ID: 968908180

View in Genome Browser
Species Human (GRCh38)
Location 4:3463977-3463999
Sequence AGGCTGGGCTGCGGTAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 573}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968908168_968908180 2 Left 968908168 4:3463952-3463974 CCTGGACCCCTCCCAGGCAGACG No data
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573
968908171_968908180 -5 Left 968908171 4:3463959-3463981 CCCTCCCAGGCAGACGAGAGGCT 0: 1
1: 0
2: 3
3: 13
4: 164
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573
968908167_968908180 3 Left 968908167 4:3463951-3463973 CCCTGGACCCCTCCCAGGCAGAC 0: 1
1: 0
2: 2
3: 26
4: 276
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573
968908176_968908180 -10 Left 968908176 4:3463964-3463986 CCAGGCAGACGAGAGGCTGGGCT 0: 1
1: 0
2: 1
3: 13
4: 300
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573
968908175_968908180 -9 Left 968908175 4:3463963-3463985 CCCAGGCAGACGAGAGGCTGGGC 0: 1
1: 1
2: 0
3: 22
4: 243
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573
968908170_968908180 -4 Left 968908170 4:3463958-3463980 CCCCTCCCAGGCAGACGAGAGGC No data
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573
968908172_968908180 -6 Left 968908172 4:3463960-3463982 CCTCCCAGGCAGACGAGAGGCTG No data
Right 968908180 4:3463977-3463999 AGGCTGGGCTGCGGTAGGGCAGG 0: 1
1: 0
2: 2
3: 69
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968908180 Original CRISPR AGGCTGGGCTGCGGTAGGGC AGG Intronic