ID: 968901844

View in Genome Browser
Species Human (GRCh38)
Location 4:3435706-3435728
Sequence GGGTGGCTTCTGGTGGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968901844 Original CRISPR GGGTGGCTTCTGGTGGGATC CGG (reversed) Intronic
900621843 1:3591127-3591149 GCGCGGCTGCTGGTGGGGTCGGG - Intronic
900988537 1:6087032-6087054 GGGCGGGCTCTGGGGGGATCTGG - Intronic
901449752 1:9328873-9328895 GGGTGGCGTCTGGTGGGTGGGGG - Intronic
901572617 1:10173947-10173969 TGGTGGCCTCTGGTGGCACCTGG + Intronic
902121581 1:14170405-14170427 ATTTGTCTTCTGGTGGGATCAGG - Intergenic
902990794 1:20186002-20186024 GGGTGGGGTCGGGTGGGGTCGGG - Intergenic
903359336 1:22766996-22767018 GGGAGGCTTCTGTTTGGCTCAGG + Intronic
903540921 1:24095834-24095856 CGGGGATTTCTGGTGGGATCAGG + Intronic
904425270 1:30418827-30418849 GCGAGGCTTCAGCTGGGATCTGG + Intergenic
904473254 1:30748653-30748675 TGGGGGCGTCTGGTGGTATCTGG - Intronic
905028328 1:34865897-34865919 GGGCGCCTTCGCGTGGGATCAGG + Exonic
905996091 1:42381354-42381376 GGGTGGCTTCAGGTGAATTCGGG - Intronic
907903369 1:58762033-58762055 GGGTGGCTTCTGGTAGATACTGG + Intergenic
908445413 1:64195353-64195375 GGCTGGGTTCTGCTGTGATCTGG + Intergenic
908848304 1:68347577-68347599 AGGTGGCTTCCGGTGGCAGCAGG - Intergenic
911983646 1:104596802-104596824 GGGTTGCTTCCAGTGGGATTAGG - Intergenic
912814826 1:112820643-112820665 GGGTTGCTTCTAGCGGGATTAGG + Intergenic
915268154 1:154733317-154733339 GGGGGGCTGCAGGTGGGACCTGG - Intronic
916188578 1:162157105-162157127 GGCTGGCTGGTTGTGGGATCTGG + Intronic
919026915 1:192184007-192184029 GAGTGGCTTCTGGCAAGATCTGG - Intronic
919692235 1:200538306-200538328 GGCTGGGTTCTGGAGGGTTCAGG + Intergenic
920609549 1:207423620-207423642 GGGTGGCTACCGGTGGGGGCGGG + Intergenic
921055820 1:211541705-211541727 GGGTTGCTTCTGGTGGGAGATGG - Intergenic
922332223 1:224587342-224587364 GGGTTGCTTCTGGTCTCATCTGG - Intronic
1062861990 10:817274-817296 CGGTAGCTTCTGGTGAGGTCTGG - Intronic
1062944260 10:1448833-1448855 CGGTGGCTTCTGGGGGGGTATGG - Intronic
1063377417 10:5562334-5562356 GCATGGCTGCTGGTGGGACCTGG - Intergenic
1063623342 10:7667581-7667603 GGGTGGCTGTAGGTGGGGTCTGG - Intergenic
1065266652 10:23983528-23983550 GGGTGAGTTCTCGTGAGATCTGG - Intronic
1065881213 10:30039234-30039256 GGGTGGCTTCCTGTAGGACCTGG - Intronic
1065942305 10:30575814-30575836 GGGGAGCTTCTGGTTGGATAAGG + Intergenic
1066484013 10:35826307-35826329 GGGTGAGTTCTTGTGAGATCTGG - Intergenic
1067174484 10:43933958-43933980 AGGTGGCTCCTTGTGGGATGGGG - Intergenic
1070550926 10:77490072-77490094 GGGTGGGTGCTGCTGGCATCCGG - Intronic
1071571617 10:86700388-86700410 GGGTGCCTTCTGATGGGGTGGGG - Intronic
1072150753 10:92680875-92680897 GGGTGACTGCTGGTGGGTACAGG - Intergenic
1072608427 10:97001756-97001778 AGATGGCTTCTGCTGGAATCCGG - Intronic
1072884960 10:99264872-99264894 GGGTTGCTTCTAGTGGGATTAGG - Intergenic
1073440719 10:103551088-103551110 GCCTGGCTTCTGCTGGGATCTGG + Intronic
1073778254 10:106809601-106809623 AGGTGACATCTGGTGGTATCTGG + Intronic
1074399020 10:113126597-113126619 GGGTGGGTTGTTGTGGAATCGGG + Intronic
1074504790 10:114060063-114060085 GTGAGACTTCAGGTGGGATCCGG - Intergenic
1075092851 10:119453205-119453227 GGGTGGTTTCTGTTCAGATCTGG - Exonic
1076280938 10:129245071-129245093 GGGCGGCTTCTGGTGTGCCCTGG - Intergenic
1076283899 10:129275075-129275097 GGGTGGGCTCTGGTGGGAGCTGG - Intergenic
1077316883 11:1923346-1923368 TGGTGGCTTTTGGGGGGCTCGGG - Intronic
1077477215 11:2796213-2796235 TGCTGGCTTCTGGTGGGACATGG - Intronic
1080203809 11:29706218-29706240 GGGTTGCTTCGAGTGGGATTAGG + Intergenic
1082160296 11:48882551-48882573 GGGGGGGTTCTGGTGGGACTGGG + Intergenic
1082162070 11:48897855-48897877 GGGGGGGTTCTGGTGGGACTGGG - Intergenic
1082235892 11:49820350-49820372 GGGGGGGTTCTGGTGGGACTGGG + Intergenic
1082242792 11:49889446-49889468 GGGGGGTTTCTGGTGGGACTGGG - Intergenic
1083528830 11:63397987-63398009 TGCTGGCTTCAGGTGGGACCTGG - Intronic
1083823793 11:65187062-65187084 GGGTGTCTATAGGTGGGATCGGG + Intronic
1084604689 11:70165628-70165650 GGGTGGCTCCTGCGGGGGTCTGG + Intronic
1084965859 11:72744126-72744148 TGGTGACATCTGGTGTGATCAGG - Intronic
1085128614 11:74018910-74018932 GGGTGGCATCAGGTGGGGTGTGG - Intronic
1085682929 11:78595053-78595075 GGGTGGCTGCTGATTGGCTCAGG - Intergenic
1088750692 11:112839877-112839899 GGGGGGCTGCTGGGGGGAGCTGG + Intergenic
1089350042 11:117816978-117817000 GGAGGGCTTCTGCTGGGTTCTGG - Intronic
1090207773 11:124895427-124895449 TGTTGGCTTCTGAAGGGATCAGG + Intronic
1090912330 11:131132179-131132201 GGGTGGCTTCAGATGGGAGCAGG - Intergenic
1091591551 12:1845734-1845756 GGCTGGGTTCTGGGGGAATCAGG - Intronic
1092767882 12:11869706-11869728 GGATGGCTTCGGGTGGGACTCGG - Exonic
1093239046 12:16646256-16646278 TTGTAGATTCTGGTGGGATCTGG + Intergenic
1095634876 12:44421306-44421328 GGGTGGCTTGTGTTGGGGACTGG - Intergenic
1096242349 12:49966187-49966209 ATGTGGCTTCTGGGGGGGTCGGG - Intergenic
1096536991 12:52281200-52281222 GGGTGGCTTCTGAAGGGAGGAGG + Intronic
1096842049 12:54385640-54385662 GGGTGGTGTCTGGAGGGAACAGG - Intronic
1096867523 12:54573708-54573730 AGGTGGCATCTGGTGGGGTGTGG + Exonic
1099141038 12:78975507-78975529 AAGTGGGTTCTGGTGGGAGCTGG + Intronic
1102029420 12:109731420-109731442 GATTTGCTCCTGGTGGGATCTGG - Intronic
1102183959 12:110933460-110933482 GGGTGGCATCTGGTGGGTAGAGG - Intergenic
1102784795 12:115595679-115595701 GGGAGGGTTCAGGGGGGATCTGG + Intergenic
1103979441 12:124726937-124726959 GGGTGGGTTCTGGTGGGGGAGGG - Intergenic
1104934227 12:132355966-132355988 GGGTGGGGACTGGTGGGCTCAGG - Intergenic
1105711251 13:23011499-23011521 CTGAGGCTTCTCGTGGGATCAGG - Intergenic
1107538660 13:41362965-41362987 GGGTGGCTTTTGATGGGGACTGG + Intronic
1109620644 13:64900537-64900559 GAGTGACTTCTTGTGAGATCTGG + Intergenic
1109681095 13:65754330-65754352 GGATGGCTTTTAGTGGGCTCTGG + Intergenic
1111229375 13:85322599-85322621 GGGTGGATTCTGGTAAAATCTGG - Intergenic
1112567620 13:100564841-100564863 GCCTGGCTTCTGCTGGGTTCAGG - Intronic
1114092560 14:19302531-19302553 GGCGGGCTTCGGGTGGGAGCCGG + Intergenic
1114585999 14:23814373-23814395 GGGTGGAGTCTGGTGGACTCTGG - Intergenic
1114646763 14:24260337-24260359 GGCTGGCTTCTCCTGGGGTCAGG + Intronic
1114686986 14:24542610-24542632 GAGTGAGTTCTTGTGGGATCTGG + Intergenic
1114688889 14:24562066-24562088 AGGTGGCACCTGGTGGGACCTGG + Intergenic
1118898794 14:69969501-69969523 GGGTGAGTTCTTGTGAGATCTGG - Intronic
1120531479 14:85637644-85637666 GGGTGCCTTCTCATGTGATCAGG + Exonic
1121517220 14:94560795-94560817 GGGTGGCATGGGGTGGGACCAGG - Intergenic
1122112047 14:99509984-99510006 GGGAGACATCTGGTGGCATCAGG + Exonic
1122396647 14:101437578-101437600 TGGTGGGTTCCGGTGGGCTCTGG + Intergenic
1122396651 14:101437588-101437610 CGGTGGGCTCTGGTGGGCTCCGG + Intergenic
1122878335 14:104678959-104678981 GGGAGGCTTCAGCTGGGGTCTGG - Intergenic
1123027637 14:105435047-105435069 GGGCTGCTTCTGCTGAGATCAGG - Intronic
1202837486 14_GL000009v2_random:89230-89252 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1126163678 15:45635630-45635652 AGGGGTCTTCTGGTGGAATCTGG + Intronic
1127302998 15:57675911-57675933 GGGTGGATTCTTGTGTGAACAGG + Intronic
1128462877 15:67884633-67884655 GGGTGCCTTCTGGCGGGGGCGGG - Intergenic
1128956756 15:71955080-71955102 TGATTACTTCTGGTGGGATCAGG - Intronic
1129615854 15:77098315-77098337 GGGTGGGCTCTGGTGGGCTCTGG + Intergenic
1129771761 15:78207284-78207306 GGGTGGCTTTGGCAGGGATCTGG - Intronic
1130843838 15:87725977-87725999 GGGTGGGTGCAGGTGGGAACAGG - Intergenic
1132150459 15:99454867-99454889 GGCTCGCTTCTGGTGGGTCCTGG - Intergenic
1132702963 16:1229812-1229834 GGGTGGGTTCTGGGGAGGTCGGG - Intronic
1132705360 16:1241056-1241078 GGGTGGGTTCTGGGGAGGTCGGG + Intronic
1132864114 16:2085265-2085287 GGGTGTCGTATGATGGGATCTGG - Exonic
1134579027 16:15356262-15356284 GGGTGGATTCTGGAGGGAGGTGG + Intergenic
1134723559 16:16401288-16401310 GGGTGGATTCTGGAGGGAGGTGG - Intergenic
1134943870 16:18310582-18310604 GGGTGGATTCTGGAGGGAGGTGG + Intergenic
1135025364 16:18995357-18995379 GGGAGGCTTCTGAGGTGATCAGG + Intronic
1135080496 16:19430504-19430526 GGCTGGCTTTTGATGGGAGCTGG - Exonic
1136154936 16:28376201-28376223 GGGTGGATTCTGGAGGGAGGTGG + Intergenic
1136208155 16:28739057-28739079 GGGTGGATTCTGGAGGGAGGTGG - Intergenic
1136264239 16:29105690-29105712 GGGTGGATTCTGGAGGGAGGTGG - Intergenic
1136505369 16:30699231-30699253 TGTTGGCTTCTGGTGAGCTCGGG + Exonic
1136535907 16:30899401-30899423 GGGGGTCTTCTGGTGGGAAAGGG - Exonic
1140211709 16:72975714-72975736 GGGTGGCTTCTGGAAGGTTAAGG - Intronic
1141253335 16:82378841-82378863 GGATGGCTTGTGGTGTGATGGGG - Intergenic
1141445224 16:84053534-84053556 GGGTGACTGCTGGTGGGAGTGGG + Intergenic
1141671477 16:85494264-85494286 TGGTGGCTTCTGGTGGCTCCTGG + Intergenic
1142098830 16:88260837-88260859 GGGCGGCGTCTGATGGCATCAGG + Intergenic
1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG + Intronic
1142771344 17:2099359-2099381 GCGTGGCTTCTTCTGGTATCTGG - Intronic
1144825283 17:18102258-18102280 GGGTGACGTCTTGTGGGCTCTGG + Intronic
1145115880 17:20210644-20210666 GGGTGGCTTTTGGTGGGGGATGG + Intronic
1145278674 17:21453136-21453158 GGGTGGCTTCGGGAGGGACTGGG + Intergenic
1145908743 17:28530681-28530703 GGGGGGCTTGGGGTGGGCTCAGG + Intronic
1146456349 17:33012613-33012635 GTGTGGCTTCTGGGGGGACAAGG + Intergenic
1146937167 17:36819102-36819124 GGGTGACTTCTGGTCTGATAGGG + Intergenic
1147673384 17:42189660-42189682 AGGTGGCCTCTGGGGGGAGCTGG + Exonic
1148147135 17:45373144-45373166 GGGTGGCTTGGGGTGGGCTGAGG - Intergenic
1149458991 17:56811983-56812005 GGGTGGCCTGGGGTGGGACCTGG - Intronic
1149469974 17:56908605-56908627 GGATGGCTTCTGGTGGGGCTGGG - Intronic
1150441670 17:65196644-65196666 CCCTGGCTTCTGGTGGGAGCCGG - Intronic
1151452864 17:74209926-74209948 TAGTGGCTTCTGATGGGAACAGG + Exonic
1151624844 17:75270394-75270416 GCTTGGCTTCTGGTGGGGACTGG + Intronic
1151681218 17:75623880-75623902 GGGTGGCTTCTGGGGGCAGCTGG + Intergenic
1151931955 17:77238052-77238074 GGGTGGGTGCTAGTGGCATCTGG - Intergenic
1152213367 17:79017115-79017137 GGGTGAGTTCTCGTGAGATCTGG - Intergenic
1156147576 18:34204034-34204056 GGGTGGCTTCAGGTGAGGCCAGG - Intronic
1156511875 18:37643867-37643889 GGTTGCCTCCTGGTGGGACCGGG + Intergenic
1157130618 18:45003984-45004006 TGGGGGCTTCTGCTGGCATCTGG + Intronic
1157638217 18:49183982-49184004 GGGTGGGGTCTAGTGGGGTCTGG - Intronic
1158490520 18:57905957-57905979 GGGTGGCTTATGGTGGAAGAAGG + Intergenic
1158840752 18:61383955-61383977 GGGAGGCTTCTTCTGAGATCTGG - Intronic
1158918628 18:62164540-62164562 GAGTGGGTTCTCGTGAGATCTGG - Intronic
1159318222 18:66809458-66809480 GGGTCTCTTCTGGTGAAATCAGG + Intergenic
1160070716 18:75625488-75625510 GGGTGGTTTGGGGTGGAATCAGG - Intergenic
1160298420 18:77657957-77657979 CGGGGGCTTGTGGTGGGCTCTGG + Intergenic
1160583669 18:79901283-79901305 GGGTGGTCTCTGGTGGGCCCTGG - Intergenic
1161269664 19:3382856-3382878 GGGTGGCTGCTGATGGGATGTGG + Intronic
1161310820 19:3593083-3593105 GGCTGGCTTCTGGGGGGTTGAGG - Exonic
1161327506 19:3670766-3670788 GGGTGGGCCCTGGAGGGATCTGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161767110 19:6213954-6213976 GGGTGGCTTCTGGGGGGGTGGGG + Exonic
1163361307 19:16847883-16847905 GGGTGGCTGCTGATGGGGACTGG - Intronic
1163856887 19:19709552-19709574 TGGTGGGCTCTGGTGGGTTCTGG + Intergenic
1164590097 19:29502011-29502033 GGGGGGCATCTGGTGGGGTCGGG - Intergenic
1165303011 19:34984056-34984078 GGGTGGCATCTGGTTGGCTTCGG - Intergenic
1166133744 19:40763008-40763030 GCATGGCCCCTGGTGGGATCTGG - Exonic
1166519760 19:43472590-43472612 GGTGGGCATCTGGTGGGATGGGG - Intergenic
1166824590 19:45601103-45601125 GGGGGGCTGATGGTGGGCTCTGG + Intronic
1167400034 19:49259514-49259536 GAATGGCTTCTTGTGAGATCTGG + Intergenic
1202635156 1_KI270706v1_random:38121-38143 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1202650062 1_KI270706v1_random:171984-172006 GAGTGACTTCTCGTGAGATCTGG + Intergenic
925077428 2:1029020-1029042 GTGTGGCTTCAGGCAGGATCGGG + Intronic
928778805 2:34795517-34795539 GGGTTGCTTCTAGTGGGATTAGG - Intergenic
931707438 2:64958783-64958805 GGGTGGCTTCAGCTTGGCTCAGG + Intergenic
931865768 2:66409576-66409598 GGGAGGCTTGTGCTGGGAGCAGG - Intergenic
932447073 2:71787620-71787642 GAGTGGCTGCTGGTGGGGACAGG + Intergenic
932886049 2:75550092-75550114 GGATGGCTTCTGGGAGGCTCTGG + Intronic
933379453 2:81524317-81524339 GGGTGGCTGCAGGTGAGGTCTGG - Intergenic
933488202 2:82949970-82949992 GGGTGGCTCGAGGTGGCATCTGG - Intergenic
934881627 2:97986591-97986613 GGGTGGCTTCTGTTGAGTTATGG - Intronic
936170060 2:110162861-110162883 GGCTGGCCTCTGATAGGATCAGG + Intronic
936460263 2:112709154-112709176 GGGCGGCTCCTGGGGGGTTCTGG - Intergenic
938538409 2:132265298-132265320 GGGTGGGTTCGGGTGGGGTGGGG - Intergenic
938540539 2:132280729-132280751 TGGTGGCATCTGGTGAGCTCTGG - Intergenic
939990482 2:148873862-148873884 GGGCATCTTCTGGTGGGCTCAGG + Intergenic
940726908 2:157344874-157344896 GGGCTGCTTCAGGTGGGATTAGG - Intergenic
946031948 2:216712443-216712465 GGGTGGATTCCGATAGGATCAGG - Intergenic
946598441 2:221332641-221332663 AGGTGGCTTTTGGTTGGAGCAGG - Intergenic
946640988 2:221783308-221783330 GAGTGACTTCTGGTGACATCTGG - Intergenic
947834345 2:233164490-233164512 GGGGAACTACTGGTGGGATCAGG - Intronic
948431539 2:237922220-237922242 GGGTGGCATCTGTTGGCCTCAGG - Intergenic
948604328 2:239125264-239125286 GAGTGGGTTCTGGTGAGGTCTGG + Intronic
948951967 2:241258921-241258943 GGGTGGCTGCATGTGGAATCGGG - Intronic
948975638 2:241461833-241461855 GGGTGGCTCTTGGAGGGTTCAGG + Intronic
1169331000 20:4716461-4716483 TGGTGGCTGCAGGTGGGATCTGG - Intergenic
1170680389 20:18520826-18520848 AGGTGGCTTCTGAGGCGATCAGG + Intronic
1171754850 20:29095887-29095909 GGATGGCTACTGGTGAGCTCTGG - Intergenic
1171869461 20:30513733-30513755 TGGTGGCATCTGGTGAGCTCTGG - Intergenic
1172160762 20:32866520-32866542 GGAAGGCTTCTGGGGGGATTTGG + Intronic
1172334988 20:34108186-34108208 GGCTGTCTTCTGGTGATATCAGG - Intronic
1173102408 20:40099058-40099080 GGGTGAGTTGTGGTGAGATCTGG - Intergenic
1173852688 20:46228734-46228756 GGGTGCCTGCTGGTGGGGCCAGG + Intronic
1174089564 20:48036240-48036262 GGCTGGCTACTGGTGGGAAGAGG - Intergenic
1175479201 20:59299925-59299947 GGGTGGCTTCAGGTGAGAGTCGG - Intergenic
1176601751 21:8800567-8800589 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1176647370 21:9363885-9363907 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1178304818 21:31482600-31482622 TGATGGCTTCTGGTGGGAGGTGG + Intronic
1178465112 21:32840885-32840907 GAGTGAGTTCTGGTGAGATCTGG + Intergenic
1178505852 21:33162528-33162550 TGATGGCTTCTGGTGGGATTCGG - Intergenic
1179398928 21:41066317-41066339 GGCTGCCTTCTTATGGGATCTGG - Intergenic
1180344037 22:11692118-11692140 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1180365549 22:11935106-11935128 GAGTGGCTTCTCGTGAGATCTGG + Intergenic
1180488169 22:15820035-15820057 GGCGGGCTTCGGGTGGGAGCCGG - Intergenic
1181160669 22:20957811-20957833 GGGTGGCGTGTGGTGGGGTTGGG + Intergenic
1181168141 22:20994147-20994169 GCGTGGCTGCTGGTGGGGCCCGG + Exonic
1181510027 22:23384989-23385011 GGGTGTATTCTGGTGGGATGGGG - Intergenic
1181540778 22:23572190-23572212 GAGTGGGTTCTCGTGGGATCTGG - Intergenic
1182141126 22:27959372-27959394 GTCTGGCTGCTGGTGGGAACAGG + Intergenic
1182764744 22:32750710-32750732 GGTTGGATTCTGGAGGGATCTGG + Intronic
1183750343 22:39716452-39716474 GCTTGGCATCTGGTAGGATCAGG - Intergenic
1184457705 22:44620948-44620970 GGGAGGCTCCTGGTGGGGTCAGG - Intergenic
1185194398 22:49459846-49459868 GGGTGACTTCTGATTGAATCAGG + Intronic
1185321227 22:50201007-50201029 GGCTGGCTTCCGGCGGGAGCGGG + Exonic
949509839 3:4758352-4758374 GGGTGGAGCCTGGTGGGAGCGGG - Intronic
950081045 3:10222358-10222380 GGTTGGCATCTGTGGGGATCAGG + Intronic
950479430 3:13235426-13235448 GGGAGGTTTCTGGAGAGATCTGG - Intergenic
950509225 3:13415793-13415815 AGCTGGCTTCTGCTGGGCTCAGG - Intronic
952852576 3:37741185-37741207 GGGTGGCTGGTGCTGGGAGCCGG - Intronic
953018693 3:39100428-39100450 AGGTGGCTTCTTGTGGTAGCTGG + Exonic
954265429 3:49467592-49467614 GGTTGGGTTCTGGTGGGAGGTGG + Intergenic
954303413 3:49713366-49713388 GGGTGGCATCTGGGGACATCGGG - Intronic
954458464 3:50612403-50612425 GGGTGGCATGGGGTGAGATCTGG + Intronic
955323594 3:57992575-57992597 GGGCTGATTCTGGTGGGAGCTGG + Intergenic
956087145 3:65623926-65623948 GGGTGGCTTCATGTGGCATGTGG - Intronic
960945404 3:122962936-122962958 GGGTGGCTACAGGTCCGATCTGG + Intronic
962280582 3:134048911-134048933 GGGTGCCTCCTGGTGGGGGCGGG - Intronic
962716228 3:138128507-138128529 GAGTGGGTTCTCGTGAGATCTGG - Intronic
964210898 3:154226863-154226885 TGATGGCATATGGTGGGATCAGG + Intronic
965371232 3:167864331-167864353 GGCTGGCTCCTGGTGGGCTTTGG + Intergenic
965861471 3:173155742-173155764 GGGCTGCTTCAAGTGGGATCAGG + Intergenic
966766989 3:183472340-183472362 GAGTGGGTTCTCGTGAGATCTGG + Intergenic
967088687 3:186116590-186116612 AGGCGGCTTTTGGTGGGATGAGG - Intronic
967414494 3:189201365-189201387 GTGTGACTTCTGGAGGTATCAGG + Intronic
967868900 3:194213243-194213265 GGGTGGAGTCTGTTGGGTTCTGG + Intergenic
968870917 4:3241810-3241832 GGGAGGCCTCTGTTGGGAGCTGG - Exonic
968901844 4:3435706-3435728 GGGTGGCTTCTGGTGGGATCCGG - Intronic
968978784 4:3835610-3835632 TGGTGGCTCCTGGTGGGGCCAGG - Intergenic
969373198 4:6747112-6747134 GGGTGGCTACTGCTGGGAGCAGG + Intergenic
969443554 4:7231856-7231878 GTGTGGCATCTGGGGGGATTGGG + Intronic
969487701 4:7481460-7481482 GGGTGGCATCTGGGGAGATCTGG + Intronic
971522080 4:27566693-27566715 AGGAGGCTTCTGGTGGAAACTGG + Intergenic
971553370 4:27980832-27980854 GGGCTGCTTCAGGTGGGATTAGG - Intergenic
973027743 4:45293630-45293652 GGGTGGGCTCTGGTGGGTTCCGG - Intergenic
973365078 4:49202374-49202396 GAGTGACTTCTCGTGAGATCTGG - Intergenic
975152544 4:71036703-71036725 GGGCTGCTTCTAGCGGGATCAGG - Intergenic
975434129 4:74331467-74331489 GAGTGAATTCTCGTGGGATCTGG - Intergenic
976619559 4:87114567-87114589 GGGGGGCTTCGGGTGGGGCCCGG - Exonic
977514017 4:97997447-97997469 GGGTGAGTTCTCGTGAGATCTGG - Intronic
979895538 4:126151463-126151485 GAGTGGTTTCTGGAGGGATGAGG - Intergenic
982067900 4:151670966-151670988 GGGTGGCTGCTGGTCGGCTGTGG + Exonic
982216975 4:153091045-153091067 TGGAGGCTTCCGGTGGGTTCTGG - Intergenic
982537974 4:156630055-156630077 GGGTGGATTCTGGTGGCTGCAGG - Intergenic
983815893 4:172126777-172126799 GGGTACCTTCTGGTGGGGGCTGG - Intronic
984028223 4:174570662-174570684 GAGTGAGTTCTGGTGAGATCCGG + Intergenic
985576873 5:677663-677685 GGGTGGGTTCTGTGGGGAGCGGG - Intronic
987173554 5:15284150-15284172 CATTGGCTTCTGGTGGCATCAGG - Intergenic
991488925 5:67165044-67165066 GGGAAGCTTCAGGTGGGAGCGGG - Exonic
992297195 5:75337276-75337298 CGGTGGCCTCTAGTGAGATCTGG + Exonic
992334242 5:75749016-75749038 GAGTGACTTCTTGTGAGATCTGG + Intergenic
996120898 5:119670973-119670995 GGGTGGGGTCTGGTGGGAGGTGG + Intergenic
997233507 5:132259538-132259560 GGTTGGGTTTGGGTGGGATCTGG + Intronic
999843365 5:155452575-155452597 GGGTGGGGTCTGGGGGGATTTGG - Intergenic
1001398470 5:171433097-171433119 GGGTGGCCTCTGGTGGCCTCTGG - Intronic
1003008125 6:2400607-2400629 GAGTGAGTTCTGGTGAGATCTGG - Intergenic
1003168826 6:3704306-3704328 GGGTGAGTTCTTGTGAGATCTGG + Intergenic
1003418945 6:5938541-5938563 GGGTGGGGTTTGGTGGGGTCGGG + Intergenic
1003647033 6:7921176-7921198 AGGTGGCTAATGGTGGGAGCTGG + Intronic
1005694090 6:28335465-28335487 CGGTGGGTTCTGGTAGGTTCCGG + Intronic
1006444204 6:34069773-34069795 GGGTGGATCCTGGTGGGGACTGG - Intronic
1007092658 6:39193789-39193811 GAGTGGGTGCTGGTGGGCTCAGG + Intronic
1007534890 6:42577818-42577840 GGGTGGCTTATGCTGCCATCAGG + Intronic
1008617369 6:53239658-53239680 GGGAGGCTTCTGGAGGCAGCTGG + Intergenic
1008683884 6:53903223-53903245 GGATGGCATCTGATGGGCTCTGG + Intronic
1011557346 6:88584974-88584996 GGGTTGCTTTTGGGGCGATCAGG - Intergenic
1015985879 6:138883580-138883602 GGGAGGCCTCTGGAGGGCTCCGG + Intronic
1016464080 6:144308674-144308696 GGGTGGCCTTGGGTGGGTTCTGG - Intronic
1017165556 6:151405094-151405116 GGGTGGCTTGAGATGAGATCAGG - Exonic
1017633606 6:156422827-156422849 AGGTGGCTCTTGGTGGGATGGGG + Intergenic
1017801211 6:157897929-157897951 AGGTGACTCCTGGTGGGATGGGG - Intronic
1018488086 6:164262788-164262810 TAGTTGCTTCTGATGGGATCTGG + Intergenic
1018972372 6:168538239-168538261 GGGTGGCCCCTGCTGGAATCTGG + Intronic
1019660193 7:2219809-2219831 GGGTGGCTTGTGGCAGGCTCTGG - Intronic
1019739465 7:2665531-2665553 GGGCGGCTTCTGGCGGGCTCAGG + Intergenic
1019826287 7:3287064-3287086 GCGTGACTTCTCGTGAGATCTGG + Intergenic
1020388129 7:7630282-7630304 GGGTGGATGGTGGAGGGATCAGG + Intergenic
1021661072 7:22918421-22918443 GGGCTGCTTCTAGTGGGATTAGG - Intergenic
1024513131 7:50218806-50218828 GGGTGACTCCTGGTGGAAACAGG + Intergenic
1024632794 7:51263128-51263150 GGGTGGCTTCCGGTGAGCTGGGG - Intronic
1025025793 7:55515151-55515173 GGGTGGCCTCTGGGGGGCTGAGG + Intronic
1025939960 7:66068724-66068746 GAGTGAGTTCTCGTGGGATCTGG - Intergenic
1026292187 7:69017814-69017836 GAGTGAGTTCTGGTGAGATCTGG - Intergenic
1026470779 7:70693179-70693201 GGGTGCGTTCTGGTGGGAGTGGG + Intronic
1031361155 7:120850272-120850294 GGGTCTCTTCTGGTCAGATCAGG - Intronic
1033306873 7:140231413-140231435 GGCTGGCTACTGCTGGGATGAGG - Intergenic
1033459273 7:141530648-141530670 CAGTGGCTTGTGATGGGATCTGG - Intergenic
1034435924 7:151062738-151062760 GGGCTGCTTCTGGTGGGAGTGGG + Intronic
1035946428 8:3968342-3968364 GGTTGGATTCTTGTAGGATCAGG - Intronic
1038420254 8:27430005-27430027 AGGGGGCTTCTGGTGGCATGAGG + Intronic
1040102123 8:43514968-43514990 GAGTGACTTCTTGTGAGATCTGG + Intergenic
1040877237 8:52166492-52166514 TGGTGGTTTCTGATGGGATGGGG - Intronic
1040988759 8:53326395-53326417 GGGTGGCATCTGGAGAGACCAGG + Intergenic
1041628483 8:60058569-60058591 GGGTAGCTTCTGGAGGGACCAGG - Intergenic
1044517173 8:93153294-93153316 GGGTGACTTGGGGTGGGGTCTGG - Intronic
1045047734 8:98294825-98294847 GGTTTGCTTCAGATGGGATCAGG + Intergenic
1046744491 8:117862441-117862463 GGGTGGAGACTGGTGGGATTAGG + Intronic
1047128890 8:121995819-121995841 GGGTGAGTTCTTGTGTGATCTGG - Intergenic
1049774698 8:144398914-144398936 GGGCGCCTCCTGGTGGGACCTGG - Intronic
1049885274 9:22276-22298 GTGTGGCTTCTGGAGGAAGCGGG + Intergenic
1053280406 9:36816754-36816776 GGGAGCCTTCTGGTGGTTTCAGG + Intergenic
1053610613 9:39709710-39709732 GGGTGCCTTCTCATGAGATCTGG - Intergenic
1053662595 9:40294473-40294495 GAGTGACTTCTCGTGAGATCTGG + Intronic
1053868648 9:42467732-42467754 GGGTGCCTTCTCATGAGATCTGG - Intergenic
1053913044 9:42924648-42924670 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054242910 9:62632685-62632707 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054374725 9:64440698-64440720 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1054522016 9:66081811-66081833 GAGTGACTTCTCGTGAGATCTGG - Intergenic
1054557034 9:66667203-66667225 GGGTGCCTTCTCATGAGATCTGG + Intergenic
1054928633 9:70613809-70613831 TGGTGGCTTCTTGAAGGATCAGG + Intronic
1055835978 9:80442434-80442456 GGGAGACGTCTGGTGGGATCGGG + Intergenic
1056323931 9:85461124-85461146 AGGGGGCTTCTGGGGCGATCGGG - Intergenic
1056628321 9:88272660-88272682 GGGGCGCTTCTGGTGAGAGCAGG - Intergenic
1056663118 9:88559163-88559185 AGGTGGCCTCTGGAGGGATGGGG + Intronic
1057036999 9:91818457-91818479 GGCTGGCTACTGGTGGGGTGGGG - Intronic
1202803617 9_KI270720v1_random:27039-27061 GGATGGCTCCTGGTGAGCTCTGG + Intergenic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203708155 Un_KI270742v1:71059-71081 GAGTGACTTCTCGTGAGATCTGG + Intergenic
1186147066 X:6635611-6635633 GAGTGGCTTCCAGTGAGATCTGG - Intergenic
1186336197 X:8591459-8591481 GATTGGCTTCTGGTGAGTTCAGG - Intronic
1186487727 X:9946445-9946467 GGGCGGCTTCTGGGGGCCTCAGG + Intronic
1186603014 X:11058570-11058592 GAGTGACTTCTTGTGAGATCTGG - Intergenic
1186679914 X:11862050-11862072 GAGTGGGTTCTTGTGAGATCTGG - Intergenic
1187475062 X:19603296-19603318 ACGTGGCTTCTGGTGGAACCCGG + Intronic
1188771283 X:34157666-34157688 GGCAGGGTTCTGGTGGGCTCAGG + Intergenic
1190153977 X:47972957-47972979 TAGTGACTTCTGGTGAGATCTGG - Intronic
1190414373 X:50166890-50166912 GGATGGCTTGTGGTGGGAATGGG - Intergenic
1190805178 X:53828588-53828610 GAGTGGGTTCTTGTGAGATCTGG - Intergenic
1192100670 X:68261179-68261201 TTGTGGTTTCTGGTGGGACCAGG - Intronic
1194313380 X:92341636-92341658 GTGTGGCTTCTTATGAGATCTGG - Intronic
1196785542 X:119418738-119418760 GAATGGCTTCTGGTGGGAAGGGG + Intronic
1199713813 X:150491719-150491741 GCTTGGCTTCTGGTGGAGTCTGG + Intronic
1199715161 X:150502835-150502857 GGGTGGGGTAGGGTGGGATCAGG + Intronic
1200236067 X:154468289-154468311 GGGTGGCGTCTGTGGGGAGCAGG - Exonic
1200621643 Y:5455758-5455780 GAGTGGCTTCTTATGAGATCTGG - Intronic
1201427242 Y:13865557-13865579 GGCTGGCTTCTGGTGAGTTAAGG + Intergenic
1202059475 Y:20871338-20871360 TGGTGGCTTCTGGTTGGTTGAGG + Intergenic