ID: 968906942

View in Genome Browser
Species Human (GRCh38)
Location 4:3457937-3457959
Sequence AGTTATCTGCGGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968906942_968906945 4 Left 968906942 4:3457937-3457959 CCTGCCATCTTCCGCAGATAACT No data
Right 968906945 4:3457964-3457986 TCCTTTTGAAAGACAGCTCTTGG 0: 7
1: 195
2: 205
3: 190
4: 402
968906942_968906950 25 Left 968906942 4:3457937-3457959 CCTGCCATCTTCCGCAGATAACT No data
Right 968906950 4:3457985-3458007 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
968906942_968906947 15 Left 968906942 4:3457937-3457959 CCTGCCATCTTCCGCAGATAACT No data
Right 968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
968906942_968906949 22 Left 968906942 4:3457937-3457959 CCTGCCATCTTCCGCAGATAACT No data
Right 968906949 4:3457982-3458004 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
968906942_968906948 16 Left 968906942 4:3457937-3457959 CCTGCCATCTTCCGCAGATAACT No data
Right 968906948 4:3457976-3457998 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968906942 Original CRISPR AGTTATCTGCGGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr