ID: 968904663

View in Genome Browser
Species Human (GRCh38)
Location 4:3445725-3445747
Sequence CCAGCCCGGGGCTCTCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 160}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968904644_968904663 6 Left 968904644 4:3445696-3445718 CCCCCCGGCTCCCTAGGACCCCG 0: 1
1: 1
2: 4
3: 19
4: 181
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904649_968904663 2 Left 968904649 4:3445700-3445722 CCGGCTCCCTAGGACCCCGGCGG 0: 1
1: 1
2: 1
3: 9
4: 145
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904648_968904663 3 Left 968904648 4:3445699-3445721 CCCGGCTCCCTAGGACCCCGGCG 0: 1
1: 1
2: 0
3: 13
4: 179
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904647_968904663 4 Left 968904647 4:3445698-3445720 CCCCGGCTCCCTAGGACCCCGGC 0: 1
1: 1
2: 0
3: 28
4: 225
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904642_968904663 18 Left 968904642 4:3445684-3445706 CCTGGGGAGAGGCCCCCCGGCTC 0: 2
1: 0
2: 2
3: 15
4: 224
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904637_968904663 30 Left 968904637 4:3445672-3445694 CCTGCTTCCTGCCCTGGGGAGAG 0: 1
1: 0
2: 9
3: 52
4: 461
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904645_968904663 5 Left 968904645 4:3445697-3445719 CCCCCGGCTCCCTAGGACCCCGG 0: 1
1: 1
2: 1
3: 18
4: 200
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904639_968904663 23 Left 968904639 4:3445679-3445701 CCTGCCCTGGGGAGAGGCCCCCC 0: 1
1: 0
2: 6
3: 49
4: 461
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904641_968904663 19 Left 968904641 4:3445683-3445705 CCCTGGGGAGAGGCCCCCCGGCT 0: 1
1: 0
2: 1
3: 17
4: 256
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904654_968904663 -5 Left 968904654 4:3445707-3445729 CCTAGGACCCCGGCGGGGCCAGC 0: 1
1: 1
2: 2
3: 17
4: 242
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160
968904653_968904663 -4 Left 968904653 4:3445706-3445728 CCCTAGGACCCCGGCGGGGCCAG 0: 1
1: 1
2: 1
3: 8
4: 114
Right 968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG 0: 1
1: 0
2: 2
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968904663 Original CRISPR CCAGCCCGGGGCTCTCATGT GGG Intronic
900005106 1:40147-40169 CCAGCACTGGGTTCTCATCTAGG - Intergenic
900246202 1:1637242-1637264 CCAGCCCAGGGCACTCAGGGTGG + Intronic
900310364 1:2030469-2030491 CCAGCCTGGGGCTCTCCGGCAGG + Exonic
900861851 1:5239352-5239374 CCAGGCATGGGCTGTCATGTGGG + Intergenic
902974756 1:20080753-20080775 CCAGCCCCGGCCTCTTCTGTGGG + Intronic
908318147 1:62954569-62954591 CCAGCCAGTGGCCATCATGTTGG - Intergenic
920245709 1:204585882-204585904 CCAGCCCGGGCTCCCCATGTTGG - Intergenic
922598803 1:226834399-226834421 GCAGCCCTGGGCTGTAATGTGGG - Intergenic
923564579 1:235067426-235067448 CCAGACAGGGCCTATCATGTGGG - Intergenic
1065304200 10:24353117-24353139 CAAGCCAGGGGCACTCATATAGG + Intronic
1066296568 10:34059082-34059104 CCAGCCCTGTGCTCTCCGGTTGG - Intergenic
1067261756 10:44699096-44699118 TCACCCCAGGGCTCTCATGGAGG - Intergenic
1070548377 10:77470497-77470519 CCTGCCCAGAGCCCTCATGTGGG - Intronic
1070764532 10:79048717-79048739 CCAGCCAGGGGCTCTCAGGTTGG + Intergenic
1072189040 10:93065934-93065956 GCAGCCCGGGGCTGTCTTGCAGG + Exonic
1072618394 10:97064399-97064421 CCAGCTCAGGGCTTTCCTGTGGG - Intronic
1076887557 10:133269597-133269619 CTGGCCCGGGGCCCTCATGCTGG - Intronic
1077097739 11:806196-806218 CCCGCTCGGGGGTATCATGTTGG - Intronic
1077097768 11:806337-806359 CCCGCTCGGGGGTATCATGTTGG - Intronic
1077615556 11:3671212-3671234 CCAGCCCTGGCCTCTCCTGGTGG - Intronic
1079617420 11:22512738-22512760 CCAGCCCAGGGCTCAAAAGTTGG + Intergenic
1080271770 11:30458055-30458077 GAAGCCCCAGGCTCTCATGTGGG + Intronic
1081838423 11:46176858-46176880 CCAGCGAGGGGATCTCATCTTGG - Intergenic
1085570878 11:77556849-77556871 CCAGCCCGAGGCTCTGGTCTGGG - Intronic
1088743325 11:112784726-112784748 CCATCCCAGGGCTCTGAGGTCGG - Intergenic
1090918854 11:131190804-131190826 CGAGCCTGGGACTCTTATGTGGG - Intergenic
1091379089 12:44322-44344 CCAGCACTGGGTTCTCATCTGGG - Intergenic
1097063085 12:56300358-56300380 CCAGCCCGGGGTCCTCAAGGAGG + Exonic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104151139 12:126084435-126084457 CCAGCTGGTGGCTCTGATGTGGG - Intergenic
1104891111 12:132140604-132140626 CCAGCCGGGGCCTCACCTGTGGG + Exonic
1105214130 13:18274473-18274495 CCAGCCTGGGGCTCTCTGGAGGG - Intergenic
1107054999 13:36093391-36093413 CCAGCCAAGGGCTCCCATGGTGG + Intronic
1107098279 13:36560208-36560230 CCTCCCTGGGTCTCTCATGTGGG + Intergenic
1108409245 13:50130429-50130451 CGAGCCCGGGGCGCTGAGGTCGG + Intronic
1114537236 14:23430695-23430717 CAAGCCCCCGGCTCTCATGGAGG + Intronic
1114771198 14:25430059-25430081 GCAGCCCTGGGCTGTAATGTGGG + Intergenic
1118319317 14:64743791-64743813 CCTGCCCAGGGCCCTCAGGTGGG + Exonic
1119560494 14:75585567-75585589 GCAGCCCTGGGCTGTAATGTGGG + Intronic
1121016528 14:90552530-90552552 CCACCCCCAGGCTCTCAGGTGGG + Intronic
1121309701 14:92929162-92929184 CCAACCCTGGGCTCAGATGTAGG + Intronic
1123698348 15:22895823-22895845 CCAGCCAGGGGCGCTCACTTGGG - Intronic
1124685383 15:31777673-31777695 CCAGGCAGGGGCTTCCATGTTGG + Intronic
1129933646 15:79432012-79432034 CCCGCCCGGGGCGCTCAAGCTGG - Intergenic
1130915272 15:88299904-88299926 CCAGCCCGGGGGAGTCTTGTAGG - Intergenic
1130996902 15:88909039-88909061 CCATCCCTGGGCCCACATGTGGG + Intronic
1132448407 15:101950797-101950819 CCAGCACTGGGTTCTCATCTAGG + Intergenic
1132764811 16:1528982-1529004 CCTGCCCGGGGCTACCATCTCGG - Intronic
1132837130 16:1959765-1959787 CCAGCCCGGGGCTCCCTCGCCGG + Intronic
1133056359 16:3147392-3147414 GCAGCCCGAGGCACTCATGCAGG + Exonic
1134067842 16:11240742-11240764 CCAGCACAGGCCTCTGATGTTGG + Intergenic
1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG + Intergenic
1134313848 16:13100080-13100102 CCAGCCAGTGGCTGTTATGTAGG + Intronic
1135460959 16:22642562-22642584 CCAGCCAGGGCCTGCCATGTCGG + Intergenic
1135498198 16:22970840-22970862 CCACCCAGGGGCTCTCAGCTGGG + Intergenic
1135716993 16:24779914-24779936 CCAGCCCTGGGCTGCCATTTTGG + Intronic
1136620774 16:31427302-31427324 GCAGCCCTGGGCTCCCATGGGGG + Intergenic
1137676477 16:50306020-50306042 CCAGCCTGGCTCTCTCCTGTCGG + Intronic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1141665991 16:85465370-85465392 CCAGGCCTGGGCTCCCATCTGGG + Intergenic
1142591570 17:1008460-1008482 CCAGCCAGGGGCCCAGATGTGGG + Intronic
1142618038 17:1148004-1148026 CCAGCCTGGGGCCATCATGCTGG - Intronic
1142979345 17:3662737-3662759 CCAGCCCCGGGCTTTCAGGCAGG + Intergenic
1147115499 17:38296462-38296484 CAAGCCCGGCGCTCTCTTGCTGG + Intergenic
1148344046 17:46891540-46891562 GCAGCCAGGGGCTCTCATCTGGG + Intergenic
1148414175 17:47493135-47493157 CAAGCCCGGCGCTCTCTTGCTGG - Intergenic
1148654399 17:49272480-49272502 ACAGCCTGGAGCTCTCAGGTAGG + Intergenic
1151017923 17:70578059-70578081 CCAGCCAAGGACTCTCATTTAGG + Intergenic
1152757140 17:82091754-82091776 CCTCCCCGAGACTCTCATGTGGG + Intronic
1153285314 18:3450600-3450622 CCGCCCAGGGGCTCTCATGCTGG + Intronic
1158002102 18:52631257-52631279 CAAGCCTGCGGCTATCATGTTGG - Intronic
1160636860 19:81756-81778 CCAGCACTGGGTTCTCATCTAGG - Intergenic
1162261832 19:9540223-9540245 GCAGCCCTGGGCTGTAATGTGGG - Intergenic
1163089067 19:15005943-15005965 CCAACCAGGGGATCTCATTTGGG - Intronic
1163769082 19:19179883-19179905 CCAGCCCGGGTTTCTCCTGGTGG - Intronic
1163791053 19:19306285-19306307 GCAGCCTGGGGCTCTGAAGTGGG + Intronic
1165913735 19:39245345-39245367 CCAGCCTGGGGCTCCCCTGGTGG - Intergenic
1165917226 19:39268279-39268301 CCAGCCTGGGGCTCCCCTGGTGG + Intergenic
1168121508 19:54254659-54254681 CCAGCCCAGAGCTCTCCTGGGGG + Intronic
1168125016 19:54278183-54278205 CCAGCCCAGAGCTCTCCTGGGGG + Intronic
925712954 2:6759299-6759321 CCCTCCCAGGGCTCTCATGGCGG - Intergenic
926172380 2:10560487-10560509 CCAGCCAGTGGTTCTCAGGTGGG + Intergenic
926564821 2:14457323-14457345 CAAGCTGGGGGCTCTCATCTGGG - Intergenic
927216408 2:20670068-20670090 CCAGCCCCGGACTCTGATCTCGG + Intronic
929573802 2:43039816-43039838 CCAGCCCAGGGGACTCAGGTGGG + Intergenic
930091545 2:47534703-47534725 CCACCTCAGGGCGCTCATGTGGG + Intronic
934567736 2:95349871-95349893 CCATCAAGGGGATCTCATGTTGG + Intronic
934856932 2:97735382-97735404 CCAGGCCGAGGCCCTCATGCTGG + Exonic
936564616 2:113573285-113573307 CCAGCACTGGGTTCTCATCTGGG + Intergenic
940834220 2:158502408-158502430 CCAGCCCAGGGCACTAATTTGGG - Intronic
945554537 2:211262640-211262662 GCAGCCCTGGGCTGTAATGTGGG - Intergenic
946301442 2:218826895-218826917 CCAGCCCGAGCCTCTCATCCTGG + Intronic
946417441 2:219547455-219547477 CCAGCCTGGTGCCCTCATCTTGG + Intronic
948936419 2:241168013-241168035 CCAGCTCTGGGCTCTCCCGTTGG + Intronic
1170579179 20:17684949-17684971 CCAGGCTGGGGCTCTCAGATGGG + Intergenic
1173706748 20:45115606-45115628 CCAGCCCTGGCCTCTCCTCTTGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1176011330 20:62897921-62897943 CCATCCTGGGGCCCTCATGGGGG - Intronic
1176101927 20:63368334-63368356 GCAGCCCTGGGCTCCCATGTAGG + Intronic
1180842071 22:18964125-18964147 CCAGCACTGGGCTTTCATCTGGG + Intergenic
1181031999 22:20152772-20152794 CGAGCCCCGGGCTGTCATGGTGG + Intergenic
1181059425 22:20274756-20274778 CCAGCACTGGGCTTTCATCTGGG - Intronic
1183801206 22:40166097-40166119 CCTGCCAGGGGCTCTCCTGAAGG + Intronic
1184747592 22:46465209-46465231 CCAGGCCCGGGCTCAGATGTGGG + Intronic
950505331 3:13391117-13391139 CCAGCGGGGGGCTTTCATCTGGG - Intronic
952832888 3:37579798-37579820 CAAGCCAGGGGCCCACATGTTGG + Intronic
953657511 3:44865226-44865248 CCAGCCTTGGGATGTCATGTGGG + Exonic
953841358 3:46392484-46392506 GCAGCCCTGGGCTGTCATGTGGG + Intergenic
954333652 3:49903890-49903912 CCAGCCCGGCGCCCTCGGGTCGG - Intronic
954630650 3:52046076-52046098 CCTTCCCAGGGCTCTCAGGTAGG + Intergenic
954691445 3:52397669-52397691 CAAGCCAGGGGCTTCCATGTTGG + Intronic
957394249 3:79619235-79619257 GCAGCCCTGGGCTGTAATGTGGG - Intronic
962367466 3:134795862-134795884 CCAGCCGGGGGCGCTCTGGTGGG - Intronic
963119565 3:141764683-141764705 CCAGCCCAGCCCTCTCCTGTGGG + Intergenic
963721015 3:148862173-148862195 CCAACCTGGGGCTCTCAGGTGGG - Intergenic
966557717 3:181282697-181282719 CCATCCAGGGGCTCTGATGATGG - Intergenic
968656317 4:1779864-1779886 CCAGCCCTGGGGGCTCATCTGGG - Intergenic
968739162 4:2318702-2318724 CCACCCAGGGGCCCTGATGTGGG - Intronic
968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG + Intronic
968940170 4:3633588-3633610 CCATCCAGGGGTTCCCATGTGGG - Intergenic
971138669 4:23899262-23899284 CCCACCTGGGGCTCTCCTGTGGG + Intronic
971672547 4:29581634-29581656 CCAGCCCAGGTCTATCTTGTTGG - Intergenic
975151904 4:71032371-71032393 GCAGCCCGGGGCTGCAATGTGGG - Intergenic
983848617 4:172550707-172550729 CCAGCCTCAGCCTCTCATGTAGG + Intronic
985897859 5:2759898-2759920 CCAGGCCGGGGCTCTCCAGGTGG + Intergenic
986014356 5:3744949-3744971 CCAGCTCGGGGCATTCAAGTGGG - Intergenic
992386075 5:76285830-76285852 CTGACCCCGGGCTCTCATGTTGG - Exonic
998370336 5:141656611-141656633 CCACCCGTGGGCTCTCACGTCGG + Exonic
998446785 5:142204908-142204930 CCAGCCCGGTGCTCTCAGCAGGG + Intergenic
1001538953 5:172523611-172523633 CCAGGAAGGGGCTCTGATGTTGG + Intergenic
1001810843 5:174627049-174627071 CCAACCAGAGACTCTCATGTAGG - Intergenic
1002583013 5:180221930-180221952 CCACCCCATGGCTCTCTTGTAGG - Intergenic
1002925658 6:1604618-1604640 CCAGGCTGGGGCTCTCAGGCTGG - Intergenic
1003214554 6:4097549-4097571 CCATCCTGGAGCTCTCATGGAGG + Intronic
1005567608 6:27112549-27112571 CAAGTTCGGGGCTCTCATCTGGG + Intergenic
1006754188 6:36400414-36400436 CCAGCCAGGGCCTGTCAGGTAGG - Intronic
1011133491 6:84075250-84075272 CCAGCCCTGGGCAGTCAGGTGGG - Intronic
1012413472 6:98987065-98987087 CCAGCCCAGGACATTCATGTAGG + Intergenic
1013285714 6:108679706-108679728 CTAGCCCTGGGCTCTGAGGTGGG + Intronic
1017269647 6:152491356-152491378 GCAGCCCTGGGCTGTAATGTGGG - Intronic
1017763112 6:157586176-157586198 CCAGCCCTGGGCTCTGAGCTGGG - Intronic
1018678676 6:166244863-166244885 GAAGCCCCGGGCTTTCATGTGGG - Intergenic
1019134406 6:169899233-169899255 CCAGCCCGGGGCTCACCTGCTGG + Intergenic
1019562240 7:1664872-1664894 CCAGCCTGCGGCTTTCGTGTGGG - Intergenic
1022103227 7:27181335-27181357 CCGGCCTGGGGATCTCATCTGGG - Intergenic
1022113013 7:27243012-27243034 CCATCCCGGGGCTCTCCGGTGGG - Exonic
1023873924 7:44276751-44276773 CCAGCGTGGGGCTCCCAGGTGGG - Intronic
1028162199 7:87498474-87498496 CCAGCTCGGGGCCCTCAGGTGGG + Intergenic
1028411386 7:90534065-90534087 CCACCTTGGGACTCTCATGTGGG - Intronic
1029614193 7:101645981-101646003 CCAGCCCAGGGCCCTCCTGCTGG - Intergenic
1032590045 7:133183455-133183477 CCAGCCCAGAGCTCTCATGGAGG - Intergenic
1037459457 8:19094481-19094503 CCAGGGCGGGGCACTCAGGTTGG + Intergenic
1040307081 8:46217651-46217673 CCAGCCCGGGACTATCCTGGGGG + Intergenic
1042721766 8:71833963-71833985 CCAGCCCCAGGCTGTCATGGGGG - Intronic
1044169745 8:89034709-89034731 CTAGCCAGGGCCTCTCAGGTGGG - Intergenic
1047940735 8:129825537-129825559 CGAGGGCGGGGCTCTCATGATGG - Intergenic
1049211573 8:141389021-141389043 CCAGCCTGGGCCCCTCCTGTAGG + Intergenic
1049528042 8:143138983-143139005 CCAGCCAGGGTCACTCATGCAGG - Intergenic
1049887802 9:39929-39951 CCAGCACTGGGTTCTCATCTGGG - Intergenic
1050552677 9:6761446-6761468 CCAGCCCCAGCCTCTCAAGTAGG + Intronic
1053527520 9:38845104-38845126 CCAGCCCGGGGCTCTGCTCTGGG - Intergenic
1054199745 9:62069533-62069555 CCAGCCCGGGGCTCTGCTCTGGG - Intergenic
1054450585 9:65401709-65401731 CCATCCAGGGGTTCCCATGTGGG + Intergenic
1054638610 9:67518824-67518846 CCAGCCCGGGGCTCTGCTCTGGG + Intergenic
1056363547 9:85881848-85881870 GCAGCCCTGGGCTGTAATGTAGG - Intergenic
1057025729 9:91732894-91732916 TCAGCCCCAGGCTCGCATGTGGG - Intronic
1058905208 9:109477268-109477290 ACTCCCCGAGGCTCTCATGTTGG + Intronic
1059764135 9:117367367-117367389 CCAGACCTGTGCTCTCATGCTGG + Intronic
1060298749 9:122361265-122361287 CCAACCTGGGGCTCTCTTGTGGG - Intergenic
1061272226 9:129550092-129550114 CCCGGCCGGGGCTCTCTTGGGGG - Intergenic
1062033359 9:134371984-134372006 CCAGCCTGGGCCTCCCTTGTGGG + Intronic
1062057884 9:134478013-134478035 CCTGCACGGGGCTCCCATGGGGG + Intergenic
1062229540 9:135474169-135474191 TCAGCCCGGGACTGTCATTTGGG - Intergenic
1196159825 X:112470723-112470745 GCAGCCCTTGGCTCTCCTGTAGG + Intergenic
1198723254 X:139647710-139647732 CCAGCTCTGGGCTTTCATTTTGG + Intronic