ID: 968900499

View in Genome Browser
Species Human (GRCh38)
Location 4:3429361-3429383
Sequence GTGGACTGGCAAGTACGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968900499_968900502 -9 Left 968900499 4:3429361-3429383 CCAGGGCGTACTTGCCAGTCCAC 0: 1
1: 0
2: 0
3: 7
4: 43
Right 968900502 4:3429375-3429397 CCAGTCCACCTGGCGTGTCACGG No data
968900499_968900507 27 Left 968900499 4:3429361-3429383 CCAGGGCGTACTTGCCAGTCCAC 0: 1
1: 0
2: 0
3: 7
4: 43
Right 968900507 4:3429411-3429433 GGCTGTGGAGTCTGACCTCACGG 0: 1
1: 0
2: 5
3: 37
4: 434
968900499_968900505 6 Left 968900499 4:3429361-3429383 CCAGGGCGTACTTGCCAGTCCAC 0: 1
1: 0
2: 0
3: 7
4: 43
Right 968900505 4:3429390-3429412 TGTCACGGCTTTGTCACAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 72
968900499_968900506 12 Left 968900499 4:3429361-3429383 CCAGGGCGTACTTGCCAGTCCAC 0: 1
1: 0
2: 0
3: 7
4: 43
Right 968900506 4:3429396-3429418 GGCTTTGTCACAGCTGGCTGTGG 0: 1
1: 0
2: 4
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968900499 Original CRISPR GTGGACTGGCAAGTACGCCC TGG (reversed) Intronic
917972564 1:180218253-180218275 ATGGATTGGCAAGTGGGCCCTGG + Intergenic
920004918 1:202826068-202826090 GTGGAATGGGAGGTACGCCCTGG + Exonic
923647445 1:235838359-235838381 GTGGACTGTCAAATACTCCATGG + Intronic
1069453256 10:68534191-68534213 TTGGACTGGCAACTTCCCCCAGG - Intergenic
1074888460 10:117714188-117714210 GTTAACAGGCAAGTACACCCAGG - Intergenic
1077320502 11:1938813-1938835 GGGCACTGGCCAGTACGCGCAGG + Intergenic
1084963721 11:72732518-72732540 CTGGGCTGCCAAGGACGCCCGGG + Exonic
1089389197 11:118088527-118088549 GTGGAAGGGCAAGAATGCCCAGG - Intronic
1102451293 12:113043850-113043872 GTGCACTGGCAAGGAGGCACAGG - Intergenic
1103212218 12:119175320-119175342 GTGCACTGCCAAGTGCGCCCTGG + Intergenic
1104644971 12:130490796-130490818 GTGGACTGGCCGGTAAGCCGAGG - Intronic
1113539479 13:111095165-111095187 GTGGACTGGCCAGCACCCCCTGG - Intergenic
1123693162 15:22856132-22856154 CAGGACTGGCAAGTAGGTCCTGG - Intronic
1131137967 15:89952934-89952956 GGGGACTGCCAAGTACAACCTGG + Intergenic
1138965569 16:62080248-62080270 GTGGACTTGCTAGTACCTCCCGG + Intergenic
1141685145 16:85565867-85565889 GAAGACTGGCAAGGACACCCGGG - Intergenic
1143236875 17:5409926-5409948 GTGGAATGGCAAGGAGGCCAAGG + Intronic
1148757414 17:49980847-49980869 GTGGCCTGGCAAGTACCACGTGG - Intergenic
1156351280 18:36303427-36303449 GTGCTCTGGCAAGTCCTCCCAGG + Intronic
1160681387 19:413114-413136 GTGGAGGGGCCAGGACGCCCCGG - Intergenic
1164179620 19:22807424-22807446 GGGGACTGGAAAGGGCGCCCGGG - Intergenic
1168655124 19:58121949-58121971 GTGGACTGTCAGGAATGCCCAGG - Intergenic
930139607 2:47938541-47938563 GAGGACTGGTAAGTACCCCCAGG - Intergenic
934466395 2:94266860-94266882 GTGGACTGAGAAATACGCCAGGG + Intergenic
938205774 2:129421715-129421737 GTGGACTGGCAGGAAGGCACTGG + Intergenic
939927003 2:148187204-148187226 GGGGACTGGCTAGTATGTCCAGG - Intronic
946979061 2:225187186-225187208 GTGAACTGGCAAAAATGCCCTGG - Intergenic
948734930 2:239996590-239996612 GTGGTCTGGGAAGGAAGCCCTGG - Intronic
1174525783 20:51170043-51170065 GTGGATTGGCGAGTACCCTCAGG + Intergenic
1177539630 21:22475367-22475389 CTGGACTGGAAAGTAAGTCCAGG + Intergenic
1183300341 22:37056062-37056084 GTGGCCTGGCAGGTACCCCTGGG + Intronic
960306453 3:116067569-116067591 GTGAACTGGCAAATACCCCCTGG + Intronic
962040258 3:131699843-131699865 TTGGGCTGGCCAGTCCGCCCAGG + Intronic
964334229 3:155637927-155637949 GTGCACTGGCTAGTGCACCCAGG - Intronic
967233862 3:187366414-187366436 GTGGAAGGGCAAATACGCACAGG - Intergenic
968900499 4:3429361-3429383 GTGGACTGGCAAGTACGCCCTGG - Intronic
986032768 5:3909348-3909370 GTGGTCTGGCAAGTGCTTCCAGG - Intergenic
986626796 5:9730304-9730326 GTGAACTGGCAAGTAGGTCCAGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
994028645 5:95114724-95114746 GTGTTCTGGCAAGTACCCCCAGG - Intronic
1018355223 6:163007815-163007837 GTGGACTGGGAAGAACTCTCAGG - Intronic
1021472582 7:21022377-21022399 CTGGACTGGCAAGTACAACATGG + Intergenic
1030689003 7:112513725-112513747 CTGGACTGGCCATTAGGCCCAGG - Intergenic
1034972414 7:155427528-155427550 GTGGACTTGGAAGGACGGCCGGG - Intergenic
1035925849 8:3726726-3726748 CTGGACTGGCAAGTTCCCTCTGG - Intronic
1037991198 8:23322332-23322354 CTGGAGTGGCAAGAAAGCCCTGG + Intronic
1040549783 8:48429158-48429180 GTGGACTGGGAAGCTGGCCCTGG - Intergenic
1049870431 8:144970822-144970844 CTGGACTGTGAAGTACACCCAGG + Intergenic
1056496125 9:87157125-87157147 GGGGACTAGCAAGTACCCTCTGG + Exonic
1061857151 9:133448665-133448687 GTGGCCTGGCAAGCAAGCCTGGG + Exonic
1062195553 9:135271738-135271760 GTTGAATGGCACGCACGCCCGGG + Intergenic