ID: 968900472

View in Genome Browser
Species Human (GRCh38)
Location 4:3429147-3429169
Sequence GTGGGCTTGCTGAGCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968900465_968900472 17 Left 968900465 4:3429107-3429129 CCAGGTGAGGGGAGGTGGAGCAC 0: 1
1: 1
2: 7
3: 36
4: 269
Right 968900472 4:3429147-3429169 GTGGGCTTGCTGAGCTCTCTTGG 0: 1
1: 0
2: 2
3: 24
4: 259
968900464_968900472 18 Left 968900464 4:3429106-3429128 CCCAGGTGAGGGGAGGTGGAGCA 0: 1
1: 0
2: 0
3: 36
4: 380
Right 968900472 4:3429147-3429169 GTGGGCTTGCTGAGCTCTCTTGG 0: 1
1: 0
2: 2
3: 24
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968900472 Original CRISPR GTGGGCTTGCTGAGCTCTCT TGG Intronic
900617770 1:3573024-3573046 CTGGGTATGCTGAGTTCTCTTGG + Intronic
901034750 1:6329703-6329725 TTGGGTTTGATGAGCTCTCGGGG - Intronic
902178446 1:14669268-14669290 GTGAGCTGGCTGAGTGCTCTGGG + Intronic
904502145 1:30919660-30919682 GTGGGCTTGCTCAGTTCTCCAGG + Intergenic
905182320 1:36175066-36175088 GTGTTCTTGCTGAGCTCTGGAGG - Intronic
908626677 1:66052415-66052437 GTGGGTTTGATGCGATCTCTAGG - Intronic
908892809 1:68864638-68864660 GTGTGCCTGCTAAGTTCTCTCGG + Intergenic
909493138 1:76247743-76247765 CTTAGCTTGCTGAGCTCTGTGGG + Intronic
910745910 1:90574856-90574878 CTGGGCTTGCTGACATGTCTGGG + Intergenic
911187629 1:94919306-94919328 GTGAGCTTGCTGTGGTCTTTGGG - Intronic
912805616 1:112754805-112754827 GTGAGATTGCTGAGCTGTTTGGG + Intergenic
913098967 1:115545650-115545672 CTGGGCTCTCTGGGCTCTCTGGG + Intergenic
914333630 1:146696200-146696222 GTGGCCATGCTGGGCTCTGTGGG + Intergenic
917157937 1:172025020-172025042 CTTAGCTTGCTGAGCTCTGTGGG - Intronic
918209756 1:182340239-182340261 ATGGGCTTGCTGGGCTCACCAGG + Intergenic
919659811 1:200233528-200233550 GTCGGCTTCCTGAGTTCTCTTGG - Intergenic
919730064 1:200908134-200908156 CTGGGGTTGATCAGCTCTCTTGG - Intronic
919978468 1:202628016-202628038 GTGTGCTTGAGGAGCTCCCTGGG - Intronic
920531611 1:206706544-206706566 GTGGGCTTGCTGTGGTCCCCAGG + Intronic
921461530 1:215432867-215432889 GTGGCCTTGCTGAGCTGTAGTGG + Intergenic
921943121 1:220863841-220863863 GTGGGCTTGCTGAGCTGCGGTGG + Intergenic
922179275 1:223221112-223221134 GTGAGGTGGCTGAGCTATCTGGG + Exonic
923690886 1:236192056-236192078 GTGGCCTTGCTGAGCTGCCATGG + Intronic
924300745 1:242635307-242635329 GTGACCTTGCTGGGCTCTCAGGG - Intergenic
924567210 1:245208826-245208848 CTGGGCTAGCTGAGCTCACTGGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
924687149 1:246305977-246305999 GTGGATTTGCTGAACTCTCTTGG + Intronic
1065427443 10:25619917-25619939 GTGGCCTTGCTGAGCTGTGGTGG - Intergenic
1069151431 10:64965715-64965737 GTGGGCTTGCTGGGTGCTTTGGG + Intergenic
1069334794 10:67335413-67335435 GCAGGCTTGCTGAGCACTTTTGG - Intronic
1070845949 10:79522783-79522805 CTGGCCCTCCTGAGCTCTCTTGG - Intergenic
1070927847 10:80237535-80237557 CTGGCCCTCCTGAGCTCTCTTGG + Intergenic
1072404426 10:95136588-95136610 GTGGACTTGCTGAGCTGTGGTGG - Intergenic
1072766375 10:98097989-98098011 GAGGGCTTACTCAGCACTCTGGG + Intergenic
1074015531 10:109530245-109530267 CTTAGCTTGCTGAGCTCTGTGGG - Intergenic
1074117257 10:110465730-110465752 GAGGGCTTGCTGAGCACTGCGGG + Intergenic
1075630305 10:123996477-123996499 CTGGGCGTGCTCAGCTCTCCTGG + Intergenic
1076515917 10:131044341-131044363 GAGGGCTTCCAGAGCTCTCCAGG - Intergenic
1076771737 10:132669839-132669861 GTGGCCTTGCTGAGCCCCCAGGG + Intronic
1076801830 10:132834553-132834575 GTGTGCTTGCTGTGCCTTCTCGG - Intronic
1077749380 11:4947691-4947713 CTGGGATTACTGAGTTCTCTGGG + Intronic
1077996127 11:7454020-7454042 GTGGGGAAGCTGAGCCCTCTTGG - Intronic
1081611176 11:44564577-44564599 GTGGGCTGCAAGAGCTCTCTAGG - Intronic
1082188620 11:49214903-49214925 GTGGGTTTGCAGAGTTCTGTGGG + Intergenic
1083203452 11:61133468-61133490 GTGGGCTTGATGAGCACTTTTGG + Intronic
1083722459 11:64610141-64610163 GAAGGCTTGCTGAGCTCCCCAGG + Intronic
1083751769 11:64764953-64764975 GTGGGCAGCCTGAGCTCCCTCGG - Exonic
1085843379 11:80039153-80039175 TTGGTCTTACTGAGCTCTGTGGG - Intergenic
1086401764 11:86466545-86466567 GGGGGCTTCCTGTGCTCTCGGGG + Intronic
1086677901 11:89631782-89631804 GTGGGTTTGCAGAGTTCTGTGGG - Intergenic
1089789487 11:120932399-120932421 ATGGGGCTGCTGAGCTCACTGGG - Intronic
1090626059 11:128609936-128609958 ATGCTCTTCCTGAGCTCTCTAGG - Intergenic
1095266026 12:40158903-40158925 GTGGCTTTGCTGATCTCTTTTGG + Intergenic
1096210587 12:49762603-49762625 GTGGGCTGCCTGACCACTCTAGG - Intronic
1096561703 12:52440172-52440194 GTGTGCTTTCTGAGCTCTTTTGG - Intergenic
1098697056 12:73572614-73572636 CTTAGCTTGCTGAGCTCTGTGGG - Intergenic
1099238160 12:80107065-80107087 CTGGGCTTGCTCAGGTGTCTAGG + Intergenic
1099697464 12:86040468-86040490 GTGGCCTTGCTGAGCTGTGGTGG + Intronic
1099699136 12:86061779-86061801 GTGGACTTGCTGAGCTGTGGTGG - Intronic
1100245455 12:92752548-92752570 GTGGGCTTGAAGACATCTCTGGG + Intronic
1100770181 12:97913112-97913134 CTGAGATGGCTGAGCTCTCTAGG - Intergenic
1103606314 12:122088325-122088347 CTGGGCTTGGAGAGGTCTCTAGG - Intronic
1104761012 12:131297562-131297584 GTGAGCTTGGTGGGCTCTGTAGG - Intergenic
1104818766 12:131663230-131663252 GTGAGCTTGGTGGGCTCTGTAGG + Intergenic
1105964551 13:25372395-25372417 CTGGGCTCCCTGGGCTCTCTGGG + Intronic
1106983870 13:35322018-35322040 CTTAGCTTGCTGAGCTCTGTTGG + Intronic
1107458655 13:40579248-40579270 CTGGGCTTTCTGAGCTACCTAGG - Intronic
1107533724 13:41308560-41308582 GTGTGCTTGCTCAGTTCTCCGGG + Intergenic
1111702644 13:91710318-91710340 GTTGTCTTGCTGTGCTCTCATGG - Intronic
1112577068 13:100645290-100645312 GTGTGCTTACTGAGTTCCCTTGG + Intronic
1113146660 13:107215460-107215482 GTTTGCTAGATGAGCTCTCTTGG - Intronic
1113437911 13:110307425-110307447 CCGGCCTTGCTGGGCTCTCTGGG - Exonic
1113789550 13:113020609-113020631 GTGGGCTTGCTCTGCTCGCCTGG - Intronic
1117981667 14:61348000-61348022 GTGGGTTTCCACAGCTCTCTTGG - Intronic
1119205609 14:72791466-72791488 GTGGGCTTGCTGGGCTCCCCAGG - Intronic
1119304890 14:73599616-73599638 CTAGGCTTGCTAGGCTCTCTTGG - Intergenic
1119416519 14:74474007-74474029 ATTGGCTTGATGAGCTGTCTGGG - Intergenic
1119750347 14:77072884-77072906 GGGGGCTTGCTGATCTATCAGGG + Intergenic
1120264220 14:82228864-82228886 TTGGGATTTCTGAGCTCTCCTGG + Intergenic
1120843168 14:89104745-89104767 CTTAGCTTGCTGAGCTCTGTGGG + Intergenic
1123448395 15:20345534-20345556 GTGGGTTAGCTGTACTCTCTGGG + Intergenic
1125288536 15:38120128-38120150 GTGGCTTTGCTGAGCTGTCATGG - Intergenic
1127317855 15:57814821-57814843 GTGGCCTTGCTGAGCTCCCGTGG + Intergenic
1127829063 15:62733978-62734000 CTGGGCTTTCTGACCTCTCGTGG + Intronic
1128223270 15:65983356-65983378 GCAGGCTTGGTGACCTCTCTGGG - Intronic
1128983121 15:72200571-72200593 GTGGGCCTGACGAGCTGTCTGGG + Exonic
1129126793 15:73448404-73448426 GCAGCCTTGCTGAGCTGTCTTGG - Intronic
1131166967 15:90149162-90149184 GTAGGCTTGGGAAGCTCTCTGGG - Intergenic
1132945684 16:2530435-2530457 GTGGGCTTCTGGAGCCCTCTTGG + Exonic
1133236764 16:4391034-4391056 GGGGGCTTCCTGTGGTCTCTGGG - Intronic
1133645621 16:7761763-7761785 GTGAGTATCCTGAGCTCTCTCGG - Intergenic
1133648149 16:7783885-7783907 GTGAACTTGCTGAACTGTCTTGG + Intergenic
1135221969 16:20621581-20621603 CTGGCCCTCCTGAGCTCTCTTGG - Intronic
1136348845 16:29694443-29694465 GTGGGCTTGATGAGATCACTGGG - Intronic
1139303208 16:65962515-65962537 GTGTGCTTGGTCAGGTCTCTCGG - Intergenic
1139999987 16:71015049-71015071 GTGGCCATGCTGGGCTCTGTGGG - Intronic
1140273593 16:73487956-73487978 CTGGGCTTGCTTAGATGTCTGGG - Intergenic
1140688958 16:77462983-77463005 GTGGGCTTGCTGAGAAATATTGG - Intergenic
1142144480 16:88487197-88487219 GTGAGCATGCTGACCTCTCCTGG - Intronic
1142278153 16:89133659-89133681 GTGGGGGTGGTGAGGTCTCTGGG - Intronic
1142315299 16:89340776-89340798 CTGGGGTTTCAGAGCTCTCTGGG - Intronic
1143028295 17:3953579-3953601 GAGGCCTTGCTGAGCTCCCCAGG - Intronic
1144642263 17:16944048-16944070 CAGGGCTTTCTGTGCTCTCTTGG + Intronic
1144670405 17:17129626-17129648 GTGGAGCTGCTGAGCTCTCCTGG - Intronic
1145960127 17:28882413-28882435 GTGGACTATCTGAGCTCCCTGGG - Exonic
1146594358 17:34156372-34156394 GTGGCCTTCGTGGGCTCTCTGGG - Intronic
1148355263 17:46971624-46971646 GTACTCTAGCTGAGCTCTCTAGG - Intronic
1149217131 17:54370413-54370435 GTGTGCCTGCTAAGGTCTCTTGG + Intergenic
1151247244 17:72804332-72804354 GTGTGCTACCTGAGCTTTCTAGG - Intronic
1151983494 17:77528030-77528052 GTGGGCTGTGTGAGCGCTCTTGG + Intergenic
1152340396 17:79721048-79721070 GTGGGTTAGCTGTACTCTCTGGG - Intergenic
1152618545 17:81349277-81349299 GTCTGCTTGCTGTGGTCTCTAGG + Intergenic
1157159110 18:45296657-45296679 GTGGGCCTACAGAGCTGTCTGGG - Intronic
1160020146 18:75173936-75173958 GTGGGTTTTCTGAGCTGCCTGGG + Intergenic
1160738760 19:676484-676506 GTGGGCTTCGTGAGCTCCATGGG + Exonic
1160804301 19:985084-985106 GTGTGCCCGCTGAGATCTCTTGG + Intronic
1161074980 19:2281123-2281145 GTGGGTTTCCTGTCCTCTCTGGG + Intronic
1161074991 19:2281166-2281188 GTGGGTTTCCTGTCCTCTCTGGG + Intronic
1161075010 19:2281252-2281274 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075020 19:2281295-2281317 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075031 19:2281338-2281360 GTGGGTTTCCTGCCCTCTCTGGG + Intronic
1161075051 19:2281424-2281446 GTGGGTTTCCTGCCCTCTCTGGG + Intronic
1161075071 19:2281510-2281532 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075081 19:2281553-2281575 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075092 19:2281596-2281618 GTGGGTTTCCTGCCCTCTCTGGG + Intronic
1161075104 19:2281639-2281661 GTGGGTTTCCTGCCCTCTCTGGG + Intronic
1161075124 19:2281725-2281747 GTGGGTTTCCTGCCCTCTCTGGG + Intronic
1161075136 19:2281768-2281790 GTGGGTTTCCTGCCCTCTCTGGG + Intronic
1161342883 19:3752595-3752617 GGGGGCCTGCTGAGCGCTCGGGG - Exonic
1163033019 19:14556668-14556690 GCAGGCTCCCTGAGCTCTCTTGG + Intronic
1163066978 19:14804320-14804342 GTGTGGTTGCTGAAGTCTCTAGG - Intronic
1163546015 19:17941980-17942002 GTGGGCTTGCTCGGCCCCCTGGG + Intronic
1165341372 19:35214480-35214502 GTGAGCTTGCTGGGCTGTCCTGG + Intergenic
1165970374 19:39624023-39624045 GTGGCCTTGCTGAGCTGTGGTGG + Intergenic
1166062263 19:40333981-40334003 GTGGTGTTGCTTAGATCTCTAGG - Intronic
1166378779 19:42343823-42343845 ATGGGCATGCTGAGCACTCAGGG + Intronic
1167652796 19:50742208-50742230 GCGGGTTTCCTCAGCTCTCTAGG + Intergenic
1167974092 19:53210037-53210059 GTGGCCTTGCTGAGCTGTGGTGG + Intergenic
1168469475 19:56628937-56628959 TGGTGCTTGCTGAGCTCACTTGG + Intergenic
925045561 2:770851-770873 GGGGGCTAGCTGAGTTCTCCAGG - Intergenic
926224006 2:10954701-10954723 CTGGGCTTTCTGTGCCCTCTGGG + Intergenic
927210504 2:20636210-20636232 GTGGGCTTGTTGATCTCTCTTGG - Intronic
929967980 2:46549749-46549771 CTGGGCTGTCTGAGCTCTCAGGG + Intronic
930264739 2:49186407-49186429 CTTAGCTTGCTGGGCTCTCTGGG + Intergenic
930723085 2:54656751-54656773 GTGGGATTTCTGAGGGCTCTGGG - Intronic
931070320 2:58640258-58640280 CTGTGCTTGCTGAGCAGTCTGGG + Intergenic
931575693 2:63716140-63716162 GTGGACTTGATGAGCTCTGAAGG + Intronic
931807694 2:65823671-65823693 ATGGGCTAGATGAGCTCTCTGGG + Intergenic
931859757 2:66342472-66342494 TTGGGCTGGATGTGCTCTCTGGG - Intergenic
932511785 2:72300257-72300279 GTGGCCTTGCTGAGCTGTGGTGG + Intronic
933151624 2:78922126-78922148 GGTGGCTTGCTAAGCACTCTTGG - Intergenic
935979473 2:108612777-108612799 GTGGGCTGGCTGAGGTGTCTGGG + Intronic
936270597 2:111045846-111045868 GTGGGCTGGCTGAGTTTTATGGG - Intronic
937853837 2:126658328-126658350 GGGGACTTGCAGAGCTCCCTGGG + Intronic
938152487 2:128899500-128899522 GATGGATTCCTGAGCTCTCTGGG + Intergenic
939043074 2:137215502-137215524 GAGGGCATGCAGAGCTCTCCAGG - Intronic
940506174 2:154556318-154556340 GTGAACTTGCAGAGCTCTTTCGG + Intergenic
941041435 2:160628190-160628212 TAGGCCTTGCTGAGCTCTGTTGG + Intergenic
944512666 2:200479852-200479874 GAGAGCTTTCTGAGGTCTCTGGG + Exonic
945323684 2:208457481-208457503 GTGGAGCTGCTGAGCTCTATTGG + Intronic
946605209 2:221396782-221396804 GTGGTCTTGCTAAGGTCTGTGGG + Intergenic
947475682 2:230445914-230445936 GTGGGCTTGCTGTGCTGGGTGGG - Intronic
947518695 2:230828333-230828355 GTGGCCTCGGTGAGCTCCCTGGG - Intergenic
947537884 2:230952418-230952440 GTGGCCTTCCTTAGCCCTCTGGG - Intronic
947866402 2:233400674-233400696 CTGAGCTCCCTGAGCTCTCTCGG + Intronic
948117256 2:235502477-235502499 GTGGCCACCCTGAGCTCTCTGGG + Intronic
1168977747 20:1980788-1980810 GTGAGCTGGCCAAGCTCTCTGGG - Exonic
1169209088 20:3755711-3755733 TTGGGCTTTCTGGGCTCTCTGGG - Intronic
1169487304 20:6044120-6044142 GTGGGCTTACAGAGCTCTCTTGG - Intronic
1170812158 20:19682475-19682497 GGGGGCTTTCTGAGCTCTAAGGG - Intronic
1171441411 20:25166353-25166375 GTGGCTTTGCTGAGCTCTGGTGG - Intergenic
1172198027 20:33105477-33105499 CTGAGCTTGCTTTGCTCTCTGGG + Intronic
1172466822 20:35161493-35161515 CTTAGCTTGCTGAGCTCTGTGGG - Intergenic
1172688747 20:36776161-36776183 CTGGGCTGGCTGAGCACCCTGGG + Intergenic
1173163867 20:40672272-40672294 CTGGGCCAGCTGAGCTCTCCTGG + Intergenic
1173173922 20:40749894-40749916 GTGGACTTGGTGATCTCTCTGGG + Intergenic
1174304826 20:49607782-49607804 ATGGGCTAGATGACCTCTCTGGG - Intergenic
1178998232 21:37427306-37427328 GTGGTCTTGCTGTGTTCCCTAGG + Intronic
1180018031 21:45100383-45100405 GTAGCCTTGCAGAGTTCTCTAGG - Intronic
1180718136 22:17886151-17886173 GTGGACTGGCTCAGCTCTCAAGG + Intronic
1181039894 22:20187088-20187110 CTGGCCCTGCTGAGCTCCCTGGG + Intergenic
1181363148 22:22354195-22354217 GTGGGTTTGCTGATCCCTCAGGG + Intergenic
1182204507 22:28609993-28610015 GTGGCCTTGCTGAGCTGTGGTGG - Intronic
1182748493 22:32623813-32623835 GTGGGGTGGCTGAACTCTGTCGG + Intronic
1182866255 22:33606971-33606993 TTGAGCTTGCTGAGCTCACATGG - Intronic
1183987816 22:41578957-41578979 GTGAGCGTGCTGAGCATTCTAGG + Intronic
1184478766 22:44735542-44735564 GTGGGCAGGCTGAGCCCTGTGGG + Intronic
1184743813 22:46444466-46444488 CTGGGTTTGCTGTGCTCTCACGG - Intronic
1185235696 22:49711631-49711653 GTGGGCCTGCTGGGCTTTTTTGG - Intergenic
950353353 3:12379646-12379668 GTGAGATTGCTGTGTTCTCTAGG + Intronic
950905962 3:16538628-16538650 GTGGTCATGCTGTGCTCTCTGGG - Intergenic
951538808 3:23763458-23763480 ACGGGCCTGCTGAGCTCTGTTGG - Intergenic
953481615 3:43256956-43256978 GTGGCCTTGCTGACCTCTTCAGG - Intergenic
953535438 3:43773675-43773697 GTGGGCTTCCTGGGTTCTCAGGG - Intergenic
954144650 3:48628560-48628582 GAAGGGTTGGTGAGCTCTCTGGG + Intronic
955619638 3:60848823-60848845 GTCAGCTTGATGAGCTTTCTTGG - Intronic
959038111 3:101388148-101388170 GTGGGCTTGCTCAGGTGTCATGG - Intronic
961828088 3:129608972-129608994 GTGGGGTTTAGGAGCTCTCTAGG + Intergenic
962316021 3:134359987-134360009 GAGGGACTGCTGAGCTCTATGGG + Intronic
962829450 3:139127340-139127362 CTGAGCTTGCTGAGATATCTAGG + Intronic
963789269 3:149566730-149566752 GTTGGCTTGCTGTTCTCTCTAGG - Intronic
966410593 3:179642613-179642635 GTGGGCTTTCTGATCCCTGTGGG + Intergenic
967078031 3:186022280-186022302 TTGGGTTCGCTGACCTCTCTAGG - Intergenic
967952549 3:194852312-194852334 AGGTGCCTGCTGAGCTCTCTGGG + Intergenic
968800944 4:2742932-2742954 CTGGGGGTGCTGAGCACTCTGGG + Intronic
968900472 4:3429147-3429169 GTGGGCTTGCTGAGCTCTCTTGG + Intronic
970617311 4:17780563-17780585 GTGGGCTGGCTGACTTCCCTAGG + Intronic
972219312 4:36935839-36935861 CTTGGCTTGCTGAGCTCCATGGG - Intergenic
974161770 4:58149957-58149979 GTGGCCTTGCTGAGCTGCGTTGG - Intergenic
974943842 4:68503343-68503365 GTGGCCTTGCTGAGCTGTGGTGG - Intergenic
975073343 4:70171651-70171673 ATGGTCTTGCTGAGCTCTTTTGG + Intronic
975988677 4:80233527-80233549 GGGGACTTGCTGAGGTCCCTGGG - Intergenic
980953734 4:139407578-139407600 GAGAGCTTGCAAAGCTCTCTGGG + Intronic
981787965 4:148502634-148502656 GTGGCCTTGCTGGGCTCTGGTGG + Intergenic
981859858 4:149341456-149341478 GTTAGCTTGCTGAGCTCCATGGG + Intergenic
983602756 4:169548890-169548912 CTGAGCTTGCTGGGCTCTGTGGG + Intronic
985716723 5:1467152-1467174 GTTGGTTTGCTGAGCTATCACGG - Intronic
985816395 5:2131217-2131239 GTGGGCTTCCTGGGGTCCCTTGG + Intergenic
986099030 5:4588308-4588330 GTGGTCTTGGAGAGCTTTCTGGG - Intergenic
986589500 5:9354065-9354087 TGTGGCATGCTGAGCTCTCTGGG - Intronic
994233545 5:97336311-97336333 CTTGGCTTGCTGGGCTCTGTGGG + Intergenic
995480354 5:112586555-112586577 CTGAGCTTGCTGGGCTCTGTGGG - Intergenic
996017550 5:118557311-118557333 GCAGGATTGCTCAGCTCTCTAGG + Intergenic
996463520 5:123773571-123773593 GTAGGCTTTGTGAGCTATCTAGG + Intergenic
996520054 5:124416150-124416172 ATAGGCTTGCTGAGTTGTCTGGG - Intergenic
997410264 5:133685647-133685669 GTGGGATTCTTGAGCCCTCTTGG + Intergenic
998320954 5:141230692-141230714 TTGGTCTTGCTTATCTCTCTGGG - Intergenic
1001158531 5:169294053-169294075 GTGGTCCAGATGAGCTCTCTGGG + Intronic
1001526717 5:172434338-172434360 GGGGGCTTGCAGAGGTATCTTGG - Intronic
1002696622 5:181096511-181096533 ATGGGCTGGCTGAGCTCACTGGG - Intergenic
1002698000 5:181102862-181102884 ATGGGCTGGCTGAGCTCACTGGG + Intergenic
1002996135 6:2286931-2286953 GTGGCCTTGCTGAGCTGTGGTGG - Intergenic
1004508463 6:16265325-16265347 GAAGGCTCCCTGAGCTCTCTAGG - Intronic
1004808990 6:19238913-19238935 CTTAGCTTGCTGGGCTCTCTGGG - Intergenic
1005463168 6:26087942-26087964 GTGGGTTTGCTCAGCCTTCTCGG - Intronic
1007742999 6:44024136-44024158 CTGGTCTTGCTGACCTCTCTTGG - Intergenic
1012079493 6:94737111-94737133 GTGCCCATGCTGAGCTCTCATGG - Intergenic
1012837310 6:104285933-104285955 GTTGGCTTTCTCACCTCTCTTGG - Intergenic
1015118958 6:129680584-129680606 GGCTGCTTGCTGAGCTTTCTTGG - Intronic
1015123541 6:129727354-129727376 GTGGGGATGCAGAGCTCTCGAGG - Intergenic
1015897343 6:138030002-138030024 GAGGGCTGGCGCAGCTCTCTAGG - Intergenic
1017120329 6:151017974-151017996 GTGGGATTGCTGGGTCCTCTAGG + Intronic
1018999018 6:168731333-168731355 ATGGGCGTGCAGAGATCTCTTGG - Intergenic
1020694035 7:11392601-11392623 CTTAGCTTGCTGAGCTCTGTGGG - Intronic
1021339182 7:19442127-19442149 GTGGGATTTCTGAGCATTCTGGG + Intergenic
1022030026 7:26484097-26484119 GGAGGCTTGCAGAGCCCTCTGGG - Intergenic
1022865770 7:34418179-34418201 GTGGCCTTGCTGAGTTGTCAGGG + Intergenic
1022869141 7:34457620-34457642 GTGGCCTTGCTGAGCTGTGGTGG - Intergenic
1024896854 7:54270430-54270452 GTGGGTTTGCTGGGCTCTGCTGG - Intergenic
1026956675 7:74380729-74380751 GTGTGCTTGCTGGGCTGGCTGGG + Intronic
1027177770 7:75915434-75915456 GAGGGCCTGCCGGGCTCTCTCGG - Intronic
1032199842 7:129812094-129812116 GTGGGATTACTCAGTTCTCTAGG + Intergenic
1032467674 7:132156611-132156633 GGGGGCATGCTGTGCTGTCTTGG + Intronic
1041944343 8:63424606-63424628 GTGGCCTTGCTGAGCTGTCGTGG - Intergenic
1042724618 8:71860344-71860366 GAGGGCTTGCTCAGCTCAGTGGG - Intronic
1044509483 8:93058385-93058407 CTTGGCTTGCTGGGCTCCCTAGG + Intergenic
1045618918 8:103952008-103952030 GTGGCCTTGCTGAGCTGTGGTGG - Intronic
1046067995 8:109218931-109218953 GTTAGCTTGCTGGGCTCTGTGGG + Intergenic
1050391970 9:5153446-5153468 GTGGCCTTGCTGAGCTGGCGTGG - Intronic
1050963323 9:11765781-11765803 CTTGGCTTGCTCAGCTCTGTGGG - Intergenic
1052061558 9:23966573-23966595 GTTAGCTTGTTGAGCTCTGTGGG + Intergenic
1054573176 9:66831555-66831577 GTGGGCTGGGTGGTCTCTCTCGG + Intergenic
1055412894 9:76050851-76050873 CTGGGATTGCTGGACTCTCTTGG - Intronic
1056118651 9:83465233-83465255 GTGGACTTGCTGCGCACTCCTGG - Intronic
1057986322 9:99718198-99718220 GTGGCCTTTCTCAGCTGTCTAGG - Intergenic
1059501346 9:114756739-114756761 GTGGGCAGGCTGGGCTCTCAGGG + Intergenic
1060052146 9:120385178-120385200 GAGGGCTTGCTGACCACACTAGG + Intergenic
1061303577 9:129720198-129720220 AGGGGCTTGCTGAGCACTCGCGG - Intronic
1061621492 9:131814004-131814026 GTGGTCTTGCTGGGGTCCCTCGG - Intergenic
1062510218 9:136901211-136901233 GTGGCCTCGACGAGCTCTCTCGG - Intronic
1186354225 X:8773360-8773382 GTGGCCTTGCTGAGCTGTGGTGG - Intergenic
1187814701 X:23218400-23218422 GTGGGGTTGCTATGCTCTCCAGG + Intergenic
1187887281 X:23901404-23901426 TTGGGCTTGCTGAAATATCTGGG - Intronic
1188473896 X:30569579-30569601 GGGGGCTTGAGGAGCTTTCTAGG + Intronic
1189870786 X:45381082-45381104 ATGAGCTTGCTCAGCTCTCCTGG + Intergenic
1191113918 X:56832319-56832341 GTGGCCTTGCTGAGCTGTGGTGG + Intergenic
1191121644 X:56912545-56912567 TTGGCCTTGCTGAGCTGTGTTGG + Intergenic
1191770534 X:64752601-64752623 CTGGGCTTGATGAGCTTTGTGGG - Intergenic
1192560896 X:72127298-72127320 GTGGGCTTTGGGAGCTTTCTTGG - Intronic
1192786845 X:74344530-74344552 GTGGGCTGGCTGATCTTTCCTGG - Intergenic
1193079336 X:77390423-77390445 CTTAGCTTGCTGGGCTCTCTGGG - Intergenic
1193254007 X:79325398-79325420 GTGGCTTTGCTGAGCTGTGTTGG + Intergenic
1194391187 X:93319840-93319862 GTGGCCTTGCTGAGCTGTGGTGG - Intergenic
1198518983 X:137433596-137433618 CTTAGCTTGCTGGGCTCTCTGGG - Intergenic
1198824483 X:140684992-140685014 GTGGGCTTACATAGCTCTGTGGG - Intergenic
1199171759 X:144741532-144741554 TTGGGGTTGCTTAGATCTCTGGG - Intergenic