ID: 968904849

View in Genome Browser
Species Human (GRCh38)
Location 4:3446408-3446430
Sequence GGTTACCGGGGACCCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968904849_968904855 -6 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904855 4:3446425-3446447 GTAACCCTCTCTGACCCCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 131
968904849_968904861 3 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904861 4:3446434-3446456 TCTGACCCCTCTGGGTCTTGGGG 0: 1
1: 1
2: 1
3: 15
4: 282
968904849_968904860 2 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904860 4:3446433-3446455 CTCTGACCCCTCTGGGTCTTGGG 0: 1
1: 0
2: 6
3: 103
4: 479
968904849_968904865 19 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904865 4:3446450-3446472 CTTGGGGCTCAGTCCTGAGCTGG 0: 1
1: 0
2: 3
3: 22
4: 239
968904849_968904867 29 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904867 4:3446460-3446482 AGTCCTGAGCTGGGCATGCATGG 0: 1
1: 0
2: 4
3: 36
4: 316
968904849_968904859 1 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904859 4:3446432-3446454 TCTCTGACCCCTCTGGGTCTTGG 0: 1
1: 0
2: 11
3: 85
4: 376
968904849_968904866 20 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904866 4:3446451-3446473 TTGGGGCTCAGTCCTGAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 228
968904849_968904856 -5 Left 968904849 4:3446408-3446430 CCTTCCCGGGGTCCCCGGTAACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 968904856 4:3446426-3446448 TAACCCTCTCTGACCCCTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968904849 Original CRISPR GGTTACCGGGGACCCCGGGA AGG (reversed) Intronic
900120610 1:1047179-1047201 GGTTAGTGGGGACCCCAGGGTGG - Intronic
901026734 1:6282310-6282332 GCTGACCTGGGGCCCCGGGAAGG + Intronic
901658296 1:10783116-10783138 GGTGGCCGGTGGCCCCGGGAGGG - Intronic
901866489 1:12110064-12110086 GGTTGCTGGGGACACCGGGGTGG - Exonic
904859156 1:33521704-33521726 TGTGACCGGGGAGCCCGGGGTGG + Intronic
905656971 1:39691602-39691624 GCTTCCCGGCGACTCCGGGAAGG - Exonic
913312542 1:117515799-117515821 GGTTACCAGGGACCTGGGGAGGG + Intronic
915267622 1:154730398-154730420 GGTTACCATGGACACCAGGAAGG - Intronic
916773633 1:167937008-167937030 GGTGAGCGGGGGCCCCGGGGCGG + Exonic
918303777 1:183227681-183227703 CCTTACCGGTGACCCCGGGAGGG - Exonic
920347032 1:205313049-205313071 GGTTACCAGGGACTGGGGGAGGG + Intronic
1064354628 10:14605620-14605642 GGGTTCCAGGGACCCAGGGATGG - Intronic
1070355866 10:75639674-75639696 GGTTAACAGGGACCCCGGCTTGG + Intronic
1075616079 10:123891693-123891715 GGTCACCGGGGGCGCCGGGCGGG + Exonic
1076979080 11:195775-195797 GGTTACAGGGGACCTGGTGAGGG + Intronic
1079361756 11:19776255-19776277 AGTTGCTGGGGACCCCTGGAGGG + Intronic
1082044735 11:47715445-47715467 AGGGAGCGGGGACCCCGGGAAGG + Intergenic
1083888777 11:65585429-65585451 GGTCAACGGGGAGCCCGGGTCGG + Exonic
1084121054 11:67069213-67069235 GGGAGCCGGGGATCCCGGGAGGG - Intronic
1084538876 11:69774628-69774650 GGTTCCCGGGGCCCCCGAGCAGG + Intronic
1089357735 11:117866119-117866141 GGTTGCCAGGGGCACCGGGAAGG + Intronic
1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG + Exonic
1091789602 12:3264237-3264259 GGGCACAGGGGACCCGGGGAAGG + Intronic
1091796030 12:3297937-3297959 GGGTGCCGGGGACCACAGGAGGG - Intergenic
1092491522 12:8949743-8949765 GATTATCAGGGAGCCCGGGAAGG - Exonic
1096191662 12:49623688-49623710 GGATAGCTGGGACCCCGGGGAGG + Intronic
1100745543 12:97641728-97641750 GGTTACCAGGGACTGGGGGAGGG - Intergenic
1102399832 12:112618863-112618885 GGTTGCCAGGGACCAAGGGAAGG - Intronic
1102518127 12:113463614-113463636 GGGGACCCGGGACCCGGGGAGGG + Intronic
1103510986 12:121474060-121474082 GGTTGCCAGGGACCAGGGGAGGG + Intronic
1103594143 12:122013314-122013336 GGTTACCAGGGACCGTGGGGAGG + Intergenic
1108690029 13:52851331-52851353 GGGAGCCGGGGAGCCCGGGAAGG + Intergenic
1109425130 13:62157592-62157614 TGCTACCGAGGACCCCTGGATGG + Intergenic
1112504479 13:99968130-99968152 GGTTATCCGGGATCCCGGAACGG - Intronic
1113030583 13:105989921-105989943 GGTTACCGTGGATCCCCTGAGGG + Intergenic
1113282306 13:108802250-108802272 GGTTGCCAGGGACTCGGGGAGGG - Intronic
1117065407 14:52008843-52008865 GGGTACCTGGCACCCAGGGATGG + Exonic
1123921585 15:25073736-25073758 GGATTCCGGGTACCCTGGGAGGG - Intergenic
1127253966 15:57271974-57271996 GGTTGCCAAGGACCACGGGATGG - Intronic
1132298813 15:100763940-100763962 CGTTGCCGGGGAAGCCGGGATGG - Intergenic
1132757867 16:1494632-1494654 GGCTACCGGCAACCCCAGGATGG - Intronic
1136462223 16:30418510-30418532 TGTTTCCAGGGACCCCGGCAGGG - Exonic
1140279632 16:73543021-73543043 GGTGCCTGGGGACCACGGGAAGG + Intergenic
1141689673 16:85589074-85589096 GGTACACGGGGATCCCGGGAAGG - Intergenic
1142120200 16:88383286-88383308 GGTGCCTGGGGACCCCGGGCTGG + Intergenic
1142156457 16:88534695-88534717 GGGTCCCGTGGCCCCCGGGACGG + Exonic
1142466570 17:140593-140615 GGTTACAGGGGACCTGGTGAGGG + Intergenic
1143204376 17:5132154-5132176 GGTTACTGGGGCCCCTGGCATGG - Intronic
1146662220 17:34672436-34672458 GGTTCCAGGGGACCCTGAGAAGG + Intergenic
1148745552 17:49916094-49916116 GTTTCCAGGGGACCTCGGGATGG - Intergenic
1151337258 17:73447322-73447344 GGCTACCAGGGACCCAGGGAGGG - Intronic
1152075936 17:78159732-78159754 GGTTACTGGGGCCCAGGGGAGGG - Intronic
1152531753 17:80922980-80923002 GGGTACCGGGGTGTCCGGGAGGG - Intronic
1157544838 18:48540042-48540064 GCTCACCGGGGACGCAGGGAGGG - Intronic
1158882563 18:61795000-61795022 GGTTACCAGGGACTAGGGGAGGG - Intergenic
1159426341 18:68292714-68292736 GGTTACCGGGGGCTGAGGGATGG - Intergenic
1160870142 19:1274230-1274252 TGTTTCCGGGGAGGCCGGGAGGG + Intronic
1161513130 19:4682812-4682834 GGTGACCGGGGCACCCGCGATGG + Exonic
1163401398 19:17095366-17095388 GGTTGCCAGGGACTCCGGGAGGG - Intronic
1164736940 19:30548576-30548598 AGTTACCGAGGAGCCCGGGAGGG - Exonic
925075857 2:1014967-1014989 GGAAGCCGGGGGCCCCGGGAGGG + Intronic
927669792 2:25059557-25059579 GGTTACCAGGGACTGCGGGGGGG + Intronic
929946668 2:46377284-46377306 AGTCACTGGGGACCCCGGCAGGG + Intronic
934777027 2:96946004-96946026 GGTTACCGGGGGCTAGGGGAAGG - Intronic
935434002 2:103008619-103008641 GGTTTCCTGGGAGCCCGAGATGG - Intergenic
938177324 2:129145446-129145468 GGTTACCAGGGACTGTGGGAGGG - Intergenic
947533732 2:230928171-230928193 TGTTCCCTGGGACCCCGGGGCGG - Intronic
947726322 2:232403057-232403079 GGTTACCTGGGACTGGGGGAGGG - Intergenic
948671451 2:239571226-239571248 GGGTTCTGGGGATCCCGGGATGG + Intergenic
949013754 2:241697659-241697681 GGTTGCCAGGGGCCTCGGGAGGG + Intergenic
1170598961 20:17826403-17826425 TGTTAGCTGGGACCCTGGGATGG + Intergenic
1171223386 20:23421047-23421069 GGTTTCCAGGGACCCTGGGGGGG + Intronic
1172670658 20:36632629-36632651 TGTTACCTGGGAACCCTGGAGGG - Exonic
1173124811 20:40326890-40326912 GATCTCCGGGGACCCCAGGATGG - Intergenic
1175168991 20:57066752-57066774 GGTTCCTGGGGTCCCAGGGATGG + Intergenic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1179658554 21:42860493-42860515 GGTTCCCGGGGACCCTGGAATGG + Intronic
1179826233 21:43968115-43968137 GGTGAGCGGGGACCTGGGGAGGG + Exonic
1179826259 21:43968174-43968196 GGTGAGCGGGGACCCAGGGAGGG + Intronic
1182520396 22:30881585-30881607 GGTTCCCAGGGGCCCAGGGAGGG - Intronic
1183113197 22:35668475-35668497 GGTTACAGGGGACCAGGGCAGGG + Intergenic
1184775889 22:46622488-46622510 GGTTACCGGGGGCTTGGGGAGGG + Intronic
1185256703 22:49837740-49837762 GGTTGCCGGGGTCTCAGGGAGGG + Intergenic
951357955 3:21691891-21691913 GGTTACCAGGGACTGGGGGAGGG - Intronic
953865935 3:46583603-46583625 GGTTACCGAGGGCCTGGGGAAGG - Intronic
954410098 3:50366770-50366792 GGTTCCAGGGGACTCCAGGAAGG + Intronic
962438176 3:135385436-135385458 AGTTACCGGGGGACCAGGGAAGG + Intergenic
968622563 4:1610469-1610491 GGTGACCGGGGATCCCAGCAGGG + Intergenic
968904849 4:3446408-3446430 GGTTACCGGGGACCCCGGGAAGG - Intronic
971363828 4:25960142-25960164 GGTTAACGAGGGCCACGGGAGGG - Intergenic
977902315 4:102436792-102436814 GGTTGCCGGGGACTGGGGGATGG + Intergenic
983649709 4:170026212-170026234 GGTTAGCGGGGGCCCCCGGCGGG - Exonic
987556297 5:19455427-19455449 GGTTACCAGGGTTCCAGGGAGGG + Intergenic
988070600 5:26284083-26284105 GGTTACCAGAGACTGCGGGAGGG + Intergenic
1003131840 6:3401650-3401672 GGTTACCAGGGAGCCAAGGAAGG - Intronic
1003546494 6:7063789-7063811 GGTTACCAGGGACTGGGGGAAGG - Intergenic
1016270892 6:142289164-142289186 GGTTACCAGGGACTGGGGGAGGG + Intergenic
1017713233 6:157188448-157188470 GGTTACAGAGGACACTGGGAAGG - Intronic
1019485948 7:1289233-1289255 GGTGACCAGGGCCCCCGGGTGGG - Intergenic
1019500329 7:1361299-1361321 GGTGACCTGGGGCCCCAGGAGGG + Intergenic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1029124048 7:98285293-98285315 GGTGACTGTGGAGCCCGGGAGGG + Intronic
1032440171 7:131936693-131936715 AGTTACCAGGGACCAGGGGAGGG + Intergenic
1034928576 7:155142698-155142720 AGTTGCCTGGGAGCCCGGGAGGG - Intergenic
1037015165 8:13895898-13895920 GGTTACCAGGGACCAGGGGAAGG - Intergenic
1037846042 8:22283137-22283159 AGCTGCGGGGGACCCCGGGACGG - Exonic
1042503256 8:69532836-69532858 GGTTGCCAGGGACTCCAGGAGGG - Intronic
1045067829 8:98467124-98467146 GGTTACCTGGTACCCCAGCAAGG - Intronic
1049196100 8:141316451-141316473 GTGTACCAGGGACCCAGGGACGG - Intergenic
1049492760 8:142913884-142913906 GGTGACCGGGCACACTGGGAAGG + Intronic
1049680842 8:143917376-143917398 GGTCATCGTGGACCCCGAGACGG - Exonic
1058274188 9:103019650-103019672 GGTTACTGGGGACCAGGGGAAGG - Intergenic
1061131857 9:128712970-128712992 GGTGTCCTGGGACCCCAGGAAGG - Intronic
1062261068 9:135663627-135663649 GGTTAGAGGGGGCCCTGGGAGGG + Intronic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic
1186480705 X:9894712-9894734 TGTCACCGGGGACCCTGGGCGGG - Exonic
1198387930 X:136147012-136147034 GGTTAGCGAGGACCCCGGTGAGG + Intergenic