ID: 968879797

View in Genome Browser
Species Human (GRCh38)
Location 4:3293040-3293062
Sequence GCGCGCGCGGGCGGTGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 9, 3: 93, 4: 613}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968879775_968879797 26 Left 968879775 4:3292991-3293013 CCCGCCCTCGCCTCGACCCCGGG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879787_968879797 9 Left 968879787 4:3293008-3293030 CCCGGGGGGCGGTGGCTGCCGAG 0: 1
1: 0
2: 3
3: 114
4: 4478
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879773_968879797 27 Left 968879773 4:3292990-3293012 CCCCGCCCTCGCCTCGACCCCGG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879785_968879797 16 Left 968879785 4:3293001-3293023 CCTCGACCCCGGGGGGCGGTGGC No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879782_968879797 21 Left 968879782 4:3292996-3293018 CCTCGCCTCGACCCCGGGGGGCG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879788_968879797 8 Left 968879788 4:3293009-3293031 CCGGGGGGCGGTGGCTGCCGAGG 0: 1
1: 0
2: 3
3: 48
4: 638
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879790_968879797 -9 Left 968879790 4:3293026-3293048 CCGAGGCGACCGTTGCGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879777_968879797 25 Left 968879777 4:3292992-3293014 CCGCCCTCGCCTCGACCCCGGGG No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879786_968879797 10 Left 968879786 4:3293007-3293029 CCCCGGGGGGCGGTGGCTGCCGA No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613
968879781_968879797 22 Left 968879781 4:3292995-3293017 CCCTCGCCTCGACCCCGGGGGGC No data
Right 968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG 0: 1
1: 0
2: 9
3: 93
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968879797 Original CRISPR GCGCGCGCGGGCGGTGGCGC GGG Intronic