ID: 968882969

View in Genome Browser
Species Human (GRCh38)
Location 4:3310558-3310580
Sequence AAGAGTGGCCAGGGACTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968882955_968882969 24 Left 968882955 4:3310511-3310533 CCAGGGCGGGCAGGTCCATGCTG 0: 1
1: 0
2: 3
3: 19
4: 184
Right 968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG 0: 1
1: 0
2: 1
3: 35
4: 281
968882964_968882969 -7 Left 968882964 4:3310542-3310564 CCAGGGAAGGTCTGGGAAGAGTG 0: 1
1: 0
2: 0
3: 49
4: 323
Right 968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG 0: 1
1: 0
2: 1
3: 35
4: 281
968882960_968882969 9 Left 968882960 4:3310526-3310548 CCATGCTGCTCTGGGTCCAGGGA 0: 1
1: 0
2: 1
3: 36
4: 379
Right 968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG 0: 1
1: 0
2: 1
3: 35
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968882969 Original CRISPR AAGAGTGGCCAGGGACTTGG AGG Intronic
900397056 1:2457346-2457368 GTGAGTGGCCAGGGGCTGGGGGG + Intronic
901360357 1:8693566-8693588 AGTGGTGGCCAGGGGCTTGGGGG + Intronic
902466826 1:16623845-16623867 ACGAGTGGCTGGGGACTTGGGGG - Intergenic
902507778 1:16948929-16948951 ACGAGGGGCTGGGGACTTGGGGG + Intronic
902608662 1:17583813-17583835 AATAGTGGGTAGGGACTTTGTGG + Intronic
903124218 1:21236721-21236743 GAGGCTGGCCAGGCACTTGGAGG - Intronic
904418751 1:30378177-30378199 CAGAGAGGCCAGGGCCTGGGAGG + Intergenic
904456791 1:30652468-30652490 ATCAGTGGCCAGGAACCTGGAGG - Intergenic
905788504 1:40776704-40776726 AAGAGAGAACAGGAACTTGGGGG - Intergenic
905960350 1:42037329-42037351 AATGGTTGCCAGGGACTGGGAGG + Intergenic
906347104 1:45023252-45023274 AATAGTTGCCAGGGACTTAGAGG - Intronic
908134422 1:61115538-61115560 AAGGTTGGCAAGGGACTTGCAGG + Intronic
911250258 1:95568385-95568407 GTCAGTGGCCAGGGACTTGGGGG + Intergenic
912698242 1:111857068-111857090 ACGAGTGTCCAGGAACTGGGTGG - Intronic
913535880 1:119771698-119771720 GGGAGTGGCCAGGGATTTGGAGG - Intergenic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
915159436 1:153907002-153907024 AAGTGTTGGCAGGGACGTGGAGG + Intronic
915771149 1:158426085-158426107 AAGAGAAGCCAGGGACATAGAGG + Intergenic
916313085 1:163418292-163418314 ACAAGTGGCCAGGTACTTGGAGG - Intergenic
917794513 1:178522939-178522961 AAGGGTAGTCAGGGGCTTGGGGG - Intronic
918936166 1:190924833-190924855 AAGAATGCCCAGTGTCTTGGGGG + Intergenic
919462350 1:197892919-197892941 AATAGTTGCTAGGGATTTGGGGG - Intergenic
920263171 1:204703453-204703475 AAGAGTGTGCAGGGAGCTGGAGG - Intergenic
921337360 1:214101523-214101545 ATTAGTGGCCAGTGAATTGGAGG + Intergenic
922206909 1:223456139-223456161 AAGGGTGGCCTGGTGCTTGGAGG - Intergenic
922796821 1:228343587-228343609 AGGAGCGGCCAGGGAGGTGGGGG + Intronic
922831286 1:228555750-228555772 AAGGCTGGCCGGGCACTTGGGGG + Intergenic
1063284547 10:4671220-4671242 ATGAGTGGGCATGGATTTGGGGG + Intergenic
1064134220 10:12736729-12736751 GAGAGCGGCCAGGGAGATGGTGG - Intronic
1065113452 10:22461956-22461978 ATGTGTGGCCATGGAGTTGGGGG - Intergenic
1065434822 10:25695259-25695281 AAGGGAGGCCAGGGGATTGGAGG - Intergenic
1066301552 10:34101753-34101775 AGGAGTGGCCTGGGACACGGTGG - Intergenic
1068616699 10:59126405-59126427 AAGAGAGACCAGGGACTGGGAGG - Intergenic
1070529672 10:77325639-77325661 TAGAATGGATAGGGACTTGGTGG - Intronic
1070714602 10:78710168-78710190 AAGAGATGCCAGGGATATGGGGG + Intergenic
1072714976 10:97744926-97744948 AAGAGAGGCCAGGGAGGTGGGGG + Intronic
1072793555 10:98336907-98336929 AAGAGTCGAAAGGGATTTGGAGG + Intergenic
1074348986 10:112716565-112716587 AAGAGAGAACAGGGACATGGAGG + Intronic
1074373116 10:112916632-112916654 AAGAGTGCCCAGGAACCTGCAGG - Intergenic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074815825 10:117140212-117140234 AAGAGGGGTAAGGGACTTTGCGG + Intergenic
1075098534 10:119489834-119489856 ATGGGTGCCCAGGGCCTTGGAGG + Intergenic
1075648107 10:124109652-124109674 GAGAGTCCCCAGGGAGTTGGGGG + Intergenic
1075656204 10:124162876-124162898 AGAAGTGGGCAGGGGCTTGGGGG - Intergenic
1075912143 10:126133744-126133766 TAGAGTGGACAGGGACAGGGAGG - Intronic
1076149915 10:128153522-128153544 AAGAGAGGCTGGGGACATGGTGG - Intergenic
1077391266 11:2301707-2301729 AAGTGTGGACTGGGCCTTGGGGG - Intronic
1077429527 11:2509251-2509273 AAGAGTGGCTTCGGACTTTGGGG + Intronic
1077439006 11:2559603-2559625 GAGAGAGGCAAGGGACTTGCTGG - Intronic
1077459935 11:2703956-2703978 AGGAGTGGACAGGAACGTGGGGG + Intronic
1079594244 11:22222661-22222683 GAGAGGGGCAAGGGACTTGGCGG - Intronic
1080052183 11:27869133-27869155 CATAGAGGCCAGGGACTTGCTGG - Intergenic
1080786375 11:35478581-35478603 AAGAGTGGAGAGGGAATTGAAGG - Intronic
1080857177 11:36122295-36122317 CAGAGTGGTCAAGGATTTGGAGG + Intronic
1081930995 11:46871341-46871363 AAGAGTAGCAAGGCACTCGGTGG + Intronic
1082894721 11:58177936-58177958 AAGAGTTGGCTAGGACTTGGAGG + Intronic
1083436412 11:62646494-62646516 AGGAGTGGAATGGGACTTGGGGG + Intronic
1083627320 11:64078337-64078359 CAGACGGGCCAGGGACTGGGAGG - Intronic
1084302087 11:68258588-68258610 CAGAGTGGGCAGGCAGTTGGTGG + Intergenic
1084692208 11:70734051-70734073 AAGAGTCACCAGGGGCTGGGAGG + Intronic
1085083415 11:73651539-73651561 AACTGTGGCCTGGGCCTTGGTGG - Intronic
1085151082 11:74253376-74253398 CAGATTTGCCAGGGCCTTGGTGG + Intronic
1088516395 11:110639610-110639632 AGTAGTTGCCAGGGACTAGGGGG - Intronic
1089563871 11:119360206-119360228 AAGAGTGCCCAGGGTCTGGCTGG - Exonic
1090010684 11:123043092-123043114 AGTAATTGCCAGGGACTTGGGGG + Intergenic
1091587474 12:1824483-1824505 AAGGGAGGCCAGGGACTCCGTGG + Intronic
1091603385 12:1931012-1931034 AACAGCGGCCAGGACCTTGGGGG - Intergenic
1095621972 12:44267676-44267698 AATGGTTGCTAGGGACTTGGAGG - Intronic
1096257517 12:50072423-50072445 CAGAGGGGCCAGGGGCCTGGGGG + Intronic
1097261664 12:57723966-57723988 AAGAGAGTCCAGGGTCTTGGAGG + Intronic
1097322658 12:58243613-58243635 AACAGAAGCCAGGGACTTGTAGG + Intergenic
1097585242 12:61507295-61507317 CATAGTGGCTAGCGACTTGGAGG - Intergenic
1097712683 12:62933683-62933705 AAAAGTGGCCATGGAGCTGGGGG + Intronic
1097731997 12:63138989-63139011 AGGAGTTGCCAGGGATTTAGGGG - Intergenic
1100039632 12:90299238-90299260 AAGAGTGGCAAGGGACCATGTGG - Intergenic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1102503582 12:113369754-113369776 TAGTGGTGCCAGGGACTTGGGGG + Intronic
1102821976 12:115916193-115916215 AGCAGTTGCCAGGGACTGGGAGG + Intergenic
1103549921 12:121729333-121729355 AAGAGTAGCCAGGGACTCCAAGG + Intronic
1104660905 12:130610947-130610969 CAGAGTGGCCAGGGACTCGCTGG - Intronic
1104781094 12:131421025-131421047 AAGGGTGACCAGGGACCTGGTGG + Intergenic
1108568895 13:51729994-51730016 AACAGTTTCCAGGGACTGGGGGG - Intronic
1109942534 13:69389874-69389896 AAAAGTGGGCAGGAACTTGGGGG + Intergenic
1111132394 13:83994343-83994365 AAGACAAGCCAGGGCCTTGGAGG + Intergenic
1111996267 13:95168792-95168814 TAGCGTGGCCGGGGACATGGAGG - Intronic
1113421433 13:110174383-110174405 AACAGTGGCCAGGGGATGGGAGG - Intronic
1113636266 13:111920960-111920982 AACAGTAGGCAGGGCCTTGGAGG - Intergenic
1114168481 14:20246668-20246690 AGTAGTGGCCAAGGACTAGGAGG + Intergenic
1116022101 14:39473601-39473623 AATGGTTGCCAGGGACTAGGGGG + Intergenic
1116385848 14:44328855-44328877 AAGGGTTGCAGGGGACTTGGAGG - Intergenic
1116663501 14:47744183-47744205 AAGAGTGTCAATGGATTTGGAGG + Intergenic
1119782037 14:77282364-77282386 AGTAGTGGCCCGGGACCTGGAGG - Intronic
1120999276 14:90439838-90439860 CTTAGAGGCCAGGGACTTGGAGG + Intergenic
1121032797 14:90673910-90673932 AATAGTTGACAGGAACTTGGTGG + Intronic
1122169185 14:99857589-99857611 AGCAGTTGCCAGGGACTGGGAGG - Intronic
1122238649 14:100347343-100347365 AGCAGTGGCCAGAGACTAGGAGG - Intronic
1122368256 14:101211478-101211500 AAGAAAGGCCCAGGACTTGGTGG - Intergenic
1124647641 15:31450283-31450305 ATGGATGGTCAGGGACTTGGAGG - Intergenic
1125523631 15:40361952-40361974 CAGAGTGCCCAGGGCCATGGGGG - Intronic
1127849958 15:62903570-62903592 AAGAGTGGGCAGGAGCTAGGAGG - Intergenic
1128147060 15:65337635-65337657 AAGTAAGCCCAGGGACTTGGGGG + Intronic
1129742050 15:77994027-77994049 CAGGGTGGCCTGGAACTTGGAGG - Intronic
1130138086 15:81198208-81198230 AAGAGTGGCCAGGAAATGGTTGG - Intronic
1130258358 15:82336340-82336362 CAGAGTGGCCTGGAACTTGGAGG - Intergenic
1130596570 15:85253620-85253642 CAGGGTGGCCTGGAACTTGGAGG + Intergenic
1130822222 15:87507772-87507794 AAGAGTGGCCAGGCATGAGGTGG - Intergenic
1134252680 16:12585549-12585571 ACGCATGGCCATGGACTTGGTGG - Intergenic
1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG + Intergenic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1135846069 16:25919669-25919691 AAGAGTGGCCAGATGCTTTGAGG + Intronic
1135883253 16:26279704-26279726 AAAGGTGGCCAGGGAAGTGGGGG + Intergenic
1137708140 16:50549037-50549059 AAGAGGGGGCAGGGTCTTGCGGG - Intronic
1138681635 16:58687771-58687793 CAGAGTTGCCAGGGGCTTGGTGG - Intergenic
1139430064 16:66906326-66906348 AAGAGTGGTCCGGGGCCTGGAGG + Intergenic
1139556928 16:67718471-67718493 AAGAGTGGACAGGGACATGAGGG - Intronic
1140235011 16:73151280-73151302 AAAAGTGGTGAGGGACATGGAGG + Intergenic
1140406229 16:74713440-74713462 AAGAATGGCCAGGGACGGGGTGG + Exonic
1141481047 16:84307129-84307151 AAGAGAGGTCAGAGACGTGGAGG + Intronic
1142189563 16:88711714-88711736 CCAAGTGGCCAGGGACTAGGAGG - Intronic
1143367494 17:6417712-6417734 GAGAGTGGCCTGTGACGTGGAGG + Intronic
1144193257 17:12866037-12866059 AAGAGTGGGGTGGGAGTTGGGGG + Intronic
1149243723 17:54680942-54680964 GAGAGTGGCCAGGGAATTACTGG - Intergenic
1149985030 17:61340760-61340782 AAGAGAGGACATGGAGTTGGGGG + Intronic
1151996600 17:77613273-77613295 AAGACTTGCCAAGGATTTGGGGG + Intergenic
1152320519 17:79606450-79606472 AAGTGTGGCCAGGGTCTAGGTGG - Intergenic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1154345734 18:13542359-13542381 ATGAGGGGCCAGGGTCCTGGAGG - Intronic
1155455568 18:26008483-26008505 AAAAGGGGGCATGGACTTGGAGG + Intergenic
1155512784 18:26594216-26594238 AAGAGCTGCCAGTGACTGGGAGG + Intronic
1155529864 18:26756197-26756219 AAGAGGAGCCAGGAAGTTGGGGG - Intergenic
1155882144 18:31162784-31162806 GAGACTGGCCAGGGAATAGGGGG - Exonic
1157597839 18:48874756-48874778 AAGAATGGAAAGGGACCTGGAGG - Intergenic
1158249002 18:55466001-55466023 AAAAGTAGGCAGAGACTTGGAGG + Intronic
1158544664 18:58385987-58386009 AGGGGTGGCCAGGCACTTTGGGG - Intronic
1160069595 18:75614976-75614998 ATGAATGGCCTGGGACTTAGAGG - Intergenic
1160579156 18:79873795-79873817 AGGAGGCGCCTGGGACTTGGCGG + Intronic
1161350201 19:3786894-3786916 AAGGGGGGCCTGGGAGTTGGAGG + Intronic
1161818673 19:6516078-6516100 AGGAGTGGGCAGGGTCTGGGAGG + Intergenic
1162295267 19:9809144-9809166 AGGAGTGGGCAGGGCCTTGCAGG - Intergenic
1163210320 19:15835558-15835580 AAGTGTGACCAGGGACTGCGTGG - Intergenic
1163704456 19:18804221-18804243 AAGAGTGGCCTGTGACTTCCAGG + Intergenic
1164570595 19:29371895-29371917 GGGAGTTGCCAGGGACCTGGGGG + Intergenic
1164676655 19:30105612-30105634 AGGTGTGGCCAGGCACATGGCGG - Intergenic
1164714276 19:30380042-30380064 AAGAGTGGCCATGTCCTCGGCGG - Intronic
1166337490 19:42117147-42117169 GAGAGTGGCCATGGCCTTGGTGG + Intronic
1166668744 19:44697472-44697494 AGGAGGGGCCAGGGAGGTGGAGG + Intergenic
1167755060 19:51407512-51407534 AATAGTGACTTGGGACTTGGAGG - Intergenic
924961986 2:44038-44060 GAGAGTGGCCAGGTCCGTGGAGG - Intronic
925998271 2:9309462-9309484 AGGGGTTGCCAGAGACTTGGGGG + Intronic
926204808 2:10828531-10828553 AAGAGTGCCCTGGGCCCTGGTGG - Intronic
927806873 2:26155809-26155831 AATGGTGGCCAGGGGCTGGGGGG + Intergenic
927842591 2:26455056-26455078 AGTAGGGGCCAGGGTCTTGGTGG - Intronic
929267760 2:39938209-39938231 AAGAATCACCAGGGACCTGGTGG + Intergenic
930106201 2:47641961-47641983 AGGAGTGGCCAGAGACATAGGGG - Intergenic
930570888 2:53085535-53085557 AGTAGTTGCCAGGGACTGGGAGG + Intergenic
931634934 2:64332556-64332578 AAGAGTGGGGAAGGAGTTGGTGG + Intergenic
931752948 2:65346934-65346956 CTGAGAGGCCAGGGAATTGGAGG - Intronic
932248286 2:70216948-70216970 ATGGGTGGCCAGTGGCTTGGTGG - Exonic
932950853 2:76291309-76291331 GAGAGAGCCCAGGGAGTTGGAGG + Intergenic
935077670 2:99761474-99761496 AAGAGTGGTCAGCTACATGGAGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
939047464 2:137266752-137266774 ACGTGTGGCCAGGAAATTGGGGG - Intronic
941413101 2:165185348-165185370 AAGATGGGCAAGGGACTTGAAGG - Intronic
941849597 2:170165907-170165929 AAGGGTGGCCTGGGACATCGTGG + Intergenic
942206707 2:173626335-173626357 AATAGTGGACAGGGCCTGGGAGG - Intergenic
942324053 2:174760530-174760552 AGGAGTTACCAGGGACTGGGGGG + Intronic
944028869 2:195207846-195207868 AAGAGTTGCCAGGGGTTTGAAGG - Intergenic
946057634 2:216915917-216915939 AAGAGAGGCCCGGGAGTTGTCGG + Intergenic
948082711 2:235219801-235219823 CAGAGTGACCTGGGGCTTGGAGG + Intergenic
948295796 2:236859513-236859535 AAAAGTGGGCAGGGCCTTGTAGG - Intergenic
948785666 2:240351423-240351445 AAGAGCGGCCAGCGTCTGGGGGG - Intergenic
1168792740 20:590841-590863 ACAAGAGGGCAGGGACTTGGTGG - Intergenic
1168961021 20:1869963-1869985 AAGATAGGGCAGGGCCTTGGGGG + Intergenic
1169968466 20:11243256-11243278 AGGAGTGGGCAGAGACCTGGCGG - Intergenic
1170098676 20:12674919-12674941 AAGAGTGGACAGAGGCTTGGTGG - Intergenic
1171392993 20:24813020-24813042 TAGAGTGGCAAGGGACTAGGGGG + Intergenic
1171499189 20:25579952-25579974 AAGAGTGGTCAGAGACCTGAGGG - Intronic
1171501617 20:25598076-25598098 AATGGTTGCCAGGGACTTGGGGG - Intergenic
1173883069 20:46433462-46433484 GACAGTGGCCTGGGACTTTGTGG + Intergenic
1174477339 20:50805333-50805355 CAGATTGGCCAGAGACTTGAAGG + Intronic
1174510801 20:51050818-51050840 AAGATTTGCCTGGGAATTGGGGG + Intergenic
1175207289 20:57321033-57321055 CAGAGTGTTCAGGGAGTTGGTGG + Intergenic
1175443087 20:59004341-59004363 AGGAGTGGCCAGGGAGGTGGAGG + Intronic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1178397943 21:32259215-32259237 GAGAGTGGCCAGGGGCTCGAGGG + Intergenic
1178914784 21:36700088-36700110 GCGAGGGGCCAGGGCCTTGGCGG + Intronic
1179304516 21:40142111-40142133 AAGAGTGCCCAGGCACATGGAGG - Intronic
1179472465 21:41620727-41620749 AAGAGTGGCCAGGCACTTCCGGG - Intergenic
1179488280 21:41724663-41724685 ACCACTGGCCAGGGACTTAGGGG - Intergenic
1183149409 22:36026350-36026372 AAGAGTGGTTAGGTCCTTGGGGG - Intronic
1183649380 22:39145455-39145477 AAGGGTGTCCTGGGACTTGCGGG - Intronic
1183666441 22:39248955-39248977 AAGAGTGGCCACAGCCGTGGGGG + Intergenic
1184365188 22:44046642-44046664 AAGTGTGTCCAGGGACTGTGTGG - Intronic
1184676569 22:46046172-46046194 CAGAGAGTCCAGGGACATGGTGG - Intergenic
1184871139 22:47239196-47239218 GAGAGTGGCCAGAGTCTTGCTGG + Intergenic
1185338198 22:50280134-50280156 AAGGGTGGCCGGGTGCTTGGAGG - Intronic
952173047 3:30830519-30830541 CAGAATGGCCAGGGAGATGGTGG - Intronic
953396149 3:42572072-42572094 AAGACTGGCTAGGGACCTTGGGG + Intronic
954108174 3:48420174-48420196 AGGGGTGGCCAGGGCTTTGGGGG + Exonic
954347237 3:50010377-50010399 AAGGGTGGCCGGGGAGTCGGGGG + Intronic
955105285 3:55891916-55891938 AAGAAGGGACAGAGACTTGGGGG - Intronic
955719774 3:61868431-61868453 CAGAGAGGCCAGGGAGCTGGGGG - Intronic
955884504 3:63583486-63583508 AAGCGTGACCAGGGACTGTGTGG + Intronic
956078255 3:65529378-65529400 AGTAGTTGCCAGGAACTTGGGGG - Intronic
956833140 3:73073168-73073190 AAGACTGGCCTGGGGCATGGGGG - Intergenic
960149829 3:114238593-114238615 CAGAGTGGGCATGGGCTTGGCGG - Intergenic
962430651 3:135316118-135316140 AAGAGTGGCAAGGGATAAGGAGG - Intergenic
964651439 3:159015821-159015843 AAGAGGAGCCAGGAGCTTGGTGG + Intronic
967080137 3:186042326-186042348 AAGAGTGGCCAGTGAAATAGGGG - Intergenic
967325403 3:188233807-188233829 AAGAGTAACCAGAGACTTTGTGG - Intronic
968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG + Intronic
969690698 4:8702536-8702558 AGAGGTGGCCAGGGACTGGGAGG + Intergenic
971851938 4:31995279-31995301 AAGAGTGACTAGTGATTTGGGGG - Intergenic
972826766 4:42767985-42768007 TACAGTGGCCAGGGAAGTGGGGG - Intergenic
973047171 4:45549174-45549196 CAGAGTGGCCAGAGGCTTTGGGG + Intergenic
974919860 4:68225517-68225539 AAGGGTGGACAGGAATTTGGAGG - Intergenic
976008022 4:80454167-80454189 TAGAGTGGCCAGAGTCTGGGAGG + Intronic
977564944 4:98571265-98571287 ATGAGTGGCCACGGACTTCAGGG - Intronic
977709404 4:100107293-100107315 AAATGTGGCAAGGGACTTGAGGG + Intergenic
979235812 4:118398917-118398939 AAGAGTGGCTTGGGACTTGCGGG + Intergenic
983459547 4:168011111-168011133 AAGATTTGCCAGGGACTCTGGGG + Intergenic
984431110 4:179650262-179650284 AGCAGTGGCCAGGGAAGTGGAGG - Intergenic
986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG + Intergenic
986616205 5:9619826-9619848 AGCAGAGGCCAGAGACTTGGGGG - Intergenic
986895667 5:12363887-12363909 AAGATTGGCCATGTACATGGTGG - Intergenic
987527198 5:19067894-19067916 AAGGGTGGACAGGGAGTTAGTGG + Intergenic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
989386035 5:40855448-40855470 AGGAGGGACCAGGGACCTGGTGG + Intronic
991228985 5:64308511-64308533 AAGTGTAGCCAGGGGCTTGGAGG + Intronic
992372110 5:76153798-76153820 AAGAATGGACAGAGGCTTGGAGG + Intronic
992519167 5:77531928-77531950 AGTAGTTGCCAGGGACTAGGGGG + Intronic
994066805 5:95552869-95552891 AATGGTGGCGAGGGAGTTGGGGG + Intronic
994645177 5:102459732-102459754 CAGAATGGCTATGGACTTGGTGG - Exonic
996493766 5:124129662-124129684 GAGAAGGGCCAGGGACTTAGGGG - Intergenic
996612110 5:125394622-125394644 AAGAGAGGACAGGGAATTGAGGG + Intergenic
997239642 5:132296872-132296894 ATGAGTAGCTATGGACTTGGAGG - Intronic
997434930 5:133867159-133867181 AAGAGGGGCCAGTGCCTTTGAGG - Intergenic
997508296 5:134435485-134435507 CAAAGGGGCCTGGGACTTGGGGG + Intergenic
998383958 5:141745458-141745480 GAGACTGGCCTGGGGCTTGGGGG - Intergenic
998485454 5:142498052-142498074 ATGAGTGGTCAGGGACATGATGG + Intergenic
999022118 5:148178054-148178076 AATAGTTTCCAGGGACTGGGGGG - Intergenic
1003455682 6:6279513-6279535 AGGGGTGGAGAGGGACTTGGTGG + Intronic
1003537221 6:6985801-6985823 AAAGGTGGCCAGGGACACGGTGG + Intergenic
1003583428 6:7363465-7363487 AAGAGAGGCTAGAGACTTAGAGG - Intronic
1003887159 6:10532164-10532186 GAGAGTGGGAAGGGACTCGGAGG - Intronic
1004698350 6:18055191-18055213 GATGGTTGCCAGGGACTTGGGGG + Intergenic
1005640001 6:27786886-27786908 AAGTCTGGCCAGGGGCTGGGGGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006830126 6:36963523-36963545 GAAATTGGGCAGGGACTTGGAGG - Exonic
1007352241 6:41282372-41282394 GTGAGTGGCCTGGGACTTGGGGG - Intronic
1007764904 6:44154590-44154612 CAGAGTGGGCAGGGCCCTGGGGG - Intronic
1007772192 6:44201016-44201038 AAAATGGGCCAGGGAGTTGGAGG - Intergenic
1007777208 6:44230421-44230443 ATGAGTGGCCAGGGCCTAGCAGG + Exonic
1011147979 6:84239792-84239814 GGTGGTGGCCAGGGACTTGGGGG + Intergenic
1012182177 6:96167882-96167904 ACGAGTGGCCAGGGAACTGGGGG + Intronic
1012260136 6:97079239-97079261 CAGAGTGGCCATGGCCTTTGCGG - Intronic
1015427959 6:133094266-133094288 AAGACTAGCCAAGGACTTTGAGG + Intergenic
1015836833 6:137429569-137429591 GAGACAGGCCAGGGACTGGGAGG - Intergenic
1017018123 6:150117497-150117519 AAGAGTGGCAGAGGCCTTGGGGG - Intergenic
1019051686 6:169188438-169188460 CAGAGTGGCCATGGGGTTGGAGG + Intergenic
1019859774 7:3646929-3646951 ATTGGTTGCCAGGGACTTGGGGG + Intronic
1019999755 7:4748978-4749000 AAGCGTGGACAGGAACCTGGGGG - Intronic
1022792712 7:33704764-33704786 CGGAGAGGCCAGGGGCTTGGGGG + Intergenic
1024171224 7:46789718-46789740 AATGGTTGCCAGTGACTTGGAGG + Intergenic
1024551072 7:50562633-50562655 AGGACTGGCCAGGAGCTTGGGGG + Intronic
1024835836 7:53517302-53517324 AAGAGAAGCCTGGAACTTGGAGG + Intergenic
1026063565 7:67048356-67048378 AAGGGTGGGCTGGGGCTTGGTGG + Intronic
1026567395 7:71500853-71500875 AAGAGAGGACAGGGGTTTGGAGG - Intronic
1026714785 7:72779118-72779140 AAGGGTGGGCTGGGGCTTGGTGG - Intronic
1027365543 7:77453939-77453961 AGGGGTGGCAAGGGAATTGGAGG + Intergenic
1028692332 7:93667458-93667480 AAGACTGGCCAGAGACTTGCAGG - Intronic
1029226775 7:99034196-99034218 CAGAGTGGCCAGGGCCCTGCAGG - Intronic
1030855723 7:114554938-114554960 AAGACTAGCCAGGGACTAAGAGG - Intronic
1030877706 7:114835828-114835850 TAGAATTGCCAGGGACTGGGAGG - Intergenic
1031443943 7:121827858-121827880 AAAAGAGGGTAGGGACTTGGAGG + Intergenic
1031541512 7:123000605-123000627 CAGAAAGTCCAGGGACTTGGTGG + Intergenic
1033289538 7:140071628-140071650 AAGGGTGGCCAGGGAACTGCCGG - Intergenic
1033415927 7:141161260-141161282 GAGAGTGGCCAGGGCTATGGTGG + Intronic
1033949825 7:146771118-146771140 AACAGTGGGCAGGGAGTTTGGGG - Intronic
1035883270 8:3266202-3266224 AATAGTGGCCAGGGAGTCAGGGG + Intronic
1036977707 8:13433201-13433223 AGGAGAGGACAGGGACTTGAAGG + Intronic
1037885064 8:22591605-22591627 AGGGGTGGCCAGGGCCCTGGAGG - Exonic
1039401620 8:37274783-37274805 AGGAGTCCCCAGGGGCTTGGCGG - Intergenic
1040389778 8:46939967-46939989 GATAGTTTCCAGGGACTTGGAGG + Intergenic
1040540302 8:48347757-48347779 GGGAGTTGCCATGGACTTGGGGG - Intergenic
1040558656 8:48504189-48504211 ACGAGTGGCCAGGGACAAAGCGG - Intergenic
1040818155 8:51530388-51530410 ACTAGAGGCCAGGGACCTGGAGG - Intronic
1041961569 8:63623220-63623242 AAGAGGGAGAAGGGACTTGGTGG + Intergenic
1043419964 8:80088120-80088142 TGGAGAGGACAGGGACTTGGAGG - Intronic
1043881672 8:85550346-85550368 GATAGTGGCCAGGGGCTGGGAGG + Intergenic
1045101396 8:98848213-98848235 AGTAGTTGCCAGGGACTGGGAGG - Intronic
1045189826 8:99871676-99871698 AAGAGTGGCCTGTGATGTGGAGG + Exonic
1046146508 8:110167955-110167977 AAGAATGGCCAGAGAATTCGAGG - Intergenic
1046521417 8:115330871-115330893 AAGGGTGGGCATGGGCTTGGCGG - Intergenic
1048309339 8:133306573-133306595 AAGGCTGGGCAGGGACTTGCTGG - Intergenic
1048329393 8:133461794-133461816 AAGAGAGGCCAGGGAGGGGGAGG - Intronic
1049560910 8:143309832-143309854 GACAGTGGCCTGGGACTCGGAGG - Intronic
1051236215 9:15001948-15001970 AAAATTAGCCAGGGGCTTGGTGG + Intergenic
1051257028 9:15224344-15224366 AGGACAGGCAAGGGACTTGGGGG - Intronic
1056383548 9:86077230-86077252 AAGCCCAGCCAGGGACTTGGAGG + Intronic
1056589476 9:87954303-87954325 AAGAGTGGCCATGGCCTGGGAGG - Intergenic
1057764674 9:97906334-97906356 ATGAGTAGGCAGGGAATTGGGGG - Intronic
1060212307 9:121718043-121718065 CAGAATGGCCAGGCTCTTGGTGG + Intronic
1060413227 9:123413586-123413608 AAGCGGGTCCAGGGACTTGGTGG + Intronic
1061164243 9:128913212-128913234 AAGGGTGGACAGGGTCATGGAGG + Intronic
1061571837 9:131482582-131482604 CACAGTGGCCAGGGCCTGGGTGG + Intronic
1062186512 9:135221332-135221354 GAGAATGGCCAGGGCCGTGGTGG + Intergenic
1203770275 EBV:46485-46507 AATAGTGGCCAGGGCCTCGGTGG + Intergenic
1186602385 X:11051676-11051698 AAGAGTGGACAGGGTCATGGAGG - Intergenic
1190957469 X:55209642-55209664 AGTAGTTGCCAGGGATTTGGAGG - Intronic
1192139710 X:68637337-68637359 AAGAGGGGCAAGAGGCTTGGTGG + Intergenic
1193531304 X:82657835-82657857 AAAAGTGGCCATGGCCATGGTGG - Intergenic
1195672533 X:107482012-107482034 AGGACTGGACTGGGACTTGGGGG - Intergenic
1196046874 X:111265768-111265790 CAGAATGTCCAGGGACTAGGAGG - Intronic
1196457817 X:115902549-115902571 AAGAGTGGAAAGGGACCTAGAGG - Intergenic
1197543773 X:127798481-127798503 ATGAGTGGACAGGGAATTGGGGG + Intergenic
1198637037 X:138711822-138711844 ACGGGCGGCCGGGGACTTGGGGG - Intronic
1199839493 X:151630218-151630240 AGTAGTGGCCATGGAGTTGGAGG - Intronic