronic
1062567465 9:137169718-137169740 GCGCGCGCAGGCGCAGGCTCAGG + Exonic
1062653543 9:137590473-137590495 GCGCGCGGTGGCGGTGGCGGCGG - Exonic
1062659037 9:137618906-137618928 GCAGGCGCGGGCGCAGGCGCAGG + Intronic
1062659180 9:137619292-137619314 GGGGGAGCGGGCGGGGGCGCAGG + Intronic
1203793032 EBV:161681-161703 GGGCACGCGGGCGGTGGAGTCGG - Intergenic
1203794642 EBV:169893-169915 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203794843 EBV:170431-170453 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203795034 EBV:170954-170976 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203795235 EBV:171492-171514 GCGGGAGCGGGGGGCGGCGCGGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471246 Un_GL000220v1:116349-116371 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1203471793 Un_GL000220v1:118431-118453 GCGCGCGCGTGCGGGGGGCCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203479067 Un_GL000220v1:160321-160343 GCGCGCGCGGGGTGGGGCGGGGG - Intergenic
1185751011 X:2609508-2609530 GAGGACGCGGGGGGTGGCGCGGG + Intergenic
1185778816 X:2828865-2828887 GCGCCCGCGGGGGCTGGCGGAGG + Exonic
1186410760 X:9342766-9342788 GCGCGGGCGGCCGGCGGCGTGGG - Intergenic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187154619 X:16712011-16712033 CCGGGTGCGGGCGCTGGCGCGGG + Exonic
1187181449 X:16946910-16946932 GCGGGCGGGGGCTGTGGCTCCGG + Exonic
1187226040 X:17375968-17375990 GCCGGCGCGGGCAGTGGCGGCGG - Exonic
1187547388 X:20267062-20267084 GCGCGCGGCGGTGGTGGCGGCGG - Intronic
1190266926 X:48832167-48832189 GCGGGCGCGGGCCGAGGCGCAGG - Exonic
1192656999 X:73003071-73003093 GCGCGAGCGGGAGCTGGCGCAGG - Intergenic
1192665121 X:73079930-73079952 GCGCGAGCGGGAGCTGGCGCAGG + Intergenic
1197870506 X:131058679-131058701 GAGCGCGTGGGCGGAGTCGCTGG + Intronic
1200058751 X:153474719-153474741 GGGGGCGGGGGCGGGGGCGCGGG + Intronic
1200058754 X:153474731-153474753 GGGGGCGCGGGCGCTGGCGCGGG + Intronic
1200084942 X:153599330-153599352 GCGCGCGCAGGCGCAGGCGCAGG + Intronic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic