ID: 968911197

View in Genome Browser
Species Human (GRCh38)
Location 4:3477755-3477777
Sequence CTCCAATCCCAGAGGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968911197_968911208 25 Left 968911197 4:3477755-3477777 CCTTGGCCCCTCTGGGATTGGAG 0: 1
1: 0
2: 3
3: 13
4: 252
Right 968911208 4:3477803-3477825 TGCCTATGCCAGCTGTGAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 175
968911197_968911205 -2 Left 968911197 4:3477755-3477777 CCTTGGCCCCTCTGGGATTGGAG 0: 1
1: 0
2: 3
3: 13
4: 252
Right 968911205 4:3477776-3477798 AGAGCCAGTATGGATGGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 249
968911197_968911203 -7 Left 968911197 4:3477755-3477777 CCTTGGCCCCTCTGGGATTGGAG 0: 1
1: 0
2: 3
3: 13
4: 252
Right 968911203 4:3477771-3477793 ATTGGAGAGCCAGTATGGATGGG 0: 1
1: 1
2: 0
3: 5
4: 115
968911197_968911202 -8 Left 968911197 4:3477755-3477777 CCTTGGCCCCTCTGGGATTGGAG 0: 1
1: 0
2: 3
3: 13
4: 252
Right 968911202 4:3477770-3477792 GATTGGAGAGCCAGTATGGATGG 0: 1
1: 0
2: 0
3: 15
4: 142
968911197_968911210 30 Left 968911197 4:3477755-3477777 CCTTGGCCCCTCTGGGATTGGAG 0: 1
1: 0
2: 3
3: 13
4: 252
Right 968911210 4:3477808-3477830 ATGCCAGCTGTGAGCTGGTGCGG 0: 1
1: 0
2: 1
3: 23
4: 265
968911197_968911204 -3 Left 968911197 4:3477755-3477777 CCTTGGCCCCTCTGGGATTGGAG 0: 1
1: 0
2: 3
3: 13
4: 252
Right 968911204 4:3477775-3477797 GAGAGCCAGTATGGATGGGCAGG 0: 1
1: 1
2: 1
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968911197 Original CRISPR CTCCAATCCCAGAGGGGCCA AGG (reversed) Intronic
900881320 1:5383220-5383242 GGCCATTCCCAGTGGGGCCAGGG - Intergenic
902734821 1:18393348-18393370 CTCCACTCCCAGGGTGACCACGG - Intergenic
903873823 1:26458208-26458230 CTTCCAACCCAGAGGGGCTAGGG - Intronic
903919351 1:26788253-26788275 CGCTCACCCCAGAGGGGCCACGG - Exonic
904206016 1:28855671-28855693 TTCCATTCCCAGAGGGGGCTGGG - Intronic
904604513 1:31691431-31691453 GTCCTATCCCAGGGGGTCCAGGG + Exonic
905027845 1:34863439-34863461 CTGTTCTCCCAGAGGGGCCAAGG - Intergenic
905895987 1:41546050-41546072 CACTAAACTCAGAGGGGCCATGG - Intronic
913075746 1:115338929-115338951 CTACAGTTTCAGAGGGGCCAAGG - Intergenic
913534693 1:119759868-119759890 CTCCAGGGCCAGAGGGGCCTTGG + Exonic
914976705 1:152371146-152371168 CTTGAGCCCCAGAGGGGCCAAGG + Intergenic
916547201 1:165817145-165817167 CTGTAAACCCAGAGGGTCCAGGG - Intronic
921164045 1:212493545-212493567 CTTCAGTCCCAGAGGGGAAATGG - Intergenic
924147147 1:241088192-241088214 CTTCAAGACCAGAGTGGCCATGG + Intronic
1064651523 10:17514649-17514671 CTCCACACCCAGATAGGCCAGGG - Intergenic
1067111351 10:43403266-43403288 CTTTAATCCCAGCAGGGCCAAGG - Intronic
1067539057 10:47138400-47138422 CTCCTCTTCCAGAAGGGCCAAGG - Intergenic
1067755241 10:49000141-49000163 CTGCAGTGGCAGAGGGGCCATGG + Intergenic
1067944647 10:50682337-50682359 CTCCCATCCCAGCCTGGCCAGGG + Intergenic
1069903496 10:71719323-71719345 CTCCCTTCCCACTGGGGCCAGGG + Intronic
1069974994 10:72205851-72205873 CTGTAATCCCAGGGAGGCCAAGG + Intronic
1070400612 10:76050434-76050456 CTCCTGCCCCAGTGGGGCCAGGG - Intronic
1070665490 10:78339557-78339579 CTCAAATCACAGAGGGACCTTGG + Intergenic
1070866149 10:79709208-79709230 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1070879943 10:79847339-79847361 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071347951 10:84711312-84711334 CACCAATCCCAGAGGTTCCCAGG - Intergenic
1071633052 10:87231429-87231451 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071646501 10:87363647-87363669 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1073446238 10:103582239-103582261 CTGGAATCCCAGAGGGGTGAGGG + Intronic
1074862638 10:117523955-117523977 CTCCCATCCAAGAGTGCCCAGGG - Intergenic
1075558073 10:123447672-123447694 CTCCAAACCCAGAAGGGCTTAGG + Intergenic
1076539834 10:131206910-131206932 CTTCACTCCCAGAGGGGCCAGGG + Intronic
1077803954 11:5571333-5571355 CTCCACCACCATAGGGGCCAGGG + Intronic
1082810209 11:57474966-57474988 CTCCACCCCCAGAGGCGGCAGGG - Intronic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1083958194 11:65998537-65998559 GTCCAAGCCCAGAAGAGCCAGGG + Exonic
1085472891 11:76769376-76769398 CTCAAATCTCAGCCGGGCCAGGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088598625 11:111457307-111457329 CCCCATCTCCAGAGGGGCCAAGG - Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089362122 11:117897935-117897957 CTCCTGTCCCAGAAGGTCCAGGG + Intergenic
1090205619 11:124882449-124882471 TGCCAATCCCAGAGAGTCCAGGG - Intergenic
1090397538 11:126429121-126429143 CTCCATTCCCAGAAGGTCCTGGG - Intronic
1091357192 11:134946188-134946210 CTGCAAGCCCAGAGGGCCCCAGG + Intergenic
1091440036 12:505482-505504 CTCCAATCCAAGATGGATCAGGG - Intronic
1091461242 12:644867-644889 ATCCAAACCCACTGGGGCCAGGG - Intronic
1091555779 12:1572544-1572566 CCCCATTCCCAGAGAGGCCGTGG + Intronic
1091611563 12:2014858-2014880 CTCCAAGGCCAGTGGGGACAAGG - Intronic
1096186829 12:49587065-49587087 CTACAAGCCCAGAGAGGCAAAGG + Intronic
1096189219 12:49604270-49604292 CTCCCCTCCCAGAGGAGGCACGG + Intronic
1096556409 12:52406679-52406701 CTCTAATCCCAGAGAAGCCAGGG - Intergenic
1096788034 12:54029112-54029134 CTCCAATCCGTCAGGGGCCAAGG - Intronic
1100256087 12:92884596-92884618 CTCCACCACCATAGGGGCCAGGG - Intronic
1100274465 12:93059146-93059168 CTCCCAGCCCAGAGGGGCAGAGG + Intergenic
1100333937 12:93612012-93612034 CTCCAATCCCAGAAATGACAAGG - Intergenic
1102328606 12:112011020-112011042 CTCCAATCTCAGAGCGGGCTTGG - Intronic
1102762078 12:115396583-115396605 CTGCAGTCCCATATGGGCCATGG - Intergenic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1103321793 12:120096515-120096537 CTCCAAACCCAGGGCAGCCATGG - Exonic
1104887227 12:132117706-132117728 CTCCAATCACAGAGCAGCCAGGG + Intronic
1105529993 13:21210602-21210624 CTCCCACCCCAGAGGGAGCAGGG - Intergenic
1105708238 13:22981947-22981969 CTCCCAGCCCAGGGGGGCCCGGG + Intergenic
1105899349 13:24742348-24742370 CTCCCATCCCAGACATGCCAAGG + Intergenic
1108091274 13:46852466-46852488 CTCCAAACACACAGGGGCTAAGG - Intronic
1108498420 13:51046684-51046706 CCCCAGGCCCAGAGGGGACAAGG - Intergenic
1111178925 13:84636261-84636283 CTGCTATGCCAGAGGGGCCCAGG - Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113054842 13:106257078-106257100 TTCCATTCCCAGAGAAGCCAGGG + Intergenic
1115382814 14:32758859-32758881 TTCCAATGCCAGAGGAGCCTTGG - Intronic
1118600897 14:67470929-67470951 CCCCAATCCCTTAGTGGCCAGGG - Exonic
1118740526 14:68736618-68736640 CTTCATTCCCAGAGAGGCCCTGG + Intergenic
1119646334 14:76351110-76351132 CTCCAGCCCCACAGTGGCCAGGG - Intronic
1119859258 14:77924631-77924653 CTCTAACCCCAGAGGCCCCAGGG - Intronic
1120663499 14:87278644-87278666 TTCCCAGCCCAGAGAGGCCAGGG - Intergenic
1120978006 14:90266530-90266552 CTCAACTCCCACAGGGGCCTTGG - Intronic
1122231734 14:100309533-100309555 CTCCCATCCCAGAGGAGGCAGGG + Intergenic
1124211796 15:27770301-27770323 CCCCAAGCCGGGAGGGGCCAGGG + Intronic
1124254312 15:28128767-28128789 CTCCCTTCCCAGAGGCCCCAGGG + Intronic
1124667447 15:31605444-31605466 CACCCACCCCAGAGGGCCCAGGG - Intronic
1125285724 15:38090469-38090491 CTCCACTCCCAGAGGGGAGGAGG + Intergenic
1126096841 15:45096027-45096049 CTGCAATTCCAGAGGCCCCAAGG - Exonic
1128089131 15:64907075-64907097 ATCCAATGCTTGAGGGGCCAGGG + Intronic
1128529103 15:68431949-68431971 ATCCAAGCCCCGAGGGCCCAGGG + Intronic
1129314377 15:74732321-74732343 CTATAATCCCAGGGAGGCCAAGG - Intergenic
1129315716 15:74742505-74742527 CTCAAAGTCCAGAGGGGCAACGG + Intergenic
1129911819 15:79234338-79234360 GTCCAGTCCTAGAGGGGCCTGGG + Intergenic
1131235444 15:90692876-90692898 CTGTAATCCCAGCGGGGCCGAGG - Intergenic
1134570379 16:15285455-15285477 CTGTAATCCCAGGGTGGCCAAGG + Intergenic
1134731998 16:16470598-16470620 CTGTAATCCCAGGGTGGCCAAGG - Intergenic
1134850427 16:17474295-17474317 CTCCACTCCCTCAGGGGCCAGGG + Intergenic
1134935440 16:18241365-18241387 CTGTAATCCCAGGGTGGCCAAGG + Intergenic
1135843111 16:25894435-25894457 CAGAAATCCCAGAGGGGCCGGGG - Intronic
1136114526 16:28086526-28086548 CTCCACCACCAGAGGTGCCATGG + Intergenic
1137713149 16:50581111-50581133 CCCCAATCCCATAGGAGCTAAGG - Intronic
1138029397 16:53547977-53547999 CTCACATCTGAGAGGGGCCAGGG + Intergenic
1138344393 16:56311331-56311353 CTCCTAACCCAGTGGGGGCAGGG - Intronic
1139580475 16:67870661-67870683 CTCAAATCCCAGTGTAGCCAAGG - Intronic
1143275708 17:5708222-5708244 GTCCAATACCAATGGGGCCAGGG - Intergenic
1143478441 17:7215956-7215978 CTCCAGTCCCAGAGTCTCCAAGG + Intronic
1144623923 17:16834789-16834811 CTCTGATCCCAGAGTGACCAGGG - Intergenic
1144798616 17:17910290-17910312 CTCACATCCCAGAGGGGGAAGGG - Intronic
1144882506 17:18437927-18437949 CTCTGATCCCAGAGTGACCAGGG + Intergenic
1145149728 17:20506459-20506481 CTCTGATCCCAGAGTGACCAGGG - Intergenic
1145235483 17:21205144-21205166 CCCACATCCCAGAGGGGCCGTGG - Intronic
1146206383 17:30908550-30908572 CTACAAACCCAGAAAGGCCAAGG + Intronic
1147265270 17:39231027-39231049 GTCCAAGCCCAGCAGGGCCAGGG + Intergenic
1148071936 17:44913785-44913807 CTCCAGATCCAGACGGGCCAGGG + Exonic
1151850865 17:76688805-76688827 CTTCAATCCCACAGAGCCCATGG - Intronic
1152087923 17:78231732-78231754 CTCCAATCCCAGCGTCCCCACGG - Exonic
1152112734 17:78366066-78366088 CTCCACCCACAGAGGGGCCCTGG + Intergenic
1152276841 17:79362956-79362978 CTCCAACCCTAGAGGGGTCCTGG - Intronic
1152352221 17:79790313-79790335 CTCCAGGCCCAGAGGAGCCTCGG - Intergenic
1152698312 17:81806979-81807001 CCCCCAACCCAGAGGGGCCCTGG - Intronic
1156543852 18:37944433-37944455 CTCAAATCACCAAGGGGCCAGGG - Intergenic
1158072643 18:53491514-53491536 CTCCAATCCCCGAGAGGCCTTGG + Intronic
1161207902 19:3051383-3051405 CCCAAGTCCCAGAGGAGCCAGGG + Intergenic
1161560825 19:4971624-4971646 CTCTAAACCCACAGGAGCCAGGG - Intronic
1161586474 19:5108458-5108480 ACCCAGTCCCAGGGGGGCCATGG - Intronic
1163064319 19:14782017-14782039 CTGTAATCCCAGAGAGGCCGAGG + Intergenic
1163676420 19:18657710-18657732 CTCCACTCCCACGGGAGCCAAGG + Intronic
1163825807 19:19524221-19524243 CGCCAACCACAGGGGGGCCAAGG - Intronic
1164548232 19:29186520-29186542 CTCAAATCCCAGAGGCACTAAGG - Intergenic
1164729179 19:30489138-30489160 TTCCAAACCCAAAGGGGACAAGG + Intronic
1164758014 19:30704707-30704729 CTGCAGTCCCAGAGGTGACAAGG - Intronic
1164931359 19:32178599-32178621 AGCCAATCCCAGACGTGCCAGGG + Intergenic
1166484098 19:43198219-43198241 CTTAAATCCCAGGGAGGCCATGG - Exonic
1167013886 19:46826980-46827002 CTCCATCACCATAGGGGCCAGGG + Intergenic
1168353351 19:55688514-55688536 CTCCCATCCCCCAGGGGCCCAGG + Intronic
1168421614 19:56207799-56207821 CCCCAATGCCAGTGGTGCCAGGG + Intronic
1168426862 19:56245960-56245982 CCCCAATGCCAGTGGTGCCAGGG + Intronic
925109225 2:1319503-1319525 CTCTCATCCCAGGGGTGCCACGG - Intronic
925891831 2:8440563-8440585 CTCCAATGCCCAAGGGCCCATGG + Intergenic
927862956 2:26571400-26571422 CTCCAACCCAAGTGGGACCATGG - Intronic
928027742 2:27753630-27753652 CCCTAATCCCAGATGAGCCAGGG - Intergenic
928875069 2:36028463-36028485 CACCATCCCCAGAGGGGCCTTGG - Intergenic
929997703 2:46839265-46839287 CTTCAATCCAAGAGGAGCCTGGG - Intronic
930990680 2:57650506-57650528 CCTCAATTCCAGAGGGACCATGG - Intergenic
931433409 2:62227915-62227937 CTCCAATCCCACAGTGGCAGTGG - Intergenic
934933921 2:98451087-98451109 TTCCAATCCCAGACAGGCTATGG - Intronic
935737644 2:106119223-106119245 CTCCAAGTCCAAAGGCGCCAAGG - Intronic
937916669 2:127102652-127102674 CCCCAATCCCCCAGGGGCCCTGG - Intronic
938200985 2:129373028-129373050 CACCAGTCCCATAGAGGCCAAGG + Intergenic
942566427 2:177268711-177268733 CTATAATCCCAGGGAGGCCAAGG + Intronic
944579357 2:201118421-201118443 CTCCAATGCCCCAGGGGCCTAGG - Intronic
944885563 2:204059067-204059089 CTCTGATCCCAGAGGGGCTCTGG + Intergenic
948146097 2:235709256-235709278 CTCCCTTCCCACAGGTGCCAGGG - Intronic
948897516 2:240934219-240934241 CTCCAAGCCCAGGGAGGCCCAGG - Intronic
948930182 2:241127012-241127034 CTGCCATCCCAGAGGGGCTGGGG + Exonic
948987856 2:241536336-241536358 CTCAGATCCCAGAGGGAACAGGG + Intergenic
1173017086 20:39235507-39235529 CTCCAATCCCAGAGGATTCCTGG - Intergenic
1174067794 20:47878352-47878374 CTGCAAGCCCAGAGGTGCCCAGG + Intergenic
1175401152 20:58700849-58700871 CCCCAATCCCACACTGGCCAGGG + Intronic
1176078604 20:63260530-63260552 CTCCAAAAGCAGAGAGGCCAAGG - Intronic
1178293072 21:31386300-31386322 CTCCATTCCCTGAGAAGCCAGGG - Intronic
1178917997 21:36719770-36719792 CGCCAATCCCAGAGAGGCGGTGG + Intronic
1179179001 21:39029447-39029469 CTCCAATCACTGAGAGCCCAGGG - Intergenic
1180998200 22:19975874-19975896 CTCCACTCCCACAGGTGCCCAGG - Intronic
1182799942 22:33023789-33023811 CAACAATCACAGAGGGGCCCAGG - Intronic
1183192568 22:36331177-36331199 CTTCATTCCCAGAGAGGTCAAGG - Intronic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1185225098 22:49647707-49647729 ATCCCAACCCAGAGGGCCCAGGG + Intronic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953673225 3:44980014-44980036 CCCCTATTCCAAAGGGGCCAGGG + Intronic
954173605 3:48825263-48825285 CTCTAATCCCAAGGAGGCCAAGG - Intronic
955779049 3:62463850-62463872 ATTCAATCCCAGAGGTGCGATGG - Intronic
956258624 3:67311816-67311838 CTCTAATCTCAGGGGAGCCAAGG + Intergenic
958457922 3:94356456-94356478 ATCCAATCCCAGTGGCACCACGG - Intergenic
961667020 3:128498881-128498903 CCCCTATCCCAGAGGGGCCTGGG + Intergenic
961720973 3:128895777-128895799 CTCCAAGCCCAGTGGGGAGAAGG - Intronic
967864773 3:194181206-194181228 CTCCAATCCCACTGCGGCCCAGG - Intergenic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
969392554 4:6901236-6901258 CTCCAGCCACAGAGGGGCCTTGG + Intergenic
971054419 4:22896569-22896591 CTACAAACCAAGGGGGGCCACGG - Intergenic
973686703 4:53377691-53377713 CTCCAATCCCAGGAAGGCGACGG - Exonic
975381470 4:73705208-73705230 ACCCAATCTCAGAGTGGCCATGG + Intergenic
975416367 4:74109756-74109778 CTCCCATCTCAGAGTGGCCAAGG + Intergenic
982366675 4:154586480-154586502 CTCCAGTCCCAGAGCTCCCAGGG + Exonic
984679396 4:182590123-182590145 TTCCAATCCCAGGGAGGCCCAGG + Intronic
985850842 5:2388174-2388196 CTCCACTGCCAGTGGGGCCCAGG + Intergenic
990279271 5:54232178-54232200 CTCTAATCCCAGAGGGGAAAGGG - Intronic
991425895 5:66491404-66491426 ATCCAATTCCACAGGGGCTAAGG - Intergenic
994520128 5:100823219-100823241 CTACACTCCCACAAGGGCCATGG + Intronic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997500323 5:134368785-134368807 CTGTAATCCCAGGGAGGCCAAGG + Intronic
997852920 5:137348456-137348478 CTGCAATCCCAGAGGGGTGGGGG + Intronic
998156634 5:139790477-139790499 CTCCAATGCCAGAGCTCCCAGGG - Intergenic
998390542 5:141784434-141784456 CTCCCATCCCATAGGAGCCTGGG + Intergenic
1001293928 5:170485637-170485659 TTCCCTTCCCAAAGGGGCCAGGG + Intronic
1001724402 5:173884948-173884970 CTCAAACCCCAGAGGGGGCTGGG + Intergenic
1002071998 5:176684520-176684542 CTCAAATCCCAGATTAGCCATGG + Intergenic
1003682524 6:8269973-8269995 CTGCCATGCCAGAGAGGCCATGG - Intergenic
1004449895 6:15735573-15735595 CTTCTACCCCAGAGAGGCCAGGG + Intergenic
1009742083 6:67758731-67758753 CTCTAGTCCCAGAGGACCCAGGG + Intergenic
1010865724 6:80974889-80974911 CTCCAGTCTCAAAGGGGCCCAGG + Intergenic
1011092149 6:83615569-83615591 CTCCAATCTCAGCGTGGCCGGGG - Intronic
1011128061 6:84028262-84028284 CCCCAACCCCAGAAGGGCCCAGG + Intergenic
1012519926 6:100109206-100109228 CACCTGTCCCAGAGGTGCCATGG - Intergenic
1013054287 6:106568300-106568322 CTCTCATCCCACAGGGGCCCAGG + Intronic
1013873536 6:114796737-114796759 CTCCAACCCTTGAGGGGCCTGGG + Intergenic
1015414869 6:132936882-132936904 CTCCAATCACAGAGTACCCAGGG + Intergenic
1015791700 6:136969847-136969869 CTCCCGTCCCAGAGGGCCTACGG - Intergenic
1016102599 6:140120724-140120746 CCCCACTCCCTGAGAGGCCATGG - Intergenic
1017882215 6:158569859-158569881 CTGCAATCCCAGAAAGGGCATGG - Intronic
1019017109 6:168888026-168888048 CCCCACCCCCAGATGGGCCAGGG - Intergenic
1021355683 7:19651191-19651213 CTGCAATGGCAGAGGGGCTATGG - Intergenic
1021927837 7:25550416-25550438 CTTTAATCCCAGAGGGGAGAAGG - Intergenic
1023089186 7:36601807-36601829 AACCAAGCACAGAGGGGCCAGGG + Intronic
1023870277 7:44259503-44259525 CTCCAATTCCAGAGCTGGCATGG + Intronic
1024272532 7:47653560-47653582 CCCCAAGGCCAGAGGGTCCAAGG - Intergenic
1024308228 7:47945945-47945967 CTCCACTCACAGAGGCGCCAAGG + Intronic
1025094733 7:56088283-56088305 CTGCAATACCAGGGAGGCCAAGG - Intronic
1026501448 7:70946487-70946509 CTCCCTTCCCAGAGGAGCCTTGG + Intergenic
1027266303 7:76496936-76496958 CTCCAAGCCAGGAGGGCCCAGGG + Intronic
1027317683 7:76995054-76995076 CTCCAAGCCAGGAGGGCCCAGGG + Intergenic
1028771732 7:94632398-94632420 CTTCAAACCCAGGAGGGCCATGG - Intronic
1031973825 7:128081663-128081685 CTCCAAGCCCAGAGGAGCAGTGG - Intronic
1033023843 7:137754062-137754084 CTAGAATCCAAGAGGGGTCATGG + Intronic
1033254517 7:139788671-139788693 ATCCAATCCCAATGGTGCCATGG - Intronic
1033683815 7:143621028-143621050 TTCCAATCCCAGCGGGTCCTGGG + Intronic
1033700797 7:143836610-143836632 TTCCAATCCCAGCGGGTCCTGGG - Intergenic
1033956406 7:146854188-146854210 CTCCAATCCAAGCTGGACCAGGG + Intronic
1034434108 7:151054985-151055007 CTCCCCTCCCAGAGGGCTCAAGG + Intronic
1035240232 7:157524335-157524357 CTCCAGTCCCAGAGCTGCCTCGG - Intergenic
1037760761 8:21739996-21740018 CTCCAAGCCCAGGGAGGACATGG + Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039622092 8:39007262-39007284 ATGCCATCCCTGAGGGGCCAGGG - Intronic
1039905321 8:41781983-41782005 CTCCATTCCCAGTTTGGCCAGGG - Intronic
1040286840 8:46104789-46104811 CTCCAATCCCAGAAGCACCCAGG - Intergenic
1040292474 8:46132479-46132501 CTCCCATCCCAGAAGCTCCAGGG - Intergenic
1040303911 8:46202328-46202350 CTCCCATCCCAGAAGCCCCAAGG + Intergenic
1040305417 8:46209381-46209403 CTCCAATCCCAGAAGCCCCCAGG + Intergenic
1040324759 8:46336080-46336102 CTCCCATCCCAGATGCCCCAGGG + Intergenic
1040330014 8:46381123-46381145 CTCCAATCCCAGAAGCCCCCAGG + Intergenic
1040333262 8:46403188-46403210 CTCCCATCCCAGAAGCCCCAGGG + Intergenic
1040333603 8:46404876-46404898 CTCCAATCCCAGAAGCCCCCAGG + Intergenic
1040334288 8:46408255-46408277 CTCCAATCCCAGAAGCCCCAGGG + Intergenic
1040335168 8:46412441-46412463 CTCCAAACCCAGAAGCCCCAGGG + Intergenic
1040335321 8:46413093-46413115 CTCCAATCCCAGAAGCCCCCAGG + Intergenic
1040338260 8:46427108-46427130 CTCCCATCCCAGAAGCCCCAAGG + Intergenic
1040338363 8:46427536-46427558 CTCCCATCCCAGAAGGCCCCAGG + Intergenic
1040338412 8:46427753-46427775 CTCCCATCTCAGAAGGCCCAGGG + Intergenic
1040339047 8:46430746-46430768 CTCCCATCCCAGAAGGCCCAGGG + Intergenic
1042358985 8:67860921-67860943 CTGTAATACCAGAGGGGTCAAGG - Intergenic
1042679166 8:71361778-71361800 CTCCACTCCCAGAAGCGCCGCGG - Exonic
1044925825 8:97208075-97208097 CTCCATTTCCAGTGGGGCCAAGG - Intergenic
1048379190 8:133849319-133849341 CTGCAGTCCCAAAGGGCCCAAGG - Intergenic
1048953383 8:139514394-139514416 GTTGACTCCCAGAGGGGCCATGG + Intergenic
1049180444 8:141219456-141219478 CACCAAGCACAGTGGGGCCAAGG - Intronic
1049267107 8:141674067-141674089 CTCCACACCCGGAGGGGACAGGG - Intergenic
1049403696 8:142442386-142442408 CTCCTCTCCCAGAGAGGGCAGGG + Intergenic
1049587000 8:143436889-143436911 CTGGAATCCCAGCAGGGCCAAGG + Intergenic
1050641674 9:7675110-7675132 TTCCTAACCCAGAGGGTCCATGG - Intergenic
1056644456 9:88398822-88398844 CTGTAATCCCAGGGAGGCCAAGG - Intronic
1056663314 9:88560412-88560434 CTCCAATTCCAGAGATGCCCCGG - Intronic
1056804533 9:89718401-89718423 CTCCACTCCCAGAGGTGCCAAGG + Intergenic
1057354319 9:94321798-94321820 CTCCCATCCCAGCCTGGCCAGGG - Intronic
1057653445 9:96935837-96935859 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1057880888 9:98791922-98791944 CTCCACTCCCAGAGTGGAAAAGG + Intronic
1059744923 9:117190635-117190657 CTCCAATCACACTGGTGCCAGGG + Intronic
1061052152 9:128203341-128203363 CTCCGATCCCCGAGGGGCGGGGG + Intronic
1061055663 9:128221539-128221561 CTTTAAACCCAGAGGGTCCAAGG + Intronic
1061232178 9:129321353-129321375 CGCCAGTCCCGGAGGGGCCCAGG - Intergenic
1203377248 Un_KI270442v1:385561-385583 CCCCAGTTCCAGAGGAGCCAGGG + Intergenic
1188653877 X:32666361-32666383 CTCCACTCCCAGACAGGCGATGG + Intronic
1189175994 X:38957757-38957779 CCCCACTCACAGAGAGGCCATGG + Intergenic
1193773826 X:85619804-85619826 CTGCAATGGCAGAGGGGCTATGG - Intergenic
1197224811 X:123946144-123946166 CTGTAATCCCAGAGAGGCCGAGG - Intergenic
1198823343 X:140673045-140673067 CTGCAATCCCAGAGTGTTCAAGG + Intergenic