ID: 968904830

View in Genome Browser
Species Human (GRCh38)
Location 4:3446361-3446383
Sequence GTCCGCAAGCGGGTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968904830_968904843 11 Left 968904830 4:3446361-3446383 CCTGTCCCCACCCGCTTGCGGAC 0: 1
1: 0
2: 0
3: 11
4: 98
Right 968904843 4:3446395-3446417 GCCTCTGCTGACCCCTTCCCGGG 0: 1
1: 0
2: 7
3: 57
4: 453
968904830_968904846 19 Left 968904830 4:3446361-3446383 CCTGTCCCCACCCGCTTGCGGAC 0: 1
1: 0
2: 0
3: 11
4: 98
Right 968904846 4:3446403-3446425 TGACCCCTTCCCGGGGTCCCCGG 0: 1
1: 0
2: 1
3: 19
4: 261
968904830_968904845 12 Left 968904830 4:3446361-3446383 CCTGTCCCCACCCGCTTGCGGAC 0: 1
1: 0
2: 0
3: 11
4: 98
Right 968904845 4:3446396-3446418 CCTCTGCTGACCCCTTCCCGGGG 0: 1
1: 0
2: 3
3: 27
4: 251
968904830_968904842 10 Left 968904830 4:3446361-3446383 CCTGTCCCCACCCGCTTGCGGAC 0: 1
1: 0
2: 0
3: 11
4: 98
Right 968904842 4:3446394-3446416 TGCCTCTGCTGACCCCTTCCCGG 0: 1
1: 1
2: 3
3: 37
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968904830 Original CRISPR GTCCGCAAGCGGGTGGGGAC AGG (reversed) Intronic
914195433 1:145445925-145445947 GTCCTCAGGCAAGTGGGGACTGG - Intergenic
914680702 1:149936535-149936557 GTCGGCAAGAGGGTGAGAACGGG - Intronic
915579892 1:156807258-156807280 GTCTCCAGGCGGGTGGGGGCTGG + Exonic
920683168 1:208088548-208088570 GTTAGCAAGCGGGTGTGCACGGG - Intronic
922336670 1:224623841-224623863 ATCTGCCAGGGGGTGGGGACGGG - Intronic
922804095 1:228376891-228376913 GGCTGCAGGCGGGTGGGGCCAGG + Intronic
1062936789 10:1396290-1396312 GTCACCGAGGGGGTGGGGACAGG - Intronic
1066180596 10:32957978-32958000 GGCCGCCAGCGGTTGGGGGCTGG - Intronic
1067112188 10:43408642-43408664 GTCCCCCTGGGGGTGGGGACGGG - Intronic
1069789950 10:71013128-71013150 GTCCCCAAGTGGGTGGGGGTGGG - Intergenic
1073428302 10:103469738-103469760 GGCAGCATGAGGGTGGGGACTGG + Intergenic
1073430925 10:103486451-103486473 GTCCTCAAGCAGGAGGGGGCTGG + Intergenic
1084811409 11:71613935-71613957 GTCACCAAGGGGGCGGGGACCGG + Intergenic
1084844475 11:71888397-71888419 GTCACCAAGGGGGCGGGGACCGG + Intronic
1091108747 11:132945506-132945528 GTCAGTGAGCGGGTGGGGAATGG + Intronic
1092538917 12:9407551-9407573 GTCACAAAGGGGGTGGGGACCGG + Intergenic
1097187070 12:57201759-57201781 GGCTGCAAGCGGGTGGGCATGGG - Exonic
1097863903 12:64543457-64543479 GTGGGCAGGCGGGTGGGGAGCGG - Intergenic
1113694472 13:112334306-112334328 GTCAGGGAGTGGGTGGGGACTGG - Intergenic
1119724675 14:76914819-76914841 GTCCCCAGGTGGGTGGGGCCTGG - Intergenic
1124426911 15:29570476-29570498 GTCCGCGACCAGGCGGGGACGGG - Intronic
1127332022 15:57948985-57949007 GTGCCAAGGCGGGTGGGGACAGG - Intergenic
1129862285 15:78872414-78872436 ATCAGCAAGAGGGTGGGAACTGG - Intronic
1132014039 15:98300322-98300344 GTCAGCAAAGGGGTGGGGACTGG - Intergenic
1132683240 16:1152408-1152430 ATCCCCACGCGGGAGGGGACCGG + Intergenic
1137714943 16:50592825-50592847 GTGCAGAAGCGGGTGGAGACAGG + Intronic
1142029573 16:87831812-87831834 CTCTGCAGGCGGGTGGGGACTGG + Exonic
1146581122 17:34039923-34039945 GTCCGCAGCCGGGTCGGGTCGGG - Intronic
1147598936 17:41734125-41734147 GTCCTGGACCGGGTGGGGACTGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148753376 17:49959102-49959124 GTCAGCAAGGGGCAGGGGACAGG - Intergenic
1150108643 17:62479223-62479245 GTCCGCAGCCGGGTCGGGTCGGG + Exonic
1160824045 19:1071244-1071266 GACCGCGAGCGCGTGGGGCCTGG - Intronic
1162030510 19:7915311-7915333 GTCCTCATGGGGGTGGGGACAGG + Intergenic
1163325177 19:16598998-16599020 GTCCCCAAGCGGGGAGGGGCAGG - Intronic
1163495731 19:17645637-17645659 GTTCTGAAGCGGGTGGGGACGGG - Intronic
1165236783 19:34428358-34428380 GGCCGGAAGCGGGTGGGGGAAGG - Exonic
1165491034 19:36122815-36122837 GCCTGCTAGTGGGTGGGGACCGG + Intronic
1167048710 19:47066495-47066517 GTCCCGAAGAGGGTGGGCACGGG + Exonic
1167668000 19:50833790-50833812 TTCCTCAAGGGGGAGGGGACAGG + Intronic
927111869 2:19869351-19869373 GTCTCATAGCGGGTGGGGACAGG - Intergenic
927896602 2:26786473-26786495 TTCCGAAAGCGGGAAGGGACCGG + Intronic
931302018 2:60989465-60989487 GTCCAAAAACGGGTGGGGCCTGG - Intronic
931309603 2:61065884-61065906 GCCTGCAAGCGGGCGGGGGCGGG + Intronic
938071436 2:128310451-128310473 GGCCACAAGCTGGTGGGGACAGG + Intronic
941621927 2:167788262-167788284 GTCCGGAAGTGGGTGGGGGCGGG + Intergenic
948362479 2:237432810-237432832 ATCGGCAAGTGGGCGGGGACAGG + Intergenic
948856090 2:240731340-240731362 TTCCTCAAGCCTGTGGGGACAGG - Intronic
949009826 2:241672051-241672073 GTCCCCATGCGGGTGTGAACAGG - Intronic
1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG + Intergenic
1172098731 20:32473367-32473389 GTTCCCACGGGGGTGGGGACCGG - Intronic
1176073817 20:63239570-63239592 GTGCGCACGCGGCTGCGGACGGG - Exonic
1177834017 21:26170422-26170444 GTCCGCAAGCGGGGGCGGAGAGG + Intronic
1178914105 21:36697563-36697585 CTCCGCAAGGGGCTAGGGACAGG + Intergenic
1180025746 21:45161181-45161203 CTCCGCAAGTTGGTGGGAACCGG + Intronic
955234913 3:57130910-57130932 GGCCTCAAGCTGGTGGGGGCTGG - Intronic
961277906 3:125742083-125742105 GTCACCAAGGGGGCGGGGACCGG + Intergenic
961876515 3:130027579-130027601 GTCACAAAGGGGGTGGGGACCGG - Intergenic
968473025 4:790544-790566 GACCCCAAGGAGGTGGGGACAGG - Intronic
968500984 4:950004-950026 ATCCGCATGTGGGAGGGGACAGG - Intronic
968566808 4:1317409-1317431 GCCAGCAAGAGGGTGGGGCCAGG - Intronic
968904830 4:3446361-3446383 GTCCGCAAGCGGGTGGGGACAGG - Intronic
969019762 4:4132026-4132048 GTCACCAAGGGGGCGGGGACCGG - Intergenic
969025374 4:4168374-4168396 GTCACCAAGGGGGCGGGGACTGG - Intergenic
969379396 4:6783624-6783646 GGCCGCAGGCGGGCGGGGCCGGG + Intronic
969785521 4:9454271-9454293 GTCACCAAGGGGGCGGGGACCGG + Intergenic
969793675 4:9509444-9509466 GTCACCAAGGGGGCGGGGACCGG + Intergenic
988835617 5:35029552-35029574 AACCCCAAGCGGGTGGAGACAGG + Intronic
1002021379 5:176366127-176366149 GACCGCAGGCGGGAGGGGATGGG - Intronic
1002771223 6:292238-292260 GTGCGCACGGGGGCGGGGACCGG + Intronic
1006428067 6:33978488-33978510 GGCCACAAGAGGGTGGGGAGAGG + Intergenic
1006457441 6:34139979-34140001 GTCCCAAAGCGGGTGGGCACAGG + Intronic
1011762835 6:90586943-90586965 GTCCGGAGGCGGGTGGGCGCGGG - Exonic
1019167780 6:170110383-170110405 GGCTGCAAGCCGGTGTGGACGGG - Intergenic
1019553516 7:1617022-1617044 GTCTGCCAGCGTGTGGGGCCAGG + Intergenic
1019587463 7:1813198-1813220 GTCCGGATGCGGATGTGGACGGG + Intergenic
1020311633 7:6872897-6872919 GTCACCAAGGGGGTGGGGACCGG - Intergenic
1022471622 7:30685039-30685061 GTCCCCAAGCTGTTGGGGACAGG + Intronic
1023562514 7:41490788-41490810 GTCAGCAAGAGGCTGGGGAGCGG - Intergenic
1029696159 7:102214678-102214700 GTCCGCATGGGGCTGGGGCCTGG - Intronic
1032096729 7:128942015-128942037 GTCTGCAGGTGGATGGGGACAGG - Intronic
1034694692 7:153043259-153043281 GTCAGCAATGAGGTGGGGACTGG + Intergenic
1034976998 7:155454666-155454688 CTCCGCAAGCGGGTGGTCGCGGG + Intergenic
1036903622 8:12690059-12690081 GTCACAAAGGGGGTGGGGACAGG - Intergenic
1040111340 8:43568380-43568402 GTCCCCCAGTGGATGGGGACAGG - Intergenic
1040413978 8:47181280-47181302 GGCTGCAAGGGGGTGGGGATGGG - Intergenic
1040487811 8:47890981-47891003 GTCTTCAAGCAGGTGTGGACAGG + Intronic
1049415346 8:142492430-142492452 GTCTGGATGCGGGTGGGGAGGGG + Intronic
1053015584 9:34660225-34660247 GTCCATACGCTGGTGGGGACGGG - Intronic
1056537633 9:87544941-87544963 GTCTGTGAGAGGGTGGGGACTGG - Intronic
1057293204 9:93820141-93820163 GCCCCCAAGCTGGTGGGGAGAGG + Intergenic
1058478396 9:105364769-105364791 GTCCGCAGGCTGGAGGGGAAGGG + Intronic
1060839375 9:126781880-126781902 GTTGGCAAACGGGAGGGGACGGG + Intergenic
1060997712 9:127884554-127884576 GTCCCCGAGCTGCTGGGGACAGG - Intergenic
1061922039 9:133787762-133787784 GGCTGCCAGCGGGTGGGGCCAGG - Intronic
1062561520 9:137144303-137144325 GTCCCCAGGATGGTGGGGACAGG + Intronic
1062561596 9:137144660-137144682 GTCCCCAGGGTGGTGGGGACAGG + Intronic
1062561619 9:137144720-137144742 GTCCCCAGGGGTGTGGGGACAGG + Intronic
1062561678 9:137144896-137144918 GTCCCCAGGGGTGTGGGGACCGG + Intronic
1062561701 9:137144953-137144975 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561721 9:137145010-137145032 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561741 9:137145067-137145089 GTCCCCAGAGGGGTGGGGACCGG + Intronic
1062561763 9:137145124-137145146 GTCCCCAGAGGGGTGGGGACCGG + Intronic
1062561785 9:137145181-137145203 GTCCCCAGGGGTGTGGGGACCGG + Intronic
1062561808 9:137145238-137145260 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561828 9:137145295-137145317 GTCCCCAGAGGGGTGGGGACAGG + Intronic
1062561887 9:137145471-137145493 GTCCCCAGCGGGGTGGGGACAGG + Intronic
1062561931 9:137145590-137145612 GTCCCCATGGGGGTGGGGACAGG + Intronic
1062699231 9:137890425-137890447 GTCCTCAGGCAAGTGGGGACTGG + Intronic
1197459826 X:126726707-126726729 GTCAGCTTGAGGGTGGGGACTGG - Intergenic