ID: 968883630

View in Genome Browser
Species Human (GRCh38)
Location 4:3315278-3315300
Sequence TGGGAATCCTAGGGAATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968883622_968883630 27 Left 968883622 4:3315228-3315250 CCTTTCGCTGTAATGAATCTCAG 0: 1
1: 0
2: 2
3: 28
4: 156
Right 968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG 0: 1
1: 0
2: 0
3: 10
4: 144
968883625_968883630 -7 Left 968883625 4:3315262-3315284 CCTTTGTGCCAAGTCCTGGGAAT 0: 1
1: 1
2: 1
3: 26
4: 207
Right 968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG 0: 1
1: 0
2: 0
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968883630 Original CRISPR TGGGAATCCTAGGGAATCAC TGG Intronic
900197092 1:1381949-1381971 TGGGGCTCCTGGGGAACCACTGG + Intergenic
900346511 1:2212985-2213007 TGGGAAGCCCAGCGACTCACAGG - Intergenic
900711536 1:4117840-4117862 TAGGAATCCCAGGCAATCTCCGG - Intergenic
901703720 1:11059049-11059071 TCGGAATCCTAGGGCAGCCCTGG - Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
908537298 1:65090163-65090185 AGGGGATCCCAGGGAATCATGGG + Intergenic
908710251 1:67006575-67006597 TAGGAATACTGGGGAAGCACAGG + Intronic
913003905 1:114609245-114609267 TGGGAATGCCATGAAATCACAGG + Intronic
916755963 1:167770676-167770698 TCTGAAGCCTTGGGAATCACTGG + Intronic
916975818 1:170076455-170076477 TGGGAATCAAATGGAATTACTGG + Intronic
917066533 1:171100744-171100766 TGTGAATCCTTGGGAACCAGAGG + Intronic
920065874 1:203269330-203269352 TGGGTTTCCTTGGGTATCACTGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1067723708 10:48750302-48750324 TGGGAATCATGGGAAAGCACTGG - Intronic
1067848345 10:49739966-49739988 TTTGAATCCCAGGGAATCCCTGG - Intronic
1070403435 10:76073879-76073901 TTGTAGTCCTAGGGAATTACGGG + Intronic
1071712405 10:88062446-88062468 TGGGCATCCGAGGGAATTTCAGG + Intergenic
1074037923 10:109759600-109759622 TGGGACTCATTGGGTATCACTGG - Intergenic
1075921148 10:126214760-126214782 TTGGAGTCCTAGTTAATCACAGG + Intronic
1078462949 11:11529118-11529140 TGGGTATCCTGGTGAAACACAGG - Intronic
1080430846 11:32198287-32198309 AGGGGTTCCTTGGGAATCACTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083728278 11:64639822-64639844 TGGGGATGCTAGGGAGACACTGG + Intronic
1084337457 11:68468144-68468166 TCACAATCCTATGGAATCACCGG - Intronic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1092127030 12:6081664-6081686 TGGGAGTCCTAGGCGATCCCTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095202096 12:39396110-39396132 TGGCTATCTTAGGTAATCACTGG - Intronic
1096239844 12:49953947-49953969 TGGGCATCCTGGGGGATCAGGGG + Intronic
1096324875 12:50650923-50650945 TGGGAATCCTTGTGCACCACTGG - Intronic
1101469877 12:104986402-104986424 TGGGACTCCTGAGGAATCCCGGG - Exonic
1104987015 12:132603016-132603038 TGGGAAGCCTGGGGAGGCACAGG - Intergenic
1105318994 13:19298946-19298968 AGGGAATCCTAGGTAATTGCTGG + Intergenic
1108467122 13:50727622-50727644 CGTGATTCCTTGGGAATCACAGG - Intronic
1112855497 13:103764791-103764813 TTTGATTCCTATGGAATCACAGG + Intergenic
1113177844 13:107586409-107586431 TTGGAGTCCCAGTGAATCACAGG - Intronic
1113917288 13:113882035-113882057 TGGGCATCCTGGGGAAGCTCAGG + Intergenic
1117598571 14:57349481-57349503 TGTGACTCATTGGGAATCACTGG + Intergenic
1122499637 14:102188258-102188280 TGGGAAGCCTGTGGCATCACAGG - Intronic
1123799386 15:23804513-23804535 CAGGAACCCTAGGGATTCACTGG - Intergenic
1123907928 15:24938713-24938735 GGGGACTCCAAGGGAAACACAGG + Intronic
1124572495 15:30877767-30877789 TGGGAACCCTCTGGAATCTCTGG + Intergenic
1125724723 15:41862445-41862467 AAGGAATCCTAGGGGAACACAGG + Intronic
1126745774 15:51824982-51825004 TAGGAATCCTATGGAAGCAGTGG - Intergenic
1126788084 15:52195533-52195555 TGGGAACCATTGGGAAGCACAGG + Intronic
1127287318 15:57543168-57543190 TGGCAATCTTTGGTAATCACTGG + Intronic
1128603641 15:69018205-69018227 TGGGATTCCTAGGGATTGGCAGG + Intronic
1130294714 15:82637496-82637518 TGGGGATGCTAGGGAAAGACAGG - Intronic
1130678758 15:85978015-85978037 TGGGAATGCTGGGGAATAAGTGG + Intergenic
1136925217 16:34365997-34366019 TGGGCCTCCTAGGGAATCTCAGG - Intergenic
1136979357 16:35045809-35045831 TGGGCCTCCTAGGGAATCTCAGG + Intergenic
1141467768 16:84218099-84218121 TGAGAATCCGATGGAATCACTGG + Intergenic
1153592815 18:6692058-6692080 TGGGAATACTAGGGAGTCCATGG + Intergenic
1155404430 18:25472479-25472501 TGGAAACCCTAGGCAATCACTGG - Intergenic
1155740892 18:29286304-29286326 TGGGAATGACAGGGAATGACTGG - Intergenic
1157730754 18:50002088-50002110 TGGGAATGTTAGGGAAACAAAGG - Intronic
1158657279 18:59349835-59349857 TTAGAATCCTAGGCAAGCACAGG + Intronic
1159878873 18:73839285-73839307 TGGGAGTCCTAGGGTCTCCCTGG - Intergenic
1160848507 19:1177931-1177953 GGGGATTTCCAGGGAATCACAGG + Intronic
1162559157 19:11406095-11406117 AGGGAATCCTAGGGAATAAGTGG - Intronic
1165659094 19:37559077-37559099 TGGGAGGCCAAGGCAATCACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168232847 19:55044399-55044421 TGGGAGTCCCAGGCAATCCCAGG + Exonic
925041683 2:735931-735953 GGGGAATCCAGGGGAGTCACTGG - Intergenic
925134201 2:1515125-1515147 TGGGAATTCCAGGTAAGCACAGG - Intronic
931830090 2:66041590-66041612 AGTGAAGCCTAGGCAATCACTGG - Intergenic
935112575 2:100105806-100105828 TAGGAATTCTGGGGAATCCCTGG - Intronic
937733028 2:125257981-125258003 TGGGAATCTTATGGAATGCCAGG + Intergenic
938275048 2:130012148-130012170 TGGAAATCCTGGGGATTGACAGG + Intergenic
938326006 2:130402873-130402895 TGGAAATCCTGGGGATTGACAGG + Intergenic
938363936 2:130718593-130718615 TGGAAATCCTGGGGATTGACAGG - Intergenic
940755520 2:157677440-157677462 TGGAACTCCTAGGTACTCACAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943808492 2:192154101-192154123 TAGGAACCCAAGGGAACCACTGG - Intronic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945137173 2:206641652-206641674 TGAGAATCAAAGGGAATCCCAGG + Intergenic
945583333 2:211624914-211624936 TGGGAAACCTACATAATCACAGG + Intronic
946897377 2:224338364-224338386 TGGGAATCTCAGGGAAGCAGTGG - Intergenic
947003679 2:225486861-225486883 AGGGAATTCTAGGGAATAGCTGG - Intronic
1170307200 20:14951591-14951613 TAGGACTCCGAGGGCATCACTGG + Intronic
1172927385 20:38550964-38550986 ATGTAATCCTAGGGAAACACAGG + Intronic
1173649420 20:44653473-44653495 TGGGATTCCTAGGAAGTCAGTGG + Intergenic
1174804249 20:53593133-53593155 TGGGCACCCGAGGGAGTCACGGG + Intronic
1175580608 20:60095904-60095926 TGGGAATGCAAGGGACTCACTGG - Intergenic
1176036986 20:63044301-63044323 TGGGAATGCCAGGGGAACACGGG + Intergenic
1176920172 21:14678686-14678708 TGGGAATTCAAGGGAAGCATTGG - Intergenic
1177645375 21:23894027-23894049 TGGTAATCATATGGAATCCCAGG - Intergenic
1179528608 21:42001955-42001977 GAGGAATCCAAGGGAACCACAGG + Intronic
1180560174 22:16609558-16609580 TGGGCACCCGAGGGAGTCACCGG + Intergenic
1185202548 22:49517067-49517089 TGGGAAGCCCAGGAAACCACAGG + Intronic
959856469 3:111164646-111164668 TGGGAATCCTTGGCATTCCCTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962017494 3:131457013-131457035 AGGGAATCCTAGGTAATTGCTGG + Intergenic
963971157 3:151430652-151430674 GGGGACTCCTATGGAATCAAAGG + Intronic
964856991 3:161157330-161157352 TTGCAATCCTAGTGAATTACTGG + Intronic
968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG + Intronic
969189453 4:5505298-5505320 TGGAAATCCTAGGGAACCCTGGG + Intergenic
971360795 4:25936663-25936685 TGGGTATCCTAGATAGTCACAGG + Intergenic
974653749 4:64790390-64790412 TGGGAATACTAGGGAAGCATTGG + Intergenic
975468231 4:74733881-74733903 TGGAAAAGCTAGGGAATCAAAGG + Intergenic
977432255 4:96944862-96944884 TGGGAATTCTTGGGAATGCCAGG + Intergenic
979212149 4:118117861-118117883 TGGTAATCCAAGGGAATATCTGG + Intronic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
984254769 4:177378345-177378367 TGAGAATCCATGGGATTCACTGG + Intergenic
985067194 4:186134088-186134110 TGGGAATCCTCGTGCATCACCGG - Intronic
985634507 5:1029238-1029260 TGAGAATTCTAGGGAATAAGGGG + Intronic
985762646 5:1758543-1758565 TGGAAATCCTAGAGAAACACTGG - Intergenic
986865692 5:11983915-11983937 ATTAAATCCTAGGGAATCACAGG + Intergenic
992114517 5:73526707-73526729 TGGGAAGCCTTGAGAATCAGAGG + Intergenic
996392619 5:122978484-122978506 TGTGAATTCTAGGGTAGCACAGG - Intronic
1001775509 5:174326446-174326468 TGGGAAGCCAAGAGAGTCACCGG + Intergenic
1002322023 5:178381979-178382001 TGGGAATCCTAGGCATTCTGAGG + Intronic
1005805307 6:29468670-29468692 TGGCAGCCCTTGGGAATCACAGG - Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1011098889 6:83699120-83699142 TGGGAATCCTAGGGAGCCTGGGG - Intronic
1013488505 6:110621105-110621127 TGATAATCCGAGGGCATCACAGG + Exonic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016091442 6:139984266-139984288 AGGGAACCCTAGAGAAGCACAGG - Intergenic
1016639408 6:146331938-146331960 TGGGAATCCGAAAGAATCACAGG + Intronic
1018543590 6:164911777-164911799 TGAGAATCCTAGAAAATCAAAGG + Intergenic
1021137119 7:16979025-16979047 TGGGAAGCCTAGTGACTCAGGGG - Intergenic
1021179221 7:17486911-17486933 TGGGAATTTTAGGGAATCTAAGG + Intergenic
1022473938 7:30698328-30698350 TGAGAATCCTAGGGCACCTCTGG + Intronic
1023981313 7:45072231-45072253 TGGGAATCCTGTGGCTTCACTGG + Intronic
1029634594 7:101775522-101775544 TGGGGGTCTTAGGGAATCAGGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1035707367 8:1687124-1687146 AGGGAATCTCAGGGGATCACAGG + Intronic
1035735290 8:1882973-1882995 TGAGAATCATTGAGAATCACTGG + Intronic
1037495483 8:19436715-19436737 TGGGAAACATAGGGAGACACTGG + Intronic
1037523049 8:19698697-19698719 TTGGAATTCTTGTGAATCACCGG + Intronic
1038876902 8:31560203-31560225 TAGGAATGCTAGTGACTCACAGG - Intergenic
1041264251 8:56048185-56048207 ATGGAATCCTGGGTAATCACTGG + Intergenic
1048618067 8:136101026-136101048 TAGGAATGCTCAGGAATCACAGG - Intergenic
1048977195 8:139679755-139679777 AGGGAAACCTGGGGAAACACAGG + Intronic
1053147548 9:35722003-35722025 TGGGAATCTTAGGGAATGGTGGG + Intronic
1053160292 9:35809301-35809323 TGGGAATCATAGGGAAAGAGAGG + Intronic
1055553938 9:77456984-77457006 AGTGAATCCTAGTGAGTCACAGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058577080 9:106415318-106415340 TGGGAAGCCCAGAGAATGACAGG + Intergenic
1060315116 9:122502571-122502593 CTGGAATTCTAGGGATTCACTGG - Intergenic
1062321226 9:135991309-135991331 TGGGCAGCCCATGGAATCACGGG - Intergenic
1185532335 X:832032-832054 TGGAATTCCAAGGGAACCACAGG + Intergenic
1185533200 X:838509-838531 TGGGAATCCAAGGGACTGAGAGG - Intergenic
1190558443 X:51662554-51662576 TGGGAATCCTTTGAAAGCACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192022817 X:67412290-67412312 TGGAAATTCTAGTGAATTACTGG - Intergenic
1195614244 X:106900316-106900338 TGGGAAGGCTAGGGAGTCAAAGG + Exonic
1196194068 X:112822171-112822193 TGGGAATCTTAGGGAAGGAACGG - Intronic
1196768086 X:119267940-119267962 TGGGAATCACTGGGAATCAGGGG - Intergenic
1197431479 X:126371750-126371772 TGGGAAACTTGGGTAATCACAGG + Intergenic
1201568361 Y:15389481-15389503 TGGGGATTCTTTGGAATCACTGG - Intergenic
1201668728 Y:16491014-16491036 TTGGAAGCCTGGGAAATCACAGG + Intergenic