ID: 968901570

View in Genome Browser
Species Human (GRCh38)
Location 4:3434568-3434590
Sequence CGGGACACAGCAGTGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 91, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968901570 Original CRISPR CGGGACACAGCAGTGCTGGA GGG (reversed) Intronic
900482944 1:2908155-2908177 TGGGACACAGCAGGGCGGGGAGG - Intergenic
901000106 1:6144744-6144766 CAGGCCAGAGGAGTGCTGGAGGG + Intronic
901133118 1:6975126-6975148 CGAGTCACACCAGAGCTGGAAGG + Intronic
901148651 1:7085753-7085775 TGGGAGCCAGCAGGGCTGGAGGG - Intronic
903453457 1:23470666-23470688 CAGGCCCCAGCAGTGCAGGAAGG - Intronic
903924338 1:26820891-26820913 AGGGAGACCGCAGAGCTGGAAGG + Intergenic
903982588 1:27200323-27200345 CTGGAGGCAGCAGTGCTGGATGG - Intergenic
903982593 1:27200365-27200387 CTGGAGGCAGCAGTGCTGGGTGG - Intergenic
905263964 1:36738524-36738546 CAGGACAAAGCAAAGCTGGAGGG + Intergenic
905279155 1:36837802-36837824 CAGGACACAGAAGCTCTGGATGG + Intronic
906452280 1:45960658-45960680 CGGGACTCAGCTTTGCTGAAAGG + Intronic
906460501 1:46032415-46032437 AGGGAGACAGCAGGTCTGGATGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908596295 1:65692049-65692071 TGGGTCACACGAGTGCTGGAAGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
910935476 1:92482804-92482826 AGGGACCCGGCAGTGCTGGGGGG - Intronic
912556867 1:110522868-110522890 AGGGATACAGCACTGCTGGGTGG - Intergenic
916360641 1:163963321-163963343 CTGGACCCAGTGGTGCTGGAAGG + Intergenic
916556685 1:165899683-165899705 GGGGTCAGAGCAGTGATGGAGGG + Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917959021 1:180127948-180127970 CTGGGCACAGCTGAGCTGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919541013 1:198845488-198845510 CAGGAGAAAGCAGTGCTGGCTGG + Intergenic
919724317 1:200872422-200872444 CGGGACACAGCAGATCTGGGTGG - Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920208914 1:204314026-204314048 TGGGACACAGCAGCACTGGTGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923338823 1:232991156-232991178 AGGGGGACAGCAGTGCTGTATGG + Intronic
924652258 1:245940138-245940160 CGGGACACAGCACTGGGGGGAGG + Intronic
1062890632 10:1057034-1057056 CGGGACACTGCAGGGCTCAAGGG + Intronic
1062992384 10:1832613-1832635 AGGGACACTGTGGTGCTGGAGGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067552825 10:47247268-47247290 TGGGACACACCTGTCCTGGAAGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069543872 10:69315654-69315676 GGGGACACAGCAGTGCAGCATGG + Intronic
1070036950 10:72735030-72735052 CGGGCCACCGCAGTGCAGGCTGG + Intronic
1070571175 10:77639967-77639989 CGGGACCCAGAAGTGCTGTGGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072795815 10:98353724-98353746 AGGGACACAGAAGCCCTGGAAGG + Intergenic
1073468713 10:103709449-103709471 TGGGACACAGCAAGGATGGAAGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075683777 10:124350072-124350094 CGGGACAGTGCAGGGCTGGAGGG + Intergenic
1075707379 10:124509803-124509825 CGGGAAGCAGCAGGGCTGGGTGG - Intronic
1075943478 10:126411119-126411141 CTGGACACAGCATTCCTGGATGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076671412 10:132122747-132122769 CTGGGCACAGCAGGGCTGCAAGG + Intronic
1078153569 11:8779163-8779185 GGGGACAGAGCAGCTCTGGACGG + Intronic
1078521769 11:12069304-12069326 CGGGACAGAGCAGTGGCTGATGG - Intergenic
1078753979 11:14191235-14191257 CTGGCCACGGCAGTGATGGAAGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083297787 11:61724587-61724609 CCGAACACAGCAGTGCAGGAGGG - Intronic
1083603022 11:63960814-63960836 CAGGCCACCCCAGTGCTGGAGGG + Intergenic
1084442652 11:69183798-69183820 GGCCACAGAGCAGTGCTGGAGGG + Intergenic
1084517557 11:69644833-69644855 TGGGCCACAGCAGAGCTGGGTGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089551280 11:119280663-119280685 GGGGACAGAGAGGTGCTGGAGGG - Intronic
1092671651 12:10868386-10868408 TGGGTGCCAGCAGTGCTGGATGG - Intronic
1092784542 12:12015508-12015530 CAGGACGCAGCAGGGCTGGGAGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1095927345 12:47592116-47592138 CGAGGCACAGCTGTGCTGAAAGG - Intergenic
1096254743 12:50056190-50056212 CGGTACCAGGCAGTGCTGGAGGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1102991592 12:117320102-117320124 CGGGCCACAGCATTGCTCAATGG + Intronic
1103316677 12:120061835-120061857 CCCGACACAGCAGTGCTGGAAGG + Intronic
1103516496 12:121511843-121511865 TGGCACACAGCAGCTCTGGATGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103969094 12:124658567-124658589 CGGGACACAGCAGAGGGTGAGGG + Intergenic
1104867004 12:131961583-131961605 GGGGGCACGGCAGTCCTGGAAGG - Exonic
1104885553 12:132104951-132104973 GGGGGCACGGCAGTCCTGGAAGG - Exonic
1105242448 13:18620258-18620280 CGTGGCAGTGCAGTGCTGGATGG + Intergenic
1108596010 13:51950200-51950222 CAGGTCACATGAGTGCTGGATGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110565356 13:76952211-76952233 CAGGACACAGCATTGCGTGATGG - Intronic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113812829 13:113152965-113152987 AGGGAGACAGCGGGGCTGGATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121184385 14:91953798-91953820 CGAGACAGAGCAATGATGGAAGG - Intergenic
1122557567 14:102589995-102590017 GGGGACACAGCCCTGCTGGATGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124157704 15:27242044-27242066 CGGGACACAGCAGAGCTCTGAGG - Intronic
1124606177 15:31171887-31171909 CGGGAGACTGCAGAGCTAGAGGG - Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128707603 15:69848913-69848935 AGGCACACAACAGTGCTGCATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129876073 15:78976634-78976656 TGGGACAGAGGACTGCTGGAGGG + Intronic
1130398816 15:83530020-83530042 CTGGACCCAGCAGTGCAGCAGGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132295719 15:100732786-100732808 CAGGACACAGCACTGCAGGAGGG + Intergenic
1132865115 16:2089492-2089514 AAGGACACAGCAGTATTGGACGG - Exonic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1138221038 16:55250665-55250687 CTGGTGGCAGCAGTGCTGGAAGG + Intergenic
1138304326 16:55960490-55960512 CTGGACACCTCAGGGCTGGAAGG - Intergenic
1139480818 16:67229723-67229745 AGGGACAGAGCAGGGTTGGAGGG + Intronic
1141443697 16:84045068-84045090 CTGGACACAGCAGGGAAGGAGGG + Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143140470 17:4739489-4739511 CGGGGCACAGCAGGGCCGGGGGG - Exonic
1143447945 17:7019837-7019859 CGGGACAGAGCAGGGCTGGCGGG - Intergenic
1143782992 17:9239276-9239298 CGGGTGAGAGCAGTGCTGGCGGG - Intronic
1144439489 17:15268695-15268717 CTGGACACAGCTGGCCTGGAAGG + Intergenic
1144686290 17:17228301-17228323 TGGGGCAAAGCAGTGCTGGCAGG - Intronic
1146459849 17:33037435-33037457 CCAGCCACAGCAGGGCTGGAGGG - Intronic
1146706129 17:35002008-35002030 CGGGACACAGCAGACCCTGAGGG - Exonic
1147649109 17:42051824-42051846 TGGCACAGAGCAGTGCTGCATGG - Intronic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150613156 17:66749491-66749513 CAGGAGTCAGCAGTCCTGGATGG - Intronic
1150834692 17:68553537-68553559 CAGGTCACAGCACTCCTGGAGGG + Intronic
1151021740 17:70624922-70624944 TGGGCCACAGGAATGCTGGATGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151677399 17:75605728-75605750 TGGGAGACAGAAGGGCTGGACGG + Intergenic
1152581879 17:81169092-81169114 CGGGACAGAGCACAGGTGGAGGG + Intergenic
1152739883 17:82014241-82014263 GGCGACACGGCAGTGCAGGACGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153664207 18:7353740-7353762 AGGGACTCTGCAGTGCTGGGAGG - Intergenic
1155067383 18:22279518-22279540 CAGGACACAGCACTGCTCAATGG + Intergenic
1155231678 18:23780370-23780392 AGAGAGACAGAAGTGCTGGAAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157600657 18:48891152-48891174 CAAGAGACAGCAGAGCTGGAAGG - Intergenic
1157714563 18:49874643-49874665 CTGGACACAGAAGTGAGGGAAGG + Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159384385 18:67704490-67704512 GGTGTCACAGCTGTGCTGGAGGG - Intergenic
1159919176 18:74212423-74212445 CGTGACACAGCCGAGCTGGGAGG + Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160763838 19:798318-798340 CGGGACACGGCCTTTCTGGAGGG - Intronic
1160765832 19:807284-807306 CGGGAGACAGCGCTGCTGCAGGG + Intronic
1160878795 19:1310329-1310351 CGGGAGTCAGCCGTGCTGGCTGG + Intergenic
1161315082 19:3613999-3614021 CGGGAGGCAGCAGCGCTGGGAGG + Intronic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1162158875 19:8697505-8697527 CAGGACCCAGCAGGACTGGAAGG + Exonic
1162454651 19:10776050-10776072 CGAGAACCAGCAGTGCTGGTGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164586401 19:29478788-29478810 AGGGACAGATCAGAGCTGGAGGG + Intergenic
1165797274 19:38526452-38526474 CAGGACTCAGCAGTCCTGGGAGG - Intronic
1165901179 19:39170010-39170032 CGGGAGACAGCAGAGCTTGGAGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168240348 19:55086094-55086116 CGGGACCCAGCGGGGCAGGAGGG + Exonic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925034658 2:676464-676486 AGTGACACAGGAGTTCTGGAGGG - Intronic
925302791 2:2828901-2828923 CTGTAGGCAGCAGTGCTGGAAGG - Intergenic
925642580 2:6000453-6000475 GGGGACACAGAGGTGCTGGGTGG - Intergenic
927640187 2:24841113-24841135 TGGGACACAGCACTGGTTGATGG - Intronic
928189528 2:29150139-29150161 CTGGAGGCAGCAGTGCTGGGTGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929942239 2:46343131-46343153 CCGGTCACAGTAGTGCTGGGAGG - Intronic
930051621 2:47220332-47220354 CTCCCCACAGCAGTGCTGGAGGG + Intergenic
930052578 2:47228133-47228155 CTGGACACTCTAGTGCTGGATGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934527806 2:95062402-95062424 GGGGAGACAGCTGTGTTGGAAGG - Intergenic
934665032 2:96163950-96163972 CGGGGCCCAGCAGTGTTGGAGGG - Intergenic
934747198 2:96767173-96767195 TGGGAGACAGAAGTGCTGCAAGG - Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936508069 2:113123990-113124012 AGGGACACTGCACTGCTGTAAGG - Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937791013 2:125961762-125961784 CAGGACCCACCAGGGCTGGATGG + Intergenic
937971335 2:127551662-127551684 CGGGAGAAGGCAGGGCTGGAAGG + Intronic
938576816 2:132612060-132612082 CAGGGCACTGCAATGCTGGATGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942201349 2:173574559-173574581 CTGGACCCAGCACTGGTGGAGGG - Intergenic
942489103 2:176472128-176472150 CTGGGCACAGGAGTCCTGGAAGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
946044165 2:216807315-216807337 CTGGACACAGGACTGCTGGTGGG + Intergenic
947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG + Intergenic
948261119 2:236605180-236605202 GGGGAGGCAGCAGTGCTGGTGGG - Intergenic
1170607954 20:17887825-17887847 CAGGACAGACCAGAGCTGGAGGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174653683 20:52152166-52152188 CGGGACAGAGCAAAGCTGGATGG + Exonic
1176058443 20:63161137-63161159 CGGGACAGAGCAGCAATGGAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178535985 21:33410963-33410985 TGGGAAACACCAGGGCTGGAAGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1182767251 22:32766414-32766436 CGTGATACAGCAGTTCTGCAAGG + Intronic
1183366630 22:37410459-37410481 CAGGACCCCGGAGTGCTGGAGGG - Intronic
1183437091 22:37802586-37802608 AGGGACACTGCAGAGCTGGGGGG - Intergenic
1184279320 22:43428057-43428079 TGGGACCCAGCAGTGATCGAAGG + Intronic
1184503004 22:44885300-44885322 CTGGCCTCAGCAGTGCAGGAAGG - Intronic
1184745473 22:46453188-46453210 CTGTGCACAGCAGGGCTGGAAGG + Intronic
1185292649 22:50034920-50034942 CGGGACACAGGAGGCCTGCACGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950442587 3:13018689-13018711 GGGGATACAGTAGTTCTGGAGGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953034714 3:39201757-39201779 CTGTACTCAGCAGTGCTGGGGGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
953904024 3:46859242-46859264 GGGGACAGAGCAGGGCAGGAAGG - Intronic
954909737 3:54093864-54093886 CTGGGCACAGCACTGCTGGGAGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956070966 3:65450681-65450703 CTGGACACAGCAGTGACAGAAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960574014 3:119211613-119211635 CGGGAGACAGAAGTAGTGGAGGG + Intergenic
961537338 3:127578040-127578062 GGGGGCACAGCAGTGCTGCTGGG - Intronic
962024179 3:131529604-131529626 AAGGACACATCAGTGCTGGAGGG + Intergenic
962843924 3:139259009-139259031 CAGGGAACAGCAGAGCTGGAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963063219 3:141241681-141241703 CATGGCACAGCAGTGTTGGACGG - Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967954299 3:194865933-194865955 AGGGACACTGCAGTGCTGTGGGG + Intergenic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969543841 4:7811132-7811154 CGGGACACAGCTGCACTGCAGGG + Intronic
970477836 4:16441646-16441668 CAGGACACAGAAGTGAGGGAAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
972940134 4:44185930-44185952 CGGGACAGGGAAGTGCTGGGAGG + Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976998975 4:91471442-91471464 CGTGACCCAGCCGCGCTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980763762 4:137271057-137271079 CAGGATACAGAAGTTCTGGAGGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985037948 4:185860380-185860402 CGTGACAAAGCAGTGCCTGAGGG + Intronic
985646144 5:1085590-1085612 CGGGACGCATCCGTGCTGGACGG + Intronic
985692278 5:1319918-1319940 CCTGGCACAGCAGAGCTGGAGGG + Intronic
986744158 5:10729902-10729924 CAGGACACAGCTGTGCAGGCAGG - Intronic
987054573 5:14179140-14179162 CGGGACACCGACGTGCTGGCCGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990810051 5:59713673-59713695 CTGGTCACAGCTGTGCTGCAAGG + Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991578664 5:68131423-68131445 AGGTACACAGCAGTGCTTGTTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996404071 5:123089741-123089763 CGGGCCCCAGCATTGCTGGATGG + Intronic
997096084 5:130913153-130913175 CTGGACACAGTATTACTGGATGG - Intergenic
997199222 5:131999683-131999705 GGGCACACAGCAGTTCTGTAAGG + Intronic
1000202039 5:159020535-159020557 CTGGACACAGAACTGCAGGAAGG - Intronic
1001677720 5:173532288-173532310 GGAGCCGCAGCAGTGCTGGAGGG - Intergenic
1002254670 5:177950430-177950452 CAGGACAGAGCAGTGAAGGACGG - Intergenic
1002401814 5:178995184-178995206 CGGGAAGCGGCAGGGCTGGAGGG - Intronic
1003182163 6:3801350-3801372 CGGCACACTGCAGGGCTGGCAGG - Intergenic
1003464256 6:6363325-6363347 CTGACCACAGCAGTGCTGGTTGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004513669 6:16303433-16303455 CTGGCCAGAGCAGGGCTGGAGGG - Exonic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011793457 6:90925948-90925970 AAGGACACAGTAATGCTGGAAGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016361590 6:143273463-143273485 GGGGACACAGCAGAGGTGAATGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016858732 6:148697166-148697188 CCGGACACAGCAGGACTGGCAGG - Intergenic
1017237192 6:152129045-152129067 CTGGACAGAGCAGAGCTGAAAGG + Intronic
1017690134 6:156956006-156956028 CAGAACCCAGCAGTCCTGGACGG - Intronic
1017717709 6:157223878-157223900 CGGGACAGACAGGTGCTGGATGG + Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018689420 6:166332982-166333004 CAGGAGACAGCACAGCTGGAAGG + Intronic
1018714429 6:166521015-166521037 CCAGGGACAGCAGTGCTGGAGGG - Intronic
1018726058 6:166614377-166614399 TGGGACACAGCTGTGCTGCCCGG + Intronic
1018926552 6:168210932-168210954 CAGGACCCAGCAACGCTGGAGGG - Intergenic
1019354200 7:570438-570460 GGGGACACAGGAGCGCGGGAGGG - Intronic
1019527112 7:1485372-1485394 GGGGACACAGATGTGCTGCAGGG - Exonic
1020895652 7:13935822-13935844 GGGGACACTGGCGTGCTGGATGG + Exonic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021858139 7:24878182-24878204 GTGGAAACAGCTGTGCTGGAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026618780 7:71932149-71932171 TGGGTCACAGCATTGTTGGAAGG - Intronic
1027231782 7:76276858-76276880 AGGGTCAGAGCAGTGCAGGAAGG - Intronic
1027422997 7:78035237-78035259 CGGGACAAAGCAGAGAGGGAGGG + Intronic
1027431232 7:78114683-78114705 CGGGACCCAGGAGTGCATGAGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028963975 7:96780978-96781000 CTTGAGACAGGAGTGCTGGAAGG - Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032551070 7:132785142-132785164 CTGGAGGCAGCAGTGCTGGATGG - Exonic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042512675 8:69627356-69627378 CCAGACACAGCAGGGCTGGCAGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047198009 8:122739033-122739055 CTGGACAGGGCAGTTCTGGAGGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048545855 8:135386628-135386650 TAGGACACTGCAGTTCTGGAAGG - Intergenic
1049228909 8:141472089-141472111 CAGGAGGCAGAAGTGCTGGAAGG - Intergenic
1049861697 8:144902849-144902871 TGGCACACAGAAGTGCTGGCGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056030411 9:82547522-82547544 CTGGCCACAGCTGGGCTGGATGG + Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056734938 9:89201470-89201492 GGGGACACAACTGTGCTGGTTGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1060347262 9:122828139-122828161 GGGGACACAGCAGCGGCGGAGGG + Intronic
1061728715 9:132596859-132596881 GGGGAGACAGCAGAGCTGCAGGG + Intronic
1061887880 9:133601932-133601954 CAGCACACAGGAGTGCTGCAGGG + Intergenic
1062345760 9:136114341-136114363 CGGGACACTGCTGTGCAGGCCGG - Intergenic
1062527759 9:136985177-136985199 CGGGTCACACCCCTGCTGGAAGG + Exonic
1185791056 X:2928641-2928663 GGGAACACGGCCGTGCTGGAAGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189428452 X:40924800-40924822 TGGTACACAGCAGTGCTGAGGGG - Intergenic
1189884065 X:45522182-45522204 AGGGCCACAGCAATGCTAGATGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191604243 X:63044076-63044098 CTAGAAACAGCAGAGCTGGAAGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199302202 X:146226246-146226268 CGGGTCACAGAAGTACTGGATGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200074729 X:153545257-153545279 CGGCACACAGCAGCCCTGCAAGG - Intronic
1200122035 X:153795603-153795625 CAGGACACAGAAGGGCTGGCGGG + Intronic
1200145888 X:153926400-153926422 CGGGGCACAGTGGGGCTGGAAGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1202019372 Y:20449183-20449205 CTTGGCACAGCAGGGCTGGAGGG - Intergenic