ID: 968885509

View in Genome Browser
Species Human (GRCh38)
Location 4:3328998-3329020
Sequence AACTCCAAGGGGAAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968885496_968885509 29 Left 968885496 4:3328946-3328968 CCTTGTCTACTAACCATGTCCAG 0: 1
1: 3
2: 0
3: 12
4: 123
Right 968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 156
968885500_968885509 16 Left 968885500 4:3328959-3328981 CCATGTCCAGTCTGGATGGGAGG 0: 1
1: 1
2: 0
3: 20
4: 186
Right 968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 156
968885495_968885509 30 Left 968885495 4:3328945-3328967 CCCTTGTCTACTAACCATGTCCA 0: 1
1: 0
2: 3
3: 11
4: 143
Right 968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 156
968885502_968885509 10 Left 968885502 4:3328965-3328987 CCAGTCTGGATGGGAGGTCACAG 0: 1
1: 0
2: 4
3: 13
4: 145
Right 968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968885509 Original CRISPR AACTCCAAGGGGAAGTTGTC AGG Intronic
904366460 1:30013895-30013917 TACTCCAAGGGAATGTGGTCAGG + Intergenic
906160511 1:43645525-43645547 AGCTCCAGGGAGAAGATGTCTGG + Intergenic
907494710 1:54836178-54836200 AACTCCAAGGGAAGGCAGTCGGG + Intronic
909934178 1:81531806-81531828 AACTCCAAGATGAATTTATCAGG + Intronic
912984587 1:114414627-114414649 TACTCAAAGGGGAAATTGTAAGG - Intronic
914339469 1:146746784-146746806 AACTCAATGGGGAAGTTGCAGGG - Intergenic
921065564 1:211620044-211620066 AACTGCAAGGGGACTTTGTGGGG + Intergenic
922205400 1:223441997-223442019 AACTCTAAGGGGAAGTTATATGG + Intergenic
1063544198 10:6964085-6964107 ACCCCCAAGGGGATGTTGTTAGG + Intergenic
1065116441 10:22487828-22487850 ATCTCAAAGGAGAACTTGTCAGG - Intergenic
1065173664 10:23056278-23056300 AACTCCAAGAGCAAGTTCTCCGG - Intergenic
1070417690 10:76205808-76205830 AACTCTTGGGGGAAGTTGGCTGG + Intronic
1071084256 10:81849766-81849788 AGCTCCCAGGGGAATTTTTCAGG + Intergenic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1075271253 10:121053746-121053768 AAGTCCAAGGTTAAGGTGTCAGG - Intergenic
1075834716 10:125443873-125443895 AATCCCAAGGAGGAGTTGTCTGG + Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076587606 10:131560044-131560066 AAGTCCCAGGGGATGATGTCTGG - Intergenic
1077121126 11:909081-909103 ATCTCCCTGGGGCAGTTGTCTGG - Intronic
1077622766 11:3742246-3742268 AACTCCAAGGGGAAAAAATCTGG + Intronic
1078319741 11:10323454-10323476 AACTCCCTTGGAAAGTTGTCTGG - Intronic
1080587697 11:33696558-33696580 AAATCCAAGGGCAAATTCTCAGG + Intergenic
1081312827 11:41594081-41594103 AACGCCAAGAGGAATTTGGCTGG - Intergenic
1084510359 11:69599560-69599582 AACTCCAAGGGGGAGATCCCTGG - Intergenic
1085100107 11:73793632-73793654 AACTCCTAGAGGAAGTTGGGAGG + Intronic
1086166306 11:83782827-83782849 AAATCAAAGGGGAAGGTTTCTGG + Intronic
1091611641 12:2015357-2015379 AACTTCAGGGGAAAGCTGTCTGG + Intronic
1096840060 12:54374606-54374628 AGACCCAAGGGGAAGTAGTCAGG - Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1097495111 12:60322186-60322208 AAATCTAAAGGTAAGTTGTCTGG - Intergenic
1097703616 12:62845655-62845677 ATCTCCCAGGGAAAGTTGTCTGG - Intronic
1099791368 12:87338899-87338921 TACTACAAGAGGAAGTTGTTAGG - Intergenic
1100411362 12:94322695-94322717 AGCTCTAAGGAGAAGTGGTCAGG - Intronic
1101889644 12:108701687-108701709 AACTCCAAAGTGAAATTCTCTGG + Intronic
1104308292 12:127630402-127630424 AAGTCCATGGAAAAGTTGTCTGG - Intergenic
1111262504 13:85760481-85760503 GACGCCAAGGGGAATTTGGCTGG - Intergenic
1112523534 13:100120663-100120685 TACTCCAATGGGAATTGGTCAGG + Intronic
1113159541 13:107364696-107364718 AACTTTAAGGTGAAGTTGTAGGG - Intronic
1117819018 14:59629403-59629425 AATTACAAGGGGAAGATGCCAGG + Intronic
1119563814 14:75611801-75611823 AACTTCAGGGGGTAGTTGTGAGG + Intronic
1120156095 14:81095095-81095117 AACTCCTAGTGGCAGTTGTAAGG - Intronic
1121576756 14:94995236-94995258 ATCTCCAAGGGGAAGCTTTGTGG + Intergenic
1122220625 14:100237278-100237300 TACTCCAAGGGGAATTATTCAGG + Intergenic
1122273121 14:100577322-100577344 ACCTCCAAGGGGAGGCAGTCCGG + Intronic
1124452700 15:29811058-29811080 AACTCAAAGAGAAAGTTGACAGG + Intronic
1126461525 15:48919883-48919905 CACACCAAGGGGAAGATATCTGG - Intronic
1131038012 15:89238010-89238032 AATTCCAAGGGGAAAATGTTGGG + Intergenic
1132001306 15:98182637-98182659 AACCCCAAGGGGAAGATTTCAGG + Intergenic
1133364198 16:5198021-5198043 AACCCCAAGGGGATGGTATCAGG - Intergenic
1137238778 16:46637328-46637350 GATTCCAAGGGGAAGCTGTCAGG - Intergenic
1138665098 16:58560269-58560291 AACTCCAGGTGGTGGTTGTCTGG + Exonic
1138857367 16:60710595-60710617 CAATTAAAGGGGAAGTTGTCAGG + Intergenic
1139994807 16:70970563-70970585 AACTCAATGGGGAAGTTGCAGGG + Exonic
1141878101 16:86840218-86840240 AGCTCCAAGGGAAATTTATCAGG - Intergenic
1144517821 17:15931234-15931256 AGCTCCAAGGGGAAATTTCCAGG - Intergenic
1145972948 17:28967672-28967694 AACTCAAAGGGGAAGATGTAAGG - Intronic
1149441246 17:56676133-56676155 AACTCCAAGGTCAGGTTATCTGG - Intergenic
1149616538 17:58005947-58005969 GCCTCCAAGTGGAAGTTGGCAGG - Exonic
1152005648 17:77678686-77678708 CACTCCATGGGGATGTTGTGAGG + Intergenic
1152346025 17:79752358-79752380 AACCCGAAGGGGAAGTTTGCTGG - Intergenic
1153189191 18:2519070-2519092 TAGTCCAAGGGGATGTAGTCTGG - Intergenic
1155227324 18:23740381-23740403 AAGACAAAGGGGAAGTTGTTAGG - Intronic
1155394894 18:25376880-25376902 AACACCAAGAGGAATTTGGCTGG + Intergenic
1156306693 18:35884432-35884454 AATTCCAGGTGGGAGTTGTCTGG + Intergenic
1156403368 18:36760581-36760603 AAAACCAAGGGGAAGTTAGCAGG - Intronic
1159516236 18:69461988-69462010 AAATGCAAGGGAAAGTAGTCTGG - Intronic
1161788065 19:6340529-6340551 TACTCCATGGGGAAGGAGTCAGG - Intergenic
1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG + Intergenic
1164963506 19:32458025-32458047 AAATTCAATGGGAAGTTATCAGG + Intronic
1165171392 19:33894486-33894508 AACTCCTAGGGAAAGGTGTCTGG + Intergenic
1166227895 19:41408362-41408384 AACTCCTCGGGGAATTTGTGAGG - Intronic
1167668425 19:50836286-50836308 AACTCCCAGGGAACGTTCTCAGG - Intronic
1167845985 19:52164602-52164624 AACTCAAAGGGGATTTTGACAGG + Intronic
928154398 2:28863094-28863116 AACTCCAACTGCAAGTTATCAGG + Intronic
928204591 2:29274932-29274954 GGGTCCAAGGGGAAGCTGTCTGG - Intronic
929046423 2:37795054-37795076 AACTCCAAGTGGAGAATGTCAGG + Intergenic
929400953 2:41580892-41580914 AAATCCAAGGGGAAAGTTTCAGG - Intergenic
930037459 2:47095851-47095873 AATTCCAAGGGGAAGCCTTCAGG + Intronic
931828061 2:66022021-66022043 AACTGAAAGGGGAAGTAGCCTGG - Intergenic
932211741 2:69937208-69937230 AAGTCAAAGGGGTAGTTGTTGGG - Intronic
932526797 2:72478390-72478412 ATCTGCAAGGGAAAGTTTTCTGG + Intronic
933748109 2:85585264-85585286 ATCTCCAAGGCAAAGATGTCAGG + Intronic
935678687 2:105617886-105617908 CACTGCATGGGGTAGTTGTCAGG + Intergenic
940352418 2:152704447-152704469 AACCCCCCGGGGAAGTTGTAAGG + Intronic
944364399 2:198899978-198900000 AACACCAATGGGAAGTTATAGGG - Intergenic
944689372 2:202146060-202146082 AACTACATGGGGATGTTGTAAGG - Intronic
948716075 2:239864681-239864703 AACCCCAAGGTGATGGTGTCAGG + Intergenic
948772501 2:240258807-240258829 AGCTCCAAGTGGAACTTGGCTGG - Intergenic
1180012954 21:45063381-45063403 AAGTCCAAGGTCAAGGTGTCTGG - Intergenic
1181365311 22:22371980-22372002 AACGGCAAGAGGATGTTGTCAGG - Intergenic
1182057624 22:27372365-27372387 AACAGCAAGGGGAAGTAGCCAGG + Intergenic
1182658187 22:31906228-31906250 TACTCCAAGCGCAAGTTCTCAGG + Exonic
1183521996 22:38300876-38300898 AGCCCCATGAGGAAGTTGTCGGG + Exonic
953912673 3:46900838-46900860 AGCCCCAAGGGGAAGCTGTTAGG + Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
954920864 3:54189652-54189674 AGCTTCAGGAGGAAGTTGTCTGG + Intronic
956019054 3:64914114-64914136 AACTCCAAGGTGAATTTGCATGG - Intergenic
963843118 3:150128398-150128420 AACACAAAGAGGAAGTTTTCTGG + Intergenic
964280658 3:155060975-155060997 AACTCCAAAGGGATATTGTTAGG - Intronic
967099166 3:186201626-186201648 AACACAAAGGGGAAGATGGCTGG - Intronic
968266243 3:197365705-197365727 AGCACCAATGGCAAGTTGTCAGG - Intergenic
968471164 4:783070-783092 GACTCCAAGGGAAAGCTGCCTGG + Intergenic
968885509 4:3328998-3329020 AACTCCAAGGGGAAGTTGTCAGG + Intronic
970557872 4:17253811-17253833 AAGTCCAGCGGGAAGCTGTCAGG + Intergenic
972887514 4:43510361-43510383 AACACCACGTGGAAGCTGTCAGG + Intergenic
976683348 4:87782834-87782856 AATTACAAGGAGAACTTGTCTGG + Intergenic
978327401 4:107575080-107575102 GACTCCGAGGGGAATTTGGCTGG + Intergenic
979565273 4:122147660-122147682 AAGTCCAAGAGCAAGGTGTCAGG - Intergenic
989242120 5:39213736-39213758 AACTCTAAGGGGCAGCTGTTTGG - Intronic
992637643 5:78740245-78740267 AAGGCCAAGGGCAATTTGTCAGG - Intronic
994878130 5:105451199-105451221 AACACCACGTGGAAGTTGCCAGG - Intergenic
995468967 5:112480128-112480150 AGCTCCAAGTGTAGGTTGTCTGG + Intergenic
995783074 5:115798315-115798337 AAGTCCAAGGGTAAGTAATCAGG - Intergenic
996957146 5:129197094-129197116 AGATCCAAGAGGAAGTTGTTTGG - Intergenic
1003840657 6:10115800-10115822 ACCTCAAAGGGGAATTTATCAGG + Intronic
1005353463 6:24959802-24959824 AACTCCACGGGGAAGGTCTGTGG + Intronic
1005608982 6:27505115-27505137 AAATTCAAGGTGAAGTTCTCTGG - Intergenic
1010753480 6:79640615-79640637 AACTCCAAGGGGTTGTTTCCTGG + Intronic
1012472452 6:99587675-99587697 CACTTCAGGGTGAAGTTGTCAGG + Intergenic
1015445488 6:133299161-133299183 AACTCCAATGGGATGTCCTCAGG + Intronic
1015793277 6:136985692-136985714 AAGTCCAAGAGGAAGGTGCCAGG - Intergenic
1017518934 6:155184660-155184682 AACACCAAAGAGAAGTTGTTAGG + Intronic
1018436719 6:163766416-163766438 ATCTTCAAGTGGAAGTTGTTGGG + Intergenic
1019640481 7:2100923-2100945 AACACCAACGTCAAGTTGTCAGG - Intronic
1019800491 7:3084738-3084760 GACGCCAAGGGGAATTTGGCCGG + Intergenic
1019950777 7:4370522-4370544 AACTCCAAGGTGGAGTGGTGTGG - Intergenic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1023301563 7:38778153-38778175 AAGTCCAAGGGCAAGTGCTCTGG + Intronic
1023488294 7:40710477-40710499 AACTCCAAAGATAAGTTCTCTGG - Intronic
1024672120 7:51605950-51605972 AATTTCTAGGGGAAGTTTTCAGG - Intergenic
1030139848 7:106293272-106293294 AAATCAAAGGGGAAGTAGGCAGG - Intergenic
1031058837 7:117026119-117026141 AACTCCAAGGGGATGCTATGGGG - Intronic
1036281091 8:7402274-7402296 AACTTAAAGGAGAAGCTGTCAGG + Intergenic
1036340375 8:7909298-7909320 AACTTAAAGGAGAAGCTGTCAGG - Intergenic
1041868103 8:62599808-62599830 TACTCCTAGGGGAAGTGGTAGGG - Intronic
1043350767 8:79358668-79358690 AACTGCAAGAGGAAGTGTTCAGG - Intergenic
1044442630 8:92239627-92239649 AATTCCAAGGGGAAAATGTTGGG - Intergenic
1045138009 8:99244590-99244612 AACTCCAAGGCGAAAATGTGAGG - Intronic
1047045331 8:121046820-121046842 CACTTCAAGGGGAGGTGGTCAGG - Intergenic
1048130151 8:131687299-131687321 ATCTCCAACGGGATGTTATCTGG + Intergenic
1049279620 8:141737630-141737652 CACTCCAGGGGAAAATTGTCTGG - Intergenic
1050068377 9:1785363-1785385 AAATCCAAAGGGAAGTTCTTAGG + Intergenic
1052266848 9:26584014-26584036 AAATCCATGGATAAGTTGTCTGG - Intergenic
1052944701 9:34158887-34158909 AAGTCCAAGGTCAAGGTGTCAGG - Intergenic
1053165809 9:35842757-35842779 AGCTTGAAGGGGAAGGTGTCAGG + Intronic
1053282519 9:36830187-36830209 AAGTCCAAGATGAAGGTGTCAGG - Intergenic
1056097527 9:83270726-83270748 ACCTCCAAGGGGTGGTTGTGAGG + Intronic
1056695449 9:88846515-88846537 AAATCTAAGGGGAAGCTGCCAGG - Intergenic
1058593440 9:106589300-106589322 AACTCCAGGAGGAAGCAGTCAGG + Intergenic
1058747696 9:108007899-108007921 AACTCCAATGGGAAGGTGGGAGG - Intergenic
1059039876 9:110800848-110800870 AGCTCCACGGGGCAGTTCTCAGG - Exonic
1059044075 9:110845245-110845267 AACAGCAAGATGAAGTTGTCAGG + Intergenic
1059790318 9:117635537-117635559 GACTCCAAGGGGAAGCTCACTGG - Intergenic
1060789413 9:126475981-126476003 AACTGCAAGGAGGAGCTGTCTGG - Intronic
1061145231 9:128793785-128793807 ATCTCCAAGGGGCAGCTCTCAGG + Intronic
1061517032 9:131096186-131096208 AACTCCATGGGGTGGTTGTGAGG - Intergenic
1186416116 X:9384416-9384438 ACCTCCAATGGGATGGTGTCAGG - Intergenic
1187519746 X:20003054-20003076 TACCCCCAGGGGAAGTTGACAGG - Intergenic
1187873623 X:23784623-23784645 AGCTAAAAGGGGAAGTTGTCTGG + Intronic
1188714519 X:33444839-33444861 AACTCTCAGGGGAAGATGTCTGG + Intergenic
1189898610 X:45682565-45682587 AAGTCCAAGGGGAACTTATGGGG + Intergenic
1193034167 X:76931600-76931622 AAGTCCAAGGTCAAGATGTCAGG + Intergenic
1197415844 X:126171684-126171706 ATCACCAAGTGGAAGTTGTAAGG + Intergenic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1199045762 X:143169682-143169704 AACTCCAAAAAGAAATTGTCTGG + Intergenic
1200732744 Y:6759863-6759885 AAGTCCTAGGGGAAGTATTCAGG + Intergenic
1201222833 Y:11788649-11788671 AAGTCCAAGGTCAAGTGGTCTGG - Intergenic