ID: 968883867

View in Genome Browser
Species Human (GRCh38)
Location 4:3317069-3317091
Sequence GTCCGGGCACACGGCGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968883867_968883876 24 Left 968883867 4:3317069-3317091 CCTTCAGCGCCGTGTGCCCGGAC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 968883876 4:3317116-3317138 ACCATGCAGACGAATGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 48
968883867_968883874 -1 Left 968883867 4:3317069-3317091 CCTTCAGCGCCGTGTGCCCGGAC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 968883874 4:3317091-3317113 CGACCGGCGATTTTTCGGGTTGG 0: 1
1: 0
2: 0
3: 0
4: 13
968883867_968883872 -6 Left 968883867 4:3317069-3317091 CCTTCAGCGCCGTGTGCCCGGAC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 968883872 4:3317086-3317108 CCGGACGACCGGCGATTTTTCGG 0: 1
1: 0
2: 0
3: 0
4: 2
968883867_968883873 -5 Left 968883867 4:3317069-3317091 CCTTCAGCGCCGTGTGCCCGGAC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 968883873 4:3317087-3317109 CGGACGACCGGCGATTTTTCGGG 0: 1
1: 0
2: 0
3: 0
4: 0
968883867_968883878 25 Left 968883867 4:3317069-3317091 CCTTCAGCGCCGTGTGCCCGGAC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 968883878 4:3317117-3317139 CCATGCAGACGAATGACGACGGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968883867 Original CRISPR GTCCGGGCACACGGCGCTGA AGG (reversed) Exonic