ID: 968889999

View in Genome Browser
Species Human (GRCh38)
Location 4:3363799-3363821
Sequence CCCTGACCCCTGGGTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 436}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968889999_968890010 14 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890010 4:3363836-3363858 TGGTACTAGAAACCTGAGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 106
968889999_968890011 19 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890011 4:3363841-3363863 CTAGAAACCTGAGGGTGGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 195
968889999_968890013 23 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890013 4:3363845-3363867 AAACCTGAGGGTGGCCTGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 227
968889999_968890009 11 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890009 4:3363833-3363855 GCTTGGTACTAGAAACCTGAGGG 0: 1
1: 0
2: 1
3: 4
4: 91
968889999_968890012 22 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890012 4:3363844-3363866 GAAACCTGAGGGTGGCCTGGAGG 0: 1
1: 0
2: 7
3: 34
4: 326
968889999_968890016 28 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890016 4:3363850-3363872 TGAGGGTGGCCTGGAGGGCTGGG 0: 1
1: 0
2: 5
3: 53
4: 556
968889999_968890015 27 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890015 4:3363849-3363871 CTGAGGGTGGCCTGGAGGGCTGG 0: 1
1: 0
2: 5
3: 81
4: 710
968889999_968890008 10 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890008 4:3363832-3363854 AGCTTGGTACTAGAAACCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 105
968889999_968890007 -6 Left 968889999 4:3363799-3363821 CCCCTGGGACCCAGGGGTCAGGG 0: 1
1: 0
2: 2
3: 37
4: 436
Right 968890007 4:3363816-3363838 TCAGGGACTGGAAGGAAGCTTGG 0: 1
1: 0
2: 5
3: 33
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968889999 Original CRISPR CCCTGACCCCTGGGTCCCAG GGG (reversed) Intronic
900130382 1:1084830-1084852 CCCAGGCTCCAGGGTCCCAGGGG + Intronic
900237050 1:1597921-1597943 CCCATACCCAAGGGTCCCAGGGG + Intergenic
900342956 1:2197319-2197341 CCCTGGCCACTGGGCCCAAGAGG + Intronic
900367572 1:2317526-2317548 CCCTGGCCTCAGGTTCCCAGGGG + Intergenic
900371156 1:2332827-2332849 CCAGGACCCCAGGGTCTCAGAGG + Intronic
900399212 1:2466183-2466205 CACTGAGACCTGGGGCCCAGAGG + Intronic
900432345 1:2608256-2608278 CCCTGAACCCTGGTGCTCAGCGG + Intronic
900436310 1:2632905-2632927 CCCTGGAGACTGGGTCCCAGTGG + Exonic
900469086 1:2843093-2843115 CCCTGAGCTCTGGTTCCCACAGG + Intergenic
900477394 1:2882387-2882409 CCCTGACCCCTGGGGGGTAGAGG - Intergenic
900930135 1:5731232-5731254 CCTGGACCCTTGGGTCCCATTGG - Intergenic
901595767 1:10384188-10384210 CTCTGCCTCCTGGGTCCAAGCGG - Intergenic
901628167 1:10635167-10635189 CACTGACTCCTGGGGCCCAGGGG - Intergenic
901703698 1:11058963-11058985 CCCTGACCCCTCGGACCCACGGG + Intronic
901874965 1:12162164-12162186 ACCTGGCCTCAGGGTCCCAGTGG - Intergenic
903021727 1:20399794-20399816 CCCTGACCCCTGGCTCCAGGAGG - Intergenic
903349645 1:22710346-22710368 CCCTGCCACCCGGGTCCCTGCGG - Intergenic
903374852 1:22859369-22859391 ACCAGCCCCCTGGGGCCCAGGGG + Intronic
903448897 1:23439373-23439395 CCCTGACCCCTGACTCTCTGGGG + Intronic
904199047 1:28807460-28807482 CCTTCACACCTGGGTCACAGAGG - Intergenic
904478145 1:30777580-30777602 CCCTGTCTCCTGGGGCCCACTGG + Intergenic
905387302 1:37613670-37613692 CCCTGACCCCAGGGAGGCAGAGG + Intronic
905626888 1:39495252-39495274 CCCCGCCCTCTGGGTCCCACAGG - Intronic
905670046 1:39785517-39785539 CCCCGCCCCCTGGGTCCCACAGG + Intronic
905893328 1:41530447-41530469 CCCTGGCCACCAGGTCCCAGGGG - Intronic
906059042 1:42936494-42936516 CCCTGCCCACTGGGTCCCCTGGG + Intronic
906073652 1:43036004-43036026 CCCTGGCCCCTAGGTCCCCCCGG + Intergenic
907091588 1:51730037-51730059 CCCCTACCCCTGAGTCCCCGGGG + Intronic
907212545 1:52835953-52835975 GCTTGAACCCTGGGACCCAGAGG + Intergenic
907359254 1:53901583-53901605 GCCTGAGCCCTGGCTGCCAGGGG + Intronic
907610835 1:55869207-55869229 CCCTGCCCACTGGTTGCCAGTGG + Intergenic
913315781 1:117550068-117550090 TCCTGAAGCCTGGGACCCAGGGG + Intergenic
914430769 1:147619093-147619115 CAGTGACCCCTGTCTCCCAGGGG + Exonic
914850348 1:151309558-151309580 CCCTGACCCTTTGGTCCCACAGG - Intronic
915108173 1:153547061-153547083 CCATGAGCACTGAGTCCCAGGGG + Intronic
915227774 1:154423458-154423480 CCCTGACAGCTGGGTGGCAGTGG - Intronic
915294168 1:154908525-154908547 CCCTGAGCTCTGGGACCCTGTGG - Intergenic
915544966 1:156591939-156591961 CCATGACCTCTGAGTCCCAGCGG - Exonic
915741618 1:158123046-158123068 CACTTACCCCTGGGCACCAGAGG + Intergenic
916894825 1:169151505-169151527 CTCTGAGCCCTGGGTCACCGAGG - Intronic
920036367 1:203068273-203068295 CCCTGGCACCTGGGTGCCTGGGG - Intronic
921319669 1:213926507-213926529 CCATGACCCTTGGTTTCCAGAGG - Intergenic
922167525 1:223128418-223128440 GCCTTGGCCCTGGGTCCCAGTGG + Intronic
923541144 1:234889040-234889062 CCCTGACCCATGGCAACCAGGGG + Intergenic
923740289 1:236648305-236648327 CCCTGACCTCCGGGGCTCAGAGG - Intergenic
924351128 1:243115643-243115665 GCCTGACCCGTGAGTCCTAGGGG + Intergenic
924593625 1:245426670-245426692 CCCTGACCCCAGGGCCTGAGCGG - Intronic
924778348 1:247126643-247126665 CCCGGGCCCCGGGCTCCCAGCGG + Intronic
924783310 1:247171777-247171799 CCCGGGCCCCGGGCTCCCAGCGG - Intronic
1063609814 10:7552924-7552946 CCTTGACCTCTGGGACTCAGTGG - Intergenic
1064982115 10:21174678-21174700 CCCGGAGACCTGCGTCCCAGAGG + Intergenic
1067053694 10:43039448-43039470 CACAGACCCCTAGGTCCCAGAGG + Intergenic
1067730655 10:48808852-48808874 CCCTGTCCCCAGGGACCCAGAGG + Intronic
1069753022 10:70757014-70757036 CCATGACCCTTGTGTCTCAGTGG + Intronic
1069857309 10:71448432-71448454 CCCTGACTCCAGGGTGCCATAGG + Intronic
1069928232 10:71865857-71865879 GCCTGTCCCCTGCATCCCAGCGG + Intergenic
1070305852 10:75238768-75238790 CCTTGAACCCTGGGACCCAGAGG + Intergenic
1070523005 10:77270604-77270626 CTCTGCCTCCTGGGTTCCAGCGG + Intronic
1070758203 10:79006450-79006472 CCCTGACCCCTGGGGCCTCAGGG + Intergenic
1071603148 10:86968730-86968752 GCCTGCCCCCTGCGTCTCAGTGG - Intronic
1073034430 10:100553372-100553394 GCCTGACCTCTGCATCCCAGTGG + Exonic
1073139212 10:101236629-101236651 CCCTGACCCATGGGGCCCGAGGG - Intergenic
1073454673 10:103629361-103629383 CCCTGGCCTCTGGGGCTCAGTGG + Intronic
1074248162 10:111714648-111714670 CCCTGTACCCTGTGTCCCTGAGG - Intergenic
1074697716 10:116065504-116065526 CCCTGCCCCCAGGGGCCCAAAGG + Intronic
1075785701 10:125048633-125048655 CCCCGACCCCAGGGAGCCAGGGG + Intronic
1077089856 11:773491-773513 ACCCCTCCCCTGGGTCCCAGGGG + Intronic
1077089860 11:773497-773519 AGGTGACCCCTGGGACCCAGGGG - Intronic
1077112689 11:868920-868942 TCCTCACCACTGGGTCCCACAGG - Exonic
1077154677 11:1086005-1086027 CACTGGCCCCTGTGCCCCAGTGG - Intergenic
1077311556 11:1891080-1891102 CCCTCACCGCTGGCTCGCAGCGG - Intronic
1077340904 11:2025905-2025927 CCCTGACCCCTGGCTTCTTGAGG + Intergenic
1077489295 11:2853099-2853121 CCCTCACCCATGGCTCCCAGAGG + Intergenic
1078251477 11:9620147-9620169 CTCTGGGCCCTGGGTCTCAGAGG + Intergenic
1078255137 11:9652353-9652375 CCCTGGCCACTGGGTCCCCCTGG - Intergenic
1078847163 11:15128740-15128762 CCCTCACCTCTGGGTCCAGGTGG - Intronic
1080852165 11:36079053-36079075 CCCTGTGCCCTGCGTCCCTGAGG - Intronic
1082645494 11:55719818-55719840 CCGTGACCCCCAGGCCCCAGAGG + Intergenic
1083476988 11:62921291-62921313 CCCAAACACCTGGCTCCCAGGGG + Exonic
1083776159 11:64895209-64895231 CCCTGACCTCTGGCTTCCACAGG - Exonic
1084517688 11:69645376-69645398 CCAGGACCCCTGGGTGCTAGTGG + Intronic
1084874961 11:72124350-72124372 CCATGACCCCTAAGCCCCAGAGG + Intronic
1085041877 11:73331455-73331477 CCCCCACTCCTGGGCCCCAGTGG + Intronic
1085406526 11:76266360-76266382 CCATGACCCCTGTGCCCCATGGG + Intergenic
1085508047 11:77071281-77071303 CCCTGAACTCTGGCTACCAGGGG - Intronic
1085821058 11:79794281-79794303 CCCTGTCCTCTGGGTCCAAAAGG - Intergenic
1087807797 11:102574415-102574437 CTCTGACCCCTGGGCTCAAGTGG + Intergenic
1088344744 11:108810275-108810297 GCCTGAACTCTGGGCCCCAGGGG + Intronic
1089006681 11:115097530-115097552 CCCTGCCTCCTGGGTTCCTGTGG + Intergenic
1089234697 11:117013391-117013413 CCCTGCCTCCTGGGTTCAAGTGG - Intronic
1089776412 11:120839979-120840001 CCCTGAGCCTTGGGTGACAGAGG + Intronic
1202823889 11_KI270721v1_random:81094-81116 CCCTGACCCCTGGCTTCTTGAGG + Intergenic
1091444585 12:536274-536296 GCCTGTCCCCTGGCTCTCAGAGG + Exonic
1091744299 12:2981448-2981470 CCCTGAGCCCCAGTTCCCAGAGG - Intronic
1091749373 12:3012803-3012825 CCCTGGTTCCAGGGTCCCAGAGG - Intronic
1092216621 12:6688507-6688529 CTCTGACCCCTGGTTACCTGTGG - Intronic
1096228172 12:49882472-49882494 CCCTGCCCCATGGGCCCCAGGGG + Intronic
1096627213 12:52903448-52903470 CCCCGACCACTGGGTTCCTGGGG + Intronic
1097016681 12:55992310-55992332 CACTGAGCCCTGGCTCCCAAGGG + Exonic
1099286515 12:80718750-80718772 ACCTGACCTCTGGGTGTCAGAGG + Intronic
1101756594 12:107625744-107625766 CACTGACACCTGGGTGTCAGGGG + Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1102297202 12:111746470-111746492 CCCTGCCTCCTGGGTTCAAGTGG + Intronic
1103909689 12:124345394-124345416 CCCTGACCTCAGTGTCCCTGGGG - Intronic
1104009187 12:124917157-124917179 ACCTGACTCCTGAGTCCAAGTGG - Intronic
1104616682 12:130276243-130276265 CCCTAGCCACTGGGTTCCAGAGG + Intergenic
1104652793 12:130548798-130548820 TCCTGACCCCATGGTCCCATGGG + Intronic
1105606712 13:21932102-21932124 CCCCCACCACTGGGTCCCCGGGG - Intergenic
1105815945 13:24036555-24036577 CCCTGCCACCTGGGGCCCACAGG + Intronic
1106319004 13:28620998-28621020 CCCTGACTCCTGGGAGCCTGGGG + Intergenic
1106463328 13:29991428-29991450 CACAGACCACTGGGTTCCAGAGG + Intergenic
1106841343 13:33687871-33687893 CCCTGAAGACTGGGTCCCATAGG - Intergenic
1106875018 13:34062192-34062214 CCATGAACCATGGGTCACAGTGG + Intergenic
1107527087 13:41243512-41243534 CCCTGAGCCCAGAGTCCCACAGG - Intronic
1110318754 13:74136215-74136237 CCCTCACCCCCGAGTCCCACTGG - Intergenic
1112041679 13:95553316-95553338 GCATGAACTCTGGGTCCCAGCGG - Intronic
1113890662 13:113734121-113734143 ACCTGACCACAGGGTCCTAGAGG - Intronic
1113900314 13:113793226-113793248 CCCTGAGCTCTGTCTCCCAGTGG - Intronic
1117251794 14:53946691-53946713 ACCTGAGGCCTGGGTCCCCGAGG + Intergenic
1119225780 14:72943645-72943667 CCCTGGCCCCTGGGTTTAAGCGG - Intronic
1119657666 14:76428989-76429011 CCTGCAGCCCTGGGTCCCAGAGG + Intronic
1121107589 14:91291305-91291327 CGCTCACAGCTGGGTCCCAGGGG - Intronic
1121249345 14:92488154-92488176 CTCTGCCCCCTGGGTTCAAGCGG + Intronic
1121430808 14:93886746-93886768 CCCTGCCTCCTGGGTTCAAGCGG + Intergenic
1122234270 14:100323191-100323213 TCCTGACACCTGGGTCCCGAGGG + Intergenic
1122298740 14:100719963-100719985 CTCTGATCTCTGGGTTCCAGGGG - Intergenic
1122399599 14:101458882-101458904 CCCTGCGCCCTGGGGCCCCGGGG + Intergenic
1122445874 14:101768093-101768115 GCCTTACCCCTGGATGCCAGTGG + Intronic
1122649878 14:103220539-103220561 CCCTGAGGCCTGGGTCCCAGGGG - Intergenic
1122790163 14:104181001-104181023 CCCGAAGCCCTGGGTCCCCGTGG - Intergenic
1123042288 14:105495352-105495374 CTCTGACCCCTAGGTCCCCCTGG - Intronic
1123042375 14:105495692-105495714 CCCCAACCCAGGGGTCCCAGGGG - Intronic
1127312161 15:57762174-57762196 ACCTCATCCCTGGGTCCCAAGGG - Intronic
1128767938 15:70262447-70262469 CCTTGGCCCCGGGGGCCCAGGGG + Intergenic
1128987411 15:72231291-72231313 CCCCGCCCCCTGCGTCCCCGCGG + Exonic
1129045082 15:72726787-72726809 CCCTGACCCCTGCCTTCTAGAGG + Intronic
1129295599 15:74598436-74598458 CCCTGCCCCCTCGCTCCCATTGG - Intergenic
1131020341 15:89092586-89092608 CCCTGACCCCTGATCCTCAGAGG + Intronic
1131758114 15:95588251-95588273 CACTGTCCTCTGGGTCCAAGGGG - Intergenic
1132470970 16:102786-102808 CCATGGCCCCAAGGTCCCAGAGG + Intronic
1132505256 16:304937-304959 CCCTGTCTCCTGGGTCCGTGGGG - Intronic
1132514290 16:359159-359181 CCTTGACCCCTGGAGGCCAGCGG - Intergenic
1132863892 16:2084413-2084435 CCTTGTCCCCAGGGTCCCCGAGG - Exonic
1132877007 16:2144424-2144446 TCCTGATCCATGGCTCCCAGGGG + Intronic
1133220927 16:4318867-4318889 CCCTCACCCCCTGGTCCAAGTGG - Intronic
1133229205 16:4358510-4358532 CCATGAGCTCTAGGTCCCAGCGG - Intronic
1133414530 16:5596068-5596090 CCCTGAGCCTGAGGTCCCAGAGG - Intergenic
1133975300 16:10596159-10596181 CCCCCACCCCTGGTTCCCTGGGG + Intergenic
1134692131 16:16197878-16197900 CCCTAACCCTGGGGTCACAGCGG + Intronic
1134930411 16:18202774-18202796 CCCCCACCCCTGGGGCTCAGAGG + Intergenic
1135898341 16:26431110-26431132 CCCTGCCCCCAGGGTTCCAGAGG + Intergenic
1136335749 16:29609541-29609563 CCCTCACCTCTGGGTCAGAGAGG + Intergenic
1136377670 16:29875228-29875250 CCCTGAGCCCTGGGCTCCAAGGG - Intronic
1139400043 16:66674171-66674193 CTGTGGCCCCTGGGTCCCAAAGG - Intronic
1139494100 16:67303406-67303428 CACTGACCCAGGGGCCCCAGAGG + Intronic
1139817655 16:69688465-69688487 CTCTGCCTCCTGGGTTCCAGAGG + Intronic
1140455814 16:75104991-75105013 CCCCGACCTCTGGCTCCGAGCGG + Intronic
1141846584 16:86613390-86613412 CCATGACCACTGGGTCACTGTGG - Intergenic
1142036467 16:87865333-87865355 CCCTCACCTCTGGGTCAGAGAGG + Intronic
1142129505 16:88426270-88426292 CACTGACCCCTGGGTCCTCATGG - Intergenic
1142788738 17:2246311-2246333 TCTTGACCCCAGGATCCCAGTGG + Intronic
1142788740 17:2246317-2246339 CCCTGACCACTGGGATCCTGGGG - Intronic
1143179153 17:4973529-4973551 CCCTGACACTTCTGTCCCAGAGG + Intronic
1143457973 17:7080011-7080033 CCCTGTCCCCTGGGTCTCACCGG + Intronic
1143509972 17:7390055-7390077 CCCAGAGTCCTGGGTTCCAGAGG + Exonic
1143523887 17:7461795-7461817 GCCTGACCCCTGAGCTCCAGGGG + Exonic
1143594813 17:7907719-7907741 ACCGGACACCTGGGTCCCAGAGG + Intronic
1143790696 17:9293085-9293107 CCCTGGCTGCTGTGTCCCAGTGG - Intronic
1143966944 17:10762274-10762296 CCCTCCCTGCTGGGTCCCAGTGG - Intergenic
1144797901 17:17904881-17904903 CCCTGATGCCATGGTCCCAGAGG - Intronic
1145391752 17:22460704-22460726 CCCTGGCCTCTGGGCCCCACAGG - Intergenic
1145774875 17:27520811-27520833 CCCTTACCCATTTGTCCCAGTGG + Intronic
1145959634 17:28879912-28879934 CCCTGACCCCAAGGGCACAGAGG - Exonic
1146056213 17:29582594-29582616 CACTGAGCCCTGGGCCCCAAAGG - Intronic
1146153112 17:30494690-30494712 CTCTGCCTCCTGGGTTCCAGCGG + Intronic
1146370738 17:32264489-32264511 CACAGACCCCAGGGCCCCAGCGG + Intergenic
1147449335 17:40494085-40494107 CCAGGAACCCTGGGTGCCAGAGG + Intronic
1147989137 17:44322728-44322750 CCCTGTCCCCAGGGCACCAGTGG - Intronic
1148062911 17:44848858-44848880 CCCTGCCTCCTGGGTTCAAGTGG + Intronic
1148468221 17:47877567-47877589 CCCCGACCCCCTGGTCTCAGAGG + Intergenic
1148779207 17:50112200-50112222 CTCTGTCCTGTGGGTCCCAGGGG - Intronic
1148865050 17:50624033-50624055 CCCCAGCCCCTGTGTCCCAGGGG - Exonic
1148910468 17:50939829-50939851 CCCTGAGCCCTGGGTGCTTGCGG - Intergenic
1150827852 17:68492405-68492427 CCCTGACGGCTGGCTCGCAGGGG - Intergenic
1151305774 17:73261921-73261943 CCTTCACCCCAGGGTGCCAGTGG + Intronic
1151671736 17:75574736-75574758 CCCACTCCCCTGGGTCCCACGGG + Intronic
1151724522 17:75876560-75876582 CCCTGACCCCGGCTTCCCACCGG + Intronic
1151815492 17:76469555-76469577 CCCTGACCACAGGCACCCAGGGG + Intronic
1151944998 17:77314859-77314881 CCCTCCCCACTGGGTACCAGGGG + Intronic
1152262237 17:79273485-79273507 CCCTGTGCCCAGAGTCCCAGTGG + Intronic
1152552514 17:81036663-81036685 CCCTGAATCCTGTTTCCCAGTGG - Intronic
1152855426 17:82662785-82662807 CCCTGACCCCAGCTGCCCAGTGG - Intronic
1153040364 18:807413-807435 CCTTGACCTCTGGGGCCCAAGGG - Intronic
1153919034 18:9772234-9772256 CCCTCAGCCCTGTGCCCCAGGGG + Intronic
1154303380 18:13213869-13213891 CCCTGAGCTCTGGGTCTCTGAGG - Intergenic
1158008069 18:52695892-52695914 GCCAGACACCTGGGTCCCAGTGG - Intronic
1160580982 18:79884477-79884499 CCCCGGCCACTGGGTCCCCGGGG + Intronic
1160584136 18:79903486-79903508 GCCAGACCCCTGGGTAGCAGAGG + Exonic
1160663299 19:311464-311486 CCCTGACACCTGGAGACCAGGGG - Intronic
1160707389 19:535958-535980 CCCAGCACCCTGGGTCCCGGAGG - Intronic
1161470412 19:4454222-4454244 CCAGGACACCTGGTTCCCAGGGG + Intronic
1161481056 19:4510846-4510868 CCCTGACCCCATGAGCCCAGCGG + Exonic
1161591183 19:5129796-5129818 CCGTGAGCCCTGGGGCCCTGGGG - Intronic
1161596602 19:5154013-5154035 CCAGGACTGCTGGGTCCCAGTGG - Intergenic
1162323150 19:9982081-9982103 CCCGGTCCCCTGGGACCCATAGG - Exonic
1162918870 19:13888842-13888864 CCCTGGCCGTGGGGTCCCAGGGG - Intronic
1163210552 19:15836823-15836845 CCCAGACCCCGGAGTCGCAGCGG + Intergenic
1163292082 19:16385477-16385499 GCGTGGCCCCTGGGTCCCACTGG + Intronic
1163294814 19:16405245-16405267 CCCCGACCCTGGGGTCCCTGTGG - Intronic
1164763220 19:30743782-30743804 CTCTGAGTCCTGGCTCCCAGAGG - Intergenic
1165075016 19:33275798-33275820 CCCTGACCCCTTGCACCCACTGG + Intergenic
1165353898 19:35292092-35292114 CCCCTCCCCCTGGGTGCCAGGGG - Intergenic
1165408636 19:35644972-35644994 CCCAGACGCCTGGGTCTCCGAGG - Intergenic
1165423387 19:35733047-35733069 CCCGGACCCCTGGGGCCCCTGGG - Exonic
1165474957 19:36025128-36025150 CCCCCAGCCCTGGGTCTCAGGGG - Intronic
1165952645 19:39482825-39482847 CCCAGTCCCCTGGGTCCCGAGGG - Intronic
1166004333 19:39896713-39896735 ACCTGAGACCTGGGCCCCAGAGG + Intronic
1166068530 19:40374487-40374509 CCCCCACCCCTGTGTCCAAGTGG + Exonic
1166101947 19:40576384-40576406 CCCACACCCCCGGGCCCCAGCGG - Exonic
1166366352 19:42280410-42280432 CCCACACCCCTAGGTGCCAGCGG - Intronic
1166373833 19:42316214-42316236 CCTGGACCCCTGGGTCTGAGGGG + Intronic
1166373851 19:42316251-42316273 CCTGGACCCCTGGGTCTGAGGGG + Intronic
1166500037 19:43333376-43333398 CCCTGACCCCTGGGCAGAAGTGG + Intergenic
1166532683 19:43552408-43552430 CCTGGACCCCTGGGTCTGAGGGG - Intronic
1166675927 19:44741028-44741050 CCCTGCCTCCTGGGTTCAAGTGG - Intergenic
1167246420 19:48375846-48375868 CCCCGACCCCTGACCCCCAGGGG - Intronic
1167250345 19:48395815-48395837 CCCGGACTCCTGGGTCCTTGGGG + Intronic
1167294156 19:48639684-48639706 CCCAGACTCCTGGGTCCTGGGGG - Intronic
1167306170 19:48710995-48711017 CCATGAGCCATGGGTCACAGAGG - Intergenic
1167690647 19:50982493-50982515 CCTGGACCCCTGGGTCTGAGTGG - Intronic
1167725841 19:51212083-51212105 CCAGGACGCCTGGGTCCCTGAGG + Intergenic
1167792219 19:51689618-51689640 CCCGCACTCCTGGGTCCCTGAGG + Intergenic
1168023070 19:53623863-53623885 CCCTGCCTCCTGGGTTCAAGAGG - Intergenic
1168289650 19:55351422-55351444 CACTGTCCCCTGGCTCCTAGGGG - Intronic
1168475478 19:56671926-56671948 CGCTGACCCCTGGGGGCCCGAGG + Intergenic
1168584857 19:57584000-57584022 CCCTCAGCCCTGGGGACCAGCGG + Intronic
1168629675 19:57947230-57947252 CACTGAGCCCTGGGGCACAGAGG - Intronic
1168671889 19:58246854-58246876 CCTTGGCCCCTGGGGCCCTGCGG - Intronic
925172039 2:1755830-1755852 CTCTGCCCTCTGGGTGCCAGGGG + Intergenic
926170597 2:10550541-10550563 TCCTGACCCCAGTGTCCCTGTGG + Intergenic
926821419 2:16855288-16855310 CACTGACCTCTGGGACCCAGCGG - Intergenic
927135651 2:20094351-20094373 CTCAGGCTCCTGGGTCCCAGTGG + Intergenic
929824797 2:45301862-45301884 CCCTGAACCCTGGGCCTCGGGGG - Intergenic
930057721 2:47264846-47264868 CCCTGACTGATGGGGCCCAGTGG + Intergenic
930755028 2:54965161-54965183 AGCTCATCCCTGGGTCCCAGGGG + Intronic
931487353 2:62706166-62706188 CCCAGACCCCTGCCCCCCAGCGG - Intronic
932153354 2:69393026-69393048 CTCTGCCTCCTGGGTTCCAGCGG + Intergenic
932575816 2:72961871-72961893 CCTGGACCCCTGGCTCCCCGAGG + Intronic
932578088 2:72973700-72973722 CCCTGAGCCCTGGGCGCCTGGGG - Intronic
935043224 2:99454463-99454485 CTCTGCCACCTGGGTTCCAGTGG - Intronic
935675177 2:105589175-105589197 CCCTGCCCCTTGTGCCCCAGGGG + Intergenic
937160878 2:119759994-119760016 TCAGGACTCCTGGGTCCCAGGGG + Exonic
937305553 2:120868460-120868482 CCCTGCCTTCTGGGCCCCAGAGG + Intronic
937665496 2:124482728-124482750 CACTGCTCCCTGGCTCCCAGCGG + Intronic
940044472 2:149394264-149394286 CCCTCCCCTCTGGGTCCCTGAGG + Intronic
942679823 2:178465509-178465531 AACAGACCTCTGGGTCCCAGTGG - Exonic
942858617 2:180582731-180582753 CCATGGCCCCTGGCACCCAGTGG - Intergenic
943524859 2:189003988-189004010 CCAGGACCCCCAGGTCCCAGCGG + Exonic
945899630 2:215523496-215523518 CCCTGACCACTGCATCTCAGTGG + Intergenic
946334472 2:219028125-219028147 CCATGCCCCCAGGGTCCCATGGG - Intronic
947461172 2:230306135-230306157 CCCTGTGCCCTGTGTCCCTGAGG + Intronic
947534938 2:230934472-230934494 CCCTGAGCTCTTGGTCCCAGGGG + Intronic
947716584 2:232342797-232342819 CCCTCACCCTGGGCTCCCAGGGG - Intronic
948273148 2:236689007-236689029 CCCTGTCTCCTGAGTCCCTGCGG - Intergenic
948361929 2:237428002-237428024 GCCTTACCACTGGGTTCCAGTGG + Intergenic
948631836 2:239307386-239307408 CCCTCTCTCCTGGGGCCCAGTGG - Intronic
1168916497 20:1492508-1492530 GTATGTCCCCTGGGTCCCAGAGG + Intergenic
1168916499 20:1492514-1492536 ACCAGACCTCTGGGACCCAGGGG - Intergenic
1170683407 20:18547050-18547072 CCCTCATCCCTGGGCCCCTGAGG + Intronic
1171186625 20:23127875-23127897 CCTAGACCCCTGATTCCCAGCGG - Intergenic
1171933174 20:31246782-31246804 CCTTGAGCTCTGGGTCCCTGGGG + Intergenic
1172530674 20:35629202-35629224 CCCTGACCCCTGAGTTCCAAGGG + Intronic
1172768397 20:37363181-37363203 CTCTGACCGCCGGCTCCCAGGGG + Intronic
1172788173 20:37483902-37483924 CCCTGCCTCCTGGGTTCAAGTGG - Intergenic
1173721342 20:45260763-45260785 AGCTGACCACAGGGTCCCAGAGG - Intergenic
1173857358 20:46258855-46258877 CACTGACTGCAGGGTCCCAGGGG + Intronic
1174055713 20:47796839-47796861 TCGTGACCCCTTGCTCCCAGGGG + Intergenic
1175388601 20:58612489-58612511 CCCTGACCCCTGCGGGCCTGAGG - Intergenic
1175437381 20:58963204-58963226 CCCTGACGACTGGGTCCCCCTGG - Intergenic
1175562622 20:59944127-59944149 CCCTGACACCTGGAACCGAGTGG - Exonic
1175816036 20:61883692-61883714 CCCCCACCCCTGGGTCATAGAGG - Intronic
1175903822 20:62370303-62370325 CCCAGAGCCCAGGGTCCAAGTGG + Intergenic
1175931832 20:62497205-62497227 CCCTGAGGCCCGGGTCCCTGGGG - Intergenic
1175958770 20:62624524-62624546 CACTGCACACTGGGTCCCAGGGG - Intergenic
1176178279 20:63738661-63738683 CCCTGGCCCTTGGGGTCCAGCGG - Exonic
1176265363 20:64206444-64206466 CTTTGGCCCCTGGGTCCCGGAGG + Intronic
1178087022 21:29122304-29122326 CCGTGACCCCTGGAGCCCTGAGG + Intronic
1178087864 21:29130723-29130745 CCCAGACCCCAGCGTCCCACGGG - Intronic
1178140536 21:29678088-29678110 ACCTGATCTTTGGGTCCCAGTGG - Intronic
1180077341 21:45469381-45469403 CCCTGAGCCCCTGGTCCCAGCGG - Intronic
1180732478 22:17992608-17992630 CCCTGCTCCCTGGCTCCCTGAGG + Intronic
1180802395 22:18637973-18637995 CCCTGACTCCTGGTCCTCAGGGG + Intergenic
1180842343 22:18965213-18965235 CCCTGTCCCATGGCTCTCAGAGG + Intergenic
1180853631 22:19033528-19033550 CCCTGACTCCTGGTCCTCAGGGG + Intergenic
1181059152 22:20273674-20273696 CCCTGTCCCATGGCTCTCAGAGG - Intronic
1181127659 22:20711288-20711310 CCTTCACCCCTGGCACCCAGGGG - Intronic
1181219329 22:21357288-21357310 CCCTGACTCCTGGTCCTCAGGGG - Intergenic
1181361610 22:22342050-22342072 CCCTAACCCCTGGTAACCAGTGG - Intergenic
1181458032 22:23070602-23070624 CCCCGACCCCTGAGGCTCAGCGG - Intronic
1183291023 22:37002147-37002169 CCTTGAGCGCTGGCTCCCAGGGG + Exonic
1183368221 22:37418334-37418356 CCCTGGCCCCTGAGCCCCATGGG - Intronic
1183382158 22:37495705-37495727 ATCTGAGCCCTGGCTCCCAGGGG + Intronic
1183426663 22:37743417-37743439 AACTCACCCCTGGGTCCCTGAGG + Intronic
1183490097 22:38111433-38111455 CCCTGACCCCCGGCTCCCCTCGG - Intergenic
1183935431 22:41259199-41259221 CCCTCAGTCCTGGGTCACAGTGG - Intronic
1184036990 22:41922977-41922999 CCCTGTCACCTGGCTCCCTGGGG + Intergenic
1184113652 22:42409681-42409703 GCCCGAACCCTGGCTCCCAGGGG - Intronic
1184616282 22:45640552-45640574 CCCTTCCCTCTGGGACCCAGGGG - Intergenic
1185412964 22:50695531-50695553 CCCTGAGGCCTGGGTCCCTGAGG + Intergenic
949895422 3:8764661-8764683 CTCTGACCCCTGCATCCCCGAGG + Intronic
949970534 3:9399006-9399028 CCCAGACCTCTGGGTTCCACTGG + Intronic
950032633 3:9862670-9862692 CCCTCTCCGCTGGGTCCCCGGGG - Intergenic
950121010 3:10482610-10482632 CCCTGACCTGTGTGTCCCTGGGG + Intronic
950560496 3:13718681-13718703 CACTGCCGCCTGGTTCCCAGCGG - Intergenic
952715525 3:36476196-36476218 CACTGACCACAGGGACCCAGAGG + Intronic
952718254 3:36504241-36504263 ACCTGAACGCTGGGTCACAGAGG + Intronic
953606850 3:44417992-44418014 CACTGACCCCACGGTCCCTGTGG + Intergenic
954288555 3:49636739-49636761 CCCTGCCCACTGGGACCCTGTGG + Intronic
954372489 3:50176144-50176166 CCTTGACTCCTGGCTCCCTGGGG + Intronic
954447631 3:50555232-50555254 CCTTGGCCCCAGGCTCCCAGAGG + Intergenic
954625706 3:52020943-52020965 CCCTGACCCCGGGCAGCCAGCGG + Intergenic
954647614 3:52141124-52141146 GCCTCATCCCTGGGTCCCTGAGG - Intronic
955239969 3:57169736-57169758 CCCTGACCCCAGTCTCCCAGAGG + Intronic
956277724 3:67521250-67521272 CCCTGACTCCTGGGGCCCGAGGG - Intronic
956290444 3:67654734-67654756 GCCTGACCCCTGCGTCCCGGGGG + Intergenic
956326048 3:68054254-68054276 CCCTGACCCCTGGCTCCCAAAGG - Intronic
957738106 3:84227719-84227741 CCCTGATGGCTGGCTCCCAGGGG - Intergenic
960587144 3:119330459-119330481 CCATGACTCCTGGCTCTCAGTGG + Intronic
960996280 3:123342580-123342602 TCCTGAACCCTGGGGCCCTGCGG + Intronic
960998989 3:123359663-123359685 CTCTGCCCCCAGGGTCCCTGAGG - Intronic
961264816 3:125633344-125633366 CCCTGACCTCTGAGTTCCTGGGG + Intergenic
961336033 3:126180311-126180333 CCCCGAGCCCGGCGTCCCAGCGG + Intronic
961379521 3:126487956-126487978 CCCTGCCACATGGGTCTCAGGGG - Intronic
961825356 3:129596467-129596489 CCCCTCCCCCTGGGTCCCAGAGG + Intronic
962374233 3:134846984-134847006 CCCTTACCCCTGGGCCTCTGTGG + Intronic
967241549 3:187444637-187444659 CTCTGACTCCTGGGTTCAAGTGG - Intergenic
967891330 3:194366418-194366440 TCCTGATCCCTAGGTCTCAGCGG + Intronic
968466202 4:752628-752650 CCCCCACCCCCGAGTCCCAGCGG - Intronic
968889999 4:3363799-3363821 CCCTGACCCCTGGGTCCCAGGGG - Intronic
968972301 4:3802395-3802417 CCCTGACCCCTGGCTTTCTGGGG + Intergenic
969652302 4:8474969-8474991 CCCTGGCCATTGGGTCCCAGTGG + Intronic
970572228 4:17394113-17394135 CTCTTGCCCCTGGGTCCCAGAGG - Intergenic
973974864 4:56253008-56253030 GCCTGACCCCAGGGTAGCAGTGG + Intronic
976181781 4:82406074-82406096 CTCTGCCTCCCGGGTCCCAGCGG - Intergenic
976308488 4:83585695-83585717 CCCTGCCTCCTGGGTTCAAGCGG + Intronic
978914330 4:114105213-114105235 CCCTGTTCCCTGGGTCCCCAGGG - Intergenic
979202312 4:117993356-117993378 CTCTGCCTCCTGGGTCCAAGCGG + Intergenic
979250810 4:118564895-118564917 GCCTGACCCGTGAGTCCTAGGGG - Intergenic
980730150 4:136812905-136812927 CCCTGTGCCCTGCGTCCCTGAGG - Intergenic
981785936 4:148479692-148479714 CTCTGCCTCCTGGGTTCCAGTGG - Intergenic
984371638 4:178874394-178874416 CTCTGCCCCCTGGGTGCAAGTGG + Intergenic
985561126 5:586622-586644 CCCTGATCCCAGGGGCTCAGCGG - Intergenic
985610234 5:883821-883843 CGCTGACCTCTGGATCCCGGTGG + Intronic
985719514 5:1481934-1481956 CCCAGAACCCTGGCACCCAGAGG + Intronic
985782786 5:1879868-1879890 CCATGATGCCTGGGGCCCAGAGG - Intronic
985893973 5:2738542-2738564 CCCTGGCCTCTGGGGCTCAGTGG + Intergenic
986308560 5:6533535-6533557 CACTGAGCCCTGGCTCCCACGGG - Intergenic
987006681 5:13717477-13717499 ACGTGAGCTCTGGGTCCCAGTGG - Exonic
991455929 5:66804435-66804457 CCCTTCCACCTGGGTCCCACGGG - Intronic
992231732 5:74670698-74670720 CCATGACCCCAAAGTCCCAGAGG - Intronic
993385009 5:87252445-87252467 CCCTGAGCGCTGGGACACAGGGG - Intergenic
993457855 5:88145385-88145407 CCCTGACCCCCGGGGTCCCGGGG - Intergenic
993547373 5:89229704-89229726 GCCTGAAACCTGGGTCCCAGTGG + Intergenic
995440431 5:112185959-112185981 CCCTGACCCCTCAGTCCTGGGGG - Intronic
996797476 5:127364887-127364909 CCCTGGTCCCTGACTCCCAGTGG - Intronic
996818833 5:127603037-127603059 CCTTTACCCCTGGGACACAGGGG - Intergenic
998108294 5:139482147-139482169 CCCTCGCCTCTGGGTGCCAGGGG + Intronic
998134823 5:139669032-139669054 CCATGAGCCCTGGATGCCAGTGG + Intronic
998161404 5:139814734-139814756 TCCTGAGCTCTGGGTCCCAGAGG - Intronic
999263257 5:150250585-150250607 CCCTGGCCCATGGGGCCAAGAGG - Intronic
999671027 5:153959389-153959411 CCCTCAGCCTTGGGTCTCAGAGG - Intergenic
999810995 5:155126990-155127012 CCCTGAACCCTAGGCTCCAGAGG - Intergenic
1000411346 5:160937352-160937374 CGCAGACCCCTTGGTCCCACTGG + Intergenic
1001084623 5:168691687-168691709 CCCTGACTCCTTGGTGCTAGTGG + Intronic
1001304369 5:170560973-170560995 GCCTGGCCTCTGGGCCCCAGAGG - Intronic
1001479897 5:172081574-172081596 CCAGGAACCCTGGCTCCCAGAGG + Intronic
1002146059 5:177182230-177182252 CTCTGCCTCCTGGGTTCCAGCGG - Intronic
1002199020 5:177516671-177516693 CCGTGACCGCGGGGTCGCAGGGG - Intronic
1002286478 5:178165834-178165856 CCATGACCGCTGAGTCCCAGCGG - Intergenic
1002614398 5:180441892-180441914 CCCTGCCCCCTGCTTCCTAGCGG - Intergenic
1002655656 5:180744636-180744658 CCTTGCCCCCTGTGTGCCAGGGG + Intergenic
1002898773 6:1393797-1393819 CCCTGCGCACTGGGCCCCAGAGG - Intronic
1003481136 6:6534549-6534571 CCTGGACGCCTGGGTCCCACGGG - Intergenic
1003505876 6:6740042-6740064 ACCTGACACCTGGGTGCCATTGG + Intergenic
1004868448 6:19877778-19877800 CCCTTCCCCCTGAGACCCAGAGG + Intergenic
1005923018 6:30417525-30417547 CCCTGAGCACTGTGTCCCTGAGG - Intergenic
1006093994 6:31644536-31644558 CCATGACCAGGGGGTCCCAGGGG + Exonic
1006152372 6:31996377-31996399 CCTGGACCCCTGGGTTCCTGAGG - Intronic
1006158673 6:32029115-32029137 CCTGGACCCCTGGGTTCCTGAGG - Intronic
1006414142 6:33893360-33893382 CGCCGACCCCTTGGTCCCAGAGG + Intergenic
1006435285 6:34022886-34022908 CCCTGACTCCTGGGTACCCCTGG - Intronic
1006802006 6:36765481-36765503 CCCAGGGCCCTGGGGCCCAGAGG - Intronic
1006815323 6:36845913-36845935 CACTCTCCCCTGGGTCCCTGAGG + Intergenic
1007340227 6:41186527-41186549 CTCTGACCCCTGGGAGCCAATGG - Intergenic
1015832984 6:137389667-137389689 CTCTGAGCCATGGCTCCCAGTGG + Intergenic
1015928678 6:138335003-138335025 TCCTGGCCCCTGGGACCCAGTGG - Exonic
1019020631 6:168914756-168914778 CCCTCACCACTGCGTCCCAAGGG - Intergenic
1019191958 6:170256687-170256709 CCCCATCCCCCGGGTCCCAGGGG - Intergenic
1019624442 7:2008903-2008925 CCCTGAAGCCTGGCTCCGAGTGG - Intronic
1023369242 7:39496577-39496599 ACCTGAGAGCTGGGTCCCAGAGG - Intergenic
1023821087 7:43980914-43980936 CCCTGTCCCCTGAGACTCAGAGG + Intergenic
1025035077 7:55588850-55588872 CCCTGAACTCAGGGTCCCAATGG + Intergenic
1025062981 7:55827018-55827040 ACCTGAACCCTGGGTACCTGAGG + Intronic
1026045626 7:66903915-66903937 GCCTGACTCCTGCGTCCCAATGG + Intergenic
1026129148 7:67606102-67606124 TCCTGAGCCCTGTGTCTCAGAGG + Intergenic
1026331373 7:69355280-69355302 CCATGGCCCCTGGGATCCAGAGG + Intergenic
1026866380 7:73826572-73826594 CCCTGTCCCCAGAGTTCCAGGGG - Intronic
1029109470 7:98205242-98205264 CCCTGACCCTTAGCGCCCAGCGG + Intronic
1029437835 7:100572795-100572817 CCCTGGGCACTGGTTCCCAGAGG + Intronic
1029438980 7:100577132-100577154 CCCTGAGCCCTGGCTTCAAGAGG + Exonic
1029749361 7:102534353-102534375 CCCTGTCCCCTGAGACTCAGAGG + Intergenic
1029767306 7:102633458-102633480 CCCTGTCCCCTGAGACTCAGAGG + Intronic
1030065575 7:105656392-105656414 CCCTGACCTCTGGCTCCCACAGG + Intronic
1032624173 7:133571588-133571610 CGCTGACTCCTGGGTTCAAGTGG - Intronic
1032680243 7:134175160-134175182 CCCTGATCCTTCAGTCCCAGAGG - Intronic
1033251168 7:139761148-139761170 CCCTGACACATGGTTCCCACTGG - Intronic
1033461604 7:141551564-141551586 CCCTGATGCTTGGGTCCCCGCGG - Intronic
1034264134 7:149773134-149773156 CCCGGGCGCCTGGGTCCCCGCGG - Exonic
1034779237 7:153862081-153862103 GCCTGACTCCAGGCTCCCAGAGG + Intergenic
1035769585 8:2136316-2136338 CCCTGATCCCAGGGTGGCAGCGG + Intronic
1037816727 8:22116477-22116499 CCCTGTCCCCCTGGTCCCTGAGG + Intronic
1037906676 8:22719562-22719584 CCCAGACTTCTGGGCCCCAGTGG - Intronic
1038226649 8:25664025-25664047 CCCACACCAGTGGGTCCCAGGGG + Intergenic
1038492555 8:27981331-27981353 CCCTGACCCTTTGGGCCCAAGGG - Intronic
1040295017 8:46144611-46144633 AACAGACCCCTGGGTCCCTGCGG + Intergenic
1042733026 8:71957910-71957932 CCCAGCCCCCTGGGCCCCAGAGG + Intronic
1042997896 8:74721169-74721191 CCCTGACACCTGTGTTCCAGTGG + Intronic
1047718743 8:127619509-127619531 CCCTGGCCCATGGGTCCTGGTGG - Intergenic
1048312507 8:133336414-133336436 AACTGAACCCTTGGTCCCAGTGG + Intergenic
1048812634 8:138302682-138302704 TCCTGAGCCCTGAGTCCCTGGGG + Intronic
1049247627 8:141571254-141571276 CTGTGAGCCCTGGGTCTCAGGGG - Intergenic
1049576691 8:143392990-143393012 GCCTGGCTCCGGGGTCCCAGAGG + Intergenic
1049687320 8:143944180-143944202 CCTTAACCCCTGCGTCCCCGCGG + Intronic
1049787485 8:144457881-144457903 CCCTGACCCCTGGGTGAGCGAGG - Intronic
1049843123 8:144786939-144786961 TCCAGACCCCTTGGTCCCAGCGG - Intronic
1053198602 9:36137681-36137703 TCCTCACCCCTGGCTGCCAGGGG + Intronic
1054752608 9:68923135-68923157 CCCAGACTCCTGGGCCCCACGGG + Intronic
1055348138 9:75357792-75357814 CCCTGTCCCCTGTCCCCCAGAGG - Intergenic
1055460814 9:76518663-76518685 CCCTGTCTCCTGGGTTCAAGTGG + Intergenic
1055829429 9:80360608-80360630 CCCTGTCCTCTGGGTCACAGGGG + Intergenic
1056388589 9:86119582-86119604 CAGTGAGCTCTGGGTCCCAGGGG + Intergenic
1056763195 9:89428888-89428910 CTCTGCCCCCTGGGTCCCTCAGG + Intronic
1057212784 9:93209797-93209819 CCCTTCCCCCAGGATCCCAGGGG + Intronic
1059308525 9:113373139-113373161 CACTGACCCCAGGCTTCCAGAGG + Intergenic
1060295905 9:122342861-122342883 CCCTGCTCCCCGGGCCCCAGAGG - Intergenic
1061150810 9:128826996-128827018 CCCTGAACCCTGGCACCCTGTGG + Intronic
1061186671 9:129059069-129059091 CCCTCACCCCCAGGTCCCTGGGG - Intronic
1061327844 9:129874995-129875017 CCCCGTCCCCTGGGACCCATGGG + Intronic
1061408319 9:130404828-130404850 CCCTGAGCCCCGGTTCCGAGTGG + Intronic
1061515539 9:131087841-131087863 CCTGAACCCCTGGGTCCCTGGGG + Intronic
1061759688 9:132841926-132841948 ACCTGAACCCGGGGTCCCAAGGG + Intronic
1061843797 9:133375798-133375820 CCCTGACTCCTTGTTCCCACAGG - Intronic
1061899585 9:133666129-133666151 CCCTGACCCCTGGCTGCAGGAGG - Intronic
1061917128 9:133761070-133761092 CCCTGATCCCCTGGTCTCAGGGG - Intergenic
1062090921 9:134678463-134678485 CCCTGACTCAGGGGTCCCATCGG + Intronic
1062151302 9:135020575-135020597 CCCTGTCCCCATGGCCCCAGGGG + Intergenic
1062331278 9:136045986-136046008 CCCCGAGCCCTGAGCCCCAGCGG + Intronic
1062392822 9:136340727-136340749 CACTGACCCCTGGGCCTCTGAGG - Intronic
1062483170 9:136761915-136761937 CCCCAACCCCTGGGTGCCAAGGG + Intronic
1185609473 X:1385989-1386011 CCCTGCCCTCTGTGCCCCAGGGG + Intergenic
1185824178 X:3233834-3233856 CTCTGCCCCCTGGGTTCAAGCGG - Intergenic
1186839129 X:13467804-13467826 CTCTGCCTCCTGGGTTCCAGTGG + Intergenic
1187526760 X:20061408-20061430 TCCTGCCCTCAGGGTCCCAGGGG - Intronic
1188262729 X:28038365-28038387 TCCTGAACCCTGGGACACAGGGG - Intergenic
1190545500 X:51522360-51522382 CCTTGACCTCTGGGACCCAAGGG + Intergenic
1192201545 X:69069440-69069462 CCCTGACTTGTGGGGCCCAGAGG - Intergenic
1192521484 X:71804989-71805011 CTCTGGTCCCTGGCTCCCAGAGG + Intergenic
1196755022 X:119150471-119150493 TCCTGGCCCCTCGGTCCCTGGGG + Exonic
1197119366 X:122871910-122871932 CCCCGACCCCTGAGTGCTAGTGG - Intergenic
1197606105 X:128587586-128587608 CTCTGCCCCCTGGGTTCAAGTGG + Intergenic
1197995430 X:132367576-132367598 CCCTGTCCCCTAGTTCCCATAGG + Intergenic
1198394160 X:136206335-136206357 CCCTGAGCAGTGGCTCCCAGAGG - Intronic
1199990109 X:152982804-152982826 CCCTGAGCCATGGGCCCCAGAGG - Intergenic
1200033274 X:153312940-153312962 CCCTGAGCCATGGGCCCCAGAGG - Intergenic
1200053507 X:153446758-153446780 CCCTGAGCCTGGGGTCCGAGGGG - Intronic
1202086526 Y:21142631-21142653 CTCTGACTCCTGGGTTCAAGTGG + Intergenic