ID: 968912256

View in Genome Browser
Species Human (GRCh38)
Location 4:3482356-3482378
Sequence GGCCCAGGAAAGCACTGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968912246_968912256 15 Left 968912246 4:3482318-3482340 CCCTCGGGCAGTGGCATTTGGCT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG 0: 1
1: 0
2: 1
3: 23
4: 268
968912244_968912256 23 Left 968912244 4:3482310-3482332 CCTGGGGTCCCTCGGGCAGTGGC 0: 1
1: 0
2: 3
3: 23
4: 252
Right 968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG 0: 1
1: 0
2: 1
3: 23
4: 268
968912247_968912256 14 Left 968912247 4:3482319-3482341 CCTCGGGCAGTGGCATTTGGCTA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG 0: 1
1: 0
2: 1
3: 23
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968912256 Original CRISPR GGCCCAGGAAAGCACTGTGC CGG Intronic
900251838 1:1675016-1675038 GGCCCAGGACAGGCCTGTGGTGG + Intronic
900262245 1:1737872-1737894 GGCCCAGGACAGGCCTGTGGTGG + Intronic
900520820 1:3104751-3104773 GGCCCAGGAATGCACAGCGAGGG - Intronic
901014001 1:6217407-6217429 AGCTCTGGTAAGCACTGTGCTGG - Intronic
901290266 1:8118537-8118559 GGCCCAGGTGAGCACACTGCAGG - Intergenic
901428911 1:9200484-9200506 GGACTAGAAAAGCACTCTGCAGG - Intergenic
902425188 1:16315352-16315374 GGACCAGGAAGAAACTGTGCTGG - Exonic
902686453 1:18080635-18080657 GGCCCAGGAAAGCAGCGAGCCGG - Intergenic
903225692 1:21893210-21893232 GGCCCAGGATTGGCCTGTGCTGG + Intronic
904028987 1:27522297-27522319 TGCCCAGGAAGGCACAGTACTGG + Intergenic
904476640 1:30769297-30769319 GGCCCAGGAAAGTACCGTGACGG - Intergenic
904605852 1:31697175-31697197 TGCCCAGGGACACACTGTGCTGG - Intronic
905413234 1:37786580-37786602 GGCCCAGGAAAGCAGAAGGCAGG - Intergenic
905777156 1:40675956-40675978 TGGCCAGGAAAGCCATGTGCAGG + Intergenic
906342363 1:44991919-44991941 GTGACAGGAAAGCCCTGTGCAGG - Intergenic
906794326 1:48684951-48684973 GGCCTGAGAAAACACTGTGCAGG + Intronic
907531466 1:55102344-55102366 TACCCAGAAAAGCACTGTACTGG - Intronic
908527616 1:65002834-65002856 GTCCCAGGAAAGCGCTGTGGCGG + Intergenic
908940873 1:69431798-69431820 GGCCCTGGAGACCACTGTCCTGG - Intergenic
910139197 1:84008048-84008070 AGGCCAAGAAAGAACTGTGCAGG - Intergenic
910585584 1:88875832-88875854 GTCTCAGTTAAGCACTGTGCTGG - Intronic
913089738 1:115468462-115468484 GCCCCAGGAAAAAACTGTGCAGG + Intergenic
913322797 1:117600955-117600977 GGCCCAGGAAAACACCATGAAGG - Intergenic
914490381 1:148147477-148147499 GGCCCAGGCAAGCACAGGGCTGG - Intronic
915142606 1:153776586-153776608 GGCCCAGGAACCCACCCTGCTGG + Exonic
915714421 1:157930978-157931000 GACCCAGTAAAGTACTGTTCAGG - Intergenic
920528076 1:206683612-206683634 GCCCCAGGAAAGGACAGTGTTGG + Intronic
920811217 1:209287674-209287696 GGCCCAGGTTATCTCTGTGCTGG + Intergenic
921286393 1:213613473-213613495 GGCCCAGAAAGGGACTGTGGTGG + Intergenic
921520955 1:216153204-216153226 GTACCAAGAAAGCACTGAGCTGG + Intronic
1063100292 10:2944599-2944621 ACCCCAGGAAAGGACTGTGCTGG + Intergenic
1063541592 10:6939540-6939562 ATCCCAGGAAACCACTGTGTGGG + Intergenic
1064188957 10:13188670-13188692 GTCCCCTGAAAGCACTGTTCTGG - Intronic
1067922729 10:50476667-50476689 GGCCTAGGACACCACTGCGCTGG + Intronic
1069651736 10:70053877-70053899 GGCGCAGGAAAGGGCTCTGCCGG + Intronic
1070526305 10:77298764-77298786 GGCACTGGAAAGAACTCTGCTGG - Intronic
1070961264 10:80501817-80501839 GACCCAGGCAAGCACTGTCCTGG + Intronic
1071036076 10:81247323-81247345 GGTTCAGGAAAGTACTGAGCCGG - Intergenic
1071187046 10:83058173-83058195 GACTCAGGAAATCACTGTGAGGG + Intergenic
1071601374 10:86960148-86960170 GGCCCAGGAGAGGACTGGGCAGG - Intronic
1072421756 10:95295546-95295568 GACACAGGATAGCACTGGGCGGG - Intergenic
1072763658 10:98079024-98079046 GAGCCAGGCAGGCACTGTGCTGG + Intergenic
1073468152 10:103706397-103706419 GGCCCAGGACAGCATTGGTCCGG - Intronic
1073476322 10:103756317-103756339 GACCCAGGAGGGCAGTGTGCGGG + Intronic
1073749438 10:106507319-106507341 GGCTTAGGGAAACACTGTGCTGG + Intergenic
1074355454 10:112778909-112778931 GGCACAGGAAAGAAATATGCAGG + Intronic
1075378494 10:121998683-121998705 GCCTCAGGAGAGCTCTGTGCTGG + Intronic
1075651354 10:124129833-124129855 GGACCAGGACAGGCCTGTGCAGG - Intergenic
1075839942 10:125492982-125493004 GGGACATGAAAGCACTGTGTGGG + Intergenic
1075850239 10:125580848-125580870 GTCCCAGGAAAGGACTCTGATGG - Intronic
1075968033 10:126629804-126629826 AGCCCGGCAAAGCACTGTCCAGG + Intronic
1076934313 10:133557196-133557218 GCCCCAGGAGGGCACTGGGCTGG + Intronic
1077011931 11:382692-382714 GGCCCAGGCCAGGACTGAGCTGG - Intergenic
1077347932 11:2072940-2072962 GGCCCAAGAAGGGCCTGTGCTGG - Intergenic
1077384795 11:2263729-2263751 GGCTCAGGACAGCACTGGACAGG + Intergenic
1077399149 11:2344733-2344755 GGACCAGGATTGCACTTTGCTGG - Intergenic
1077516087 11:3002958-3002980 TGACCAGGACAGCACTGTGAGGG + Intronic
1078467130 11:11558714-11558736 TGGCCAGGAAAGCACTTTGCAGG + Intronic
1079400940 11:20105791-20105813 TGGCCAGGACAGCACTTTGCAGG + Intronic
1080124574 11:28717829-28717851 GCCCCTGGAAAGCAATGTGGAGG - Intergenic
1084423303 11:69071265-69071287 GGCACAGGATAGCACAGCGCCGG - Intronic
1084544107 11:69805352-69805374 CACCCTGGAGAGCACTGTGCAGG + Intergenic
1084566385 11:69931166-69931188 GGCCCAAGATAGCCCCGTGCAGG - Intergenic
1085463653 11:76710075-76710097 GGCCTAGGAAAGCACACAGCAGG + Intergenic
1085698914 11:78729131-78729153 GGCCCTGAAAAGTGCTGTGCTGG - Intronic
1086919496 11:92570200-92570222 GACACTGGAAAGCACTGTGAGGG - Intronic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1090666275 11:128916890-128916912 GGCTCAGGGAGGCCCTGTGCTGG - Exonic
1091293164 11:134453707-134453729 GGCTCTGGCCAGCACTGTGCCGG + Intergenic
1094072466 12:26432983-26433005 GGAGAAGGAAAGCTCTGTGCTGG - Intronic
1095701437 12:45194911-45194933 AGTGCAGGAAAGAACTGTGCAGG - Intergenic
1096414477 12:51401657-51401679 GGCACAGGATAGGACTGTGGTGG + Intronic
1099028126 12:77491542-77491564 GGCCCAGGCAGGCACAATGCTGG - Intergenic
1101462567 12:104911801-104911823 GGCCTAAGAAAGCACTGGGTGGG + Intronic
1101918253 12:108912569-108912591 GGCCGAGGAATGCACGGTGCAGG - Exonic
1102008813 12:109605806-109605828 GGTTGAGGAGAGCACTGTGCAGG + Intergenic
1102205730 12:111089612-111089634 GGGCCTGGAAAGCCCTCTGCAGG + Intronic
1102574948 12:113850302-113850324 TACCCAGGAAAGCTCTGAGCAGG + Intronic
1102651865 12:114448032-114448054 GGCCCAGGAATGCACAGTAGTGG + Intergenic
1103700259 12:122845528-122845550 GCCCCAGGAATGCAGTGTGACGG - Intronic
1103944049 12:124516559-124516581 CACCCAGGCCAGCACTGTGCGGG + Intronic
1104072937 12:125362214-125362236 GGCACAGGGAAGCGCTGAGCAGG - Intronic
1109729891 13:66398945-66398967 GGCCCTGAATAGCACTGTGCAGG + Intronic
1111404325 13:87782596-87782618 GCCCCAGGAAAGAAATGTGTGGG - Intergenic
1112376533 13:98847255-98847277 GTCACAGAAAGGCACTGTGCTGG - Intronic
1114716636 14:24833207-24833229 GGCAGAGGAAAGGAGTGTGCAGG - Intronic
1115380550 14:32733264-32733286 AGACCAGGATGGCACTGTGCAGG + Intronic
1116365030 14:44049338-44049360 GCCCCAGGAAAGCACTATTGGGG + Intergenic
1116583300 14:46670265-46670287 GGGTCAGGAAAGGACTCTGCAGG + Intergenic
1117052979 14:51880687-51880709 GTCCCAGGAAAGCCCTGTCTTGG - Intronic
1117297936 14:54396237-54396259 GGCTCAGGGAAGCACTGTATTGG - Intergenic
1117555188 14:56876702-56876724 GGTGCTGGAAACCACTGTGCTGG + Intergenic
1119038283 14:71249060-71249082 GGCCCAGGAAATAAGTGTGTAGG - Intergenic
1119284645 14:73443114-73443136 GGCCTCCCAAAGCACTGTGCTGG + Intronic
1119559451 14:75578612-75578634 GGCCCGGGAGAGGACTCTGCGGG + Exonic
1121585600 14:95060937-95060959 GGACCAGGAGAGCCCTGGGCGGG + Intergenic
1121608483 14:95259199-95259221 GGGCTAGGAAAGCAGTGGGCCGG + Intronic
1122264792 14:100541532-100541554 GGCCCAGGGAGGCACTGAGAGGG - Intronic
1122339432 14:101018735-101018757 GGGGCAGGAAAGGGCTGTGCTGG - Intergenic
1122623838 14:103074269-103074291 GTCCCAGGACAGCACTGGGGCGG - Intergenic
1122693771 14:103543231-103543253 GGCCCAGGCAGGCCCTGTGAGGG + Intergenic
1122938150 14:104969386-104969408 GGCCCAGGCAGGCACAGTGAGGG - Intronic
1122954842 14:105065808-105065830 GGGCCAGGCAAGCACGGAGCAGG + Intergenic
1123714022 15:23013526-23013548 GGCCCAGGAGGGCAGTGTGGAGG + Intronic
1123981378 15:25607715-25607737 GGACCTGGAAAGTTCTGTGCTGG + Intergenic
1124291585 15:28457030-28457052 GGCCCAGGAAAGCGCAGGGCTGG + Intergenic
1124403108 15:29367626-29367648 TGCCCAGGAAAGCCCTGAGAAGG + Intronic
1124955786 15:34359517-34359539 CATCCAGGAAAGCACTGGGCTGG - Intronic
1125958081 15:43804887-43804909 CCCACAGGAAAGCACTGTCCAGG - Exonic
1126778762 15:52120538-52120560 GGCCCAGGGAAGCACATTCCAGG - Exonic
1128063137 15:64747761-64747783 GGGCCAGGAAGGCTCTGTGTGGG - Intronic
1128612881 15:69087987-69088009 AGACCAGGACAGCACTGTGAAGG + Intergenic
1129673812 15:77621744-77621766 GGCACAGGAAAGGAGTGTGGTGG - Intronic
1130082677 15:80747992-80748014 GCAGCAGGAAAGCACTGGGCCGG - Intronic
1131062099 15:89410576-89410598 CGCCCATGACAGCAGTGTGCAGG + Intergenic
1132284476 15:100651961-100651983 GGCCCAAGAAGGCCCAGTGCTGG - Intergenic
1132405018 15:101536681-101536703 GCCCCAGGACAGCGCTGAGCTGG - Intergenic
1136267359 16:29129605-29129627 TGCCCAGGACGGCCCTGTGCTGG + Intergenic
1136366536 16:29811726-29811748 GGCCCTGGAAAGGACGGAGCGGG - Intronic
1136707194 16:32200640-32200662 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1136760716 16:32728777-32728799 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1136807387 16:33141609-33141631 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1137286822 16:47023076-47023098 GGTCAAGGAAAGCAGTGTCCTGG + Intergenic
1138177017 16:54909625-54909647 GGCCAAGGAGAGCACTGAGGTGG + Intergenic
1138185363 16:54972622-54972644 GGCCAAGGAGAGCACTGAGGTGG - Intergenic
1138298298 16:55905715-55905737 TCCCCAGGAAAACACTGTCCTGG + Intronic
1138346975 16:56326105-56326127 GGGCCAGGACAGGAGTGTGCTGG - Intronic
1138379535 16:56590435-56590457 GGCCCAGGAAAGCCGTGGGGAGG - Intronic
1138418364 16:56884297-56884319 GGCCCTGGACAGCACAGAGCCGG - Intronic
1140407112 16:74718329-74718351 GGCCAAGGACAGCACAATGCAGG + Intronic
1141111901 16:81276638-81276660 GTTCCAGCAATGCACTGTGCTGG - Intronic
1141184169 16:81775237-81775259 GGACCAGGAAAGCAGAGAGCGGG - Intronic
1141321920 16:83018991-83019013 GGCCTAGGACATTACTGTGCAGG + Intronic
1203062868 16_KI270728v1_random:989091-989113 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1143151687 17:4810847-4810869 GGCCCAAGAGATCACTGAGCTGG + Exonic
1143307356 17:5958058-5958080 GTCCCAGGATCGCACTGTGGAGG - Intronic
1144422367 17:15110020-15110042 GGCCAAGGGAAGCACTGGGAAGG - Intergenic
1145001699 17:19309811-19309833 TGCCCAGGAAACTGCTGTGCAGG + Intronic
1145190973 17:20842080-20842102 GGCCCAGGCAAGCGCAGGGCTGG - Intronic
1145999297 17:29121795-29121817 GGCTCAGGAGTGCACTGGGCAGG - Intronic
1149597426 17:57872574-57872596 GGCTCAGGAAAACACTGAGCTGG - Intronic
1151151036 17:72086977-72086999 GGCCCAGGAAAGCTCTGCAACGG + Intergenic
1151355458 17:73555473-73555495 GGCCCAGGAAAGGAAGGGGCTGG + Intronic
1151524923 17:74658522-74658544 GGCTCAGGAAGGGACTGTGGAGG - Intergenic
1151540460 17:74762152-74762174 GGCCCAGGATCGCATTGTGGAGG + Exonic
1152986016 18:321742-321764 GGGCCAGGAGAAGACTGTGCTGG - Exonic
1154139919 18:11814226-11814248 GGCACAGAAAAACACTGGGCCGG + Intronic
1154310201 18:13261421-13261443 GTCCCAGGCAGGCACTGTGCTGG - Intronic
1154376175 18:13811866-13811888 GGCACTTGAAAGCACTGGGCAGG + Intergenic
1154463865 18:14623491-14623513 GGCCCACAAAGGCACTGTGCTGG + Intergenic
1155090977 18:22510904-22510926 TGACCAGGAAAGCACTGAGAAGG - Intergenic
1156611931 18:38735049-38735071 GGCCCTGAACAGCACTGTGCAGG + Intergenic
1157210473 18:45737864-45737886 GCCCCAGATCAGCACTGTGCAGG - Intronic
1158224023 18:55182027-55182049 GGCCCTGGGTGGCACTGTGCTGG - Intergenic
1158395089 18:57073029-57073051 AGCACAGGGAAGCACTATGCTGG + Intergenic
1158949976 18:62485284-62485306 AAACCAGCAAAGCACTGTGCTGG + Intergenic
1159493932 18:69176056-69176078 GGCCCAGGGCAGCACTGTGAAGG - Intergenic
1159763380 18:72456138-72456160 GGGATAGGCAAGCACTGTGCTGG - Intergenic
1159831945 18:73287889-73287911 GGCCCAGAGCAACACTGTGCAGG - Intergenic
1160629293 18:80234177-80234199 GGTCCAGGACATCGCTGTGCTGG - Intronic
1160995229 19:1879343-1879365 GGCCCAGGCAAGCGCAGGGCTGG + Intronic
1163120459 19:15214134-15214156 GTCCCAGGGAAGCAGTGTCCAGG - Intergenic
1163789908 19:19300647-19300669 GGACCAGGAAAGAACTGGGTGGG - Intronic
1164524072 19:29000664-29000686 GGCCCGGGGAAGCATTTTGCAGG - Intergenic
1165285551 19:34838895-34838917 GGTCGAGGAGAGCTCTGTGCCGG + Intergenic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1168176967 19:54633371-54633393 GCCCCAGGAGAGCTCTGGGCTGG + Intronic
1168719633 19:58547900-58547922 TGCCCAGGTAAGCCTTGTGCCGG + Exonic
925176598 2:1788820-1788842 TGCCCAGGGGAGCCCTGTGCTGG + Intergenic
925865955 2:8225959-8225981 GGCCCAGGAAGGCCAAGTGCTGG + Intergenic
927056333 2:19368927-19368949 TGCTCAGGAAACCACTGTGAAGG + Intergenic
927493962 2:23540093-23540115 GGCCCAGGCAAGGACTGAGGAGG - Intronic
928402677 2:30990626-30990648 GCCCCAGGCTAGCACTGTGAGGG - Intronic
931288861 2:60855091-60855113 GGCCAAGAAAAGAACTGTGGTGG + Intergenic
931632775 2:64316198-64316220 TGCCCAGCAAAGCACTTTGGTGG - Intergenic
932413204 2:71559270-71559292 GACCCAGGAAAAGACAGTGCTGG - Intronic
937924906 2:127160600-127160622 GGCCCAGGATAGCGCAGTGATGG + Intergenic
941102212 2:161308662-161308684 GACTCAGGAAAGCACGGGGCTGG - Intronic
941772729 2:169362006-169362028 GCTCCTGGAAAGCACTTTGCGGG - Intronic
943732810 2:191320970-191320992 TGCCCTAGAAAGCACTGTGCTGG - Intronic
943846550 2:192656156-192656178 TGCCCAGAAAAGCCCTGGGCAGG + Intergenic
945992804 2:216410636-216410658 GGCCCAGGAAAGCGAAGTGATGG + Intergenic
946063760 2:216968494-216968516 GGCCCTGGAAAGCTCTAGGCTGG + Intergenic
946495176 2:220189446-220189468 GGGCCAGCAACTCACTGTGCTGG - Intergenic
948334324 2:237195485-237195507 GGCATATGAAAACACTGTGCAGG + Intergenic
948766297 2:240222887-240222909 GGCCAAAGACAGCACTATGCAGG - Intergenic
1171248647 20:23632773-23632795 GGCAAAGGGAAGGACTGTGCAGG + Intronic
1173361139 20:42345781-42345803 GGCTCAGGAAAGAACTATGAAGG + Intronic
1175245208 20:57578070-57578092 GGCCCAGCACTGCACTGCGCTGG + Intergenic
1175604239 20:60299259-60299281 GGACCAGGAATGCAGGGTGCGGG + Intergenic
1175825237 20:61933366-61933388 GGCACAGGGCAGCACTGGGCTGG - Intronic
1175902206 20:62364437-62364459 GGCCCAGGCAGGGACTGAGCAGG - Intronic
1176101246 20:63365504-63365526 GGCCCAGGAGAGGACTGAGGAGG + Intronic
1176810666 21:13534882-13534904 GGCCCACAAAGGCACTGTGCTGG - Intergenic
1177290304 21:19103027-19103049 GGACCAGGAGAGCACTGGGTAGG - Intergenic
1178818160 21:35950540-35950562 GCCCCATCTAAGCACTGTGCAGG + Intronic
1181121302 22:20669883-20669905 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181263969 22:21619369-21619391 GGGCCTGGAAAGCTCTCTGCAGG - Intronic
1181334258 22:22116908-22116930 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181337029 22:22144454-22144476 GAGCCAAGAAAGCAGTGTGCAGG - Intergenic
1183623161 22:38986570-38986592 GGCCCAGGAAAGCAGGGAGGAGG - Intronic
1184262810 22:43329102-43329124 GGCCCAGGACAGCACTGGCATGG - Intronic
1185029606 22:48434746-48434768 GTCCCTGGAAAGGACTGTGGAGG + Intergenic
1185081946 22:48714350-48714372 GCCCCAGGAGAGCAGTGTGTGGG + Intronic
1185301199 22:50081995-50082017 GACCCAGGACAGCACGGGGCGGG + Intronic
950451703 3:13069067-13069089 GCCCCAGGAAGCCACTGGGCAGG - Intronic
950662788 3:14477109-14477131 GGCCCAGGAACACACAATGCAGG - Intronic
952675516 3:36025847-36025869 TGCTCAGGACATCACTGTGCTGG + Intergenic
955520663 3:59772549-59772571 GGCCCAGGTAGGCACAGGGCTGG + Intronic
960407620 3:117281386-117281408 TGCCCAGGATAGCACTTTCCTGG - Intergenic
961634892 3:128327215-128327237 CTCCCAGGAGAGCGCTGTGCAGG - Intronic
963065204 3:141258211-141258233 GGCCTGGGAAGCCACTGTGCTGG - Intronic
963724955 3:148909437-148909459 GGCACTGGAAAGCACTATGCTGG - Intergenic
964862359 3:161216860-161216882 GACCCAGGCAAGAACTGTGGAGG - Intronic
968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG + Intronic
969056963 4:4408141-4408163 GGCTCAGGAGGGCACTCTGCTGG + Intronic
969426446 4:7127221-7127243 GGCCCAGGAAGGCAGGGCGCAGG - Intergenic
975873671 4:78810288-78810310 CGCCCAGGAAAGAACTGAGAAGG - Intronic
976512980 4:85932059-85932081 CGCAAAGGAAAGCACTCTGCAGG - Intronic
982015609 4:151150588-151150610 GGTCCAAGAAAGCAGTGTGCTGG + Intronic
982209620 4:153023805-153023827 GGCCCAGGACTCCTCTGTGCTGG + Intergenic
985881844 5:2644328-2644350 CGTGGAGGAAAGCACTGTGCAGG - Intergenic
985915144 5:2912362-2912384 AACTCCGGAAAGCACTGTGCAGG - Intergenic
986252392 5:6072277-6072299 AGCCCTGGAAAGCATTATGCGGG + Intergenic
986566568 5:9121795-9121817 GGGCCAGGAAAGTAAAGTGCAGG - Intronic
989123212 5:38025618-38025640 GGCCCATAAAACCACCGTGCAGG - Intergenic
990451194 5:55933186-55933208 GGGCCAGGAGAGGACTGAGCTGG + Intergenic
990788414 5:59449330-59449352 GGCCCAGGAAAAGTTTGTGCTGG + Intronic
997286443 5:132682134-132682156 GGCCCAGTAGAGCACCGGGCAGG + Intronic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1002670422 5:180861632-180861654 GGCGCAGGACAGCGCTGGGCTGG + Intergenic
1002916790 6:1535623-1535645 GGCCCAGGAAAAGACTGTCAAGG - Intergenic
1004664906 6:17740838-17740860 GCCCCAGGGAAGCAGAGTGCTGG + Intergenic
1008504234 6:52213640-52213662 GCTCCAGGAAGGCACTGGGCAGG - Intergenic
1009391671 6:63151742-63151764 AGACCAGGATAGCACTGTGAAGG + Intergenic
1010908306 6:81520677-81520699 GGGCAAGGAAAGCAATGTGTTGG - Intronic
1019221866 6:170479452-170479474 GGCCCAGAAGAGCAGTGTGGAGG - Intergenic
1019275256 7:172743-172765 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275268 7:172773-172795 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275280 7:172803-172825 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275305 7:172863-172885 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275317 7:172893-172915 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275329 7:172923-172945 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019275341 7:172953-172975 GGCCCAGGTCAGCCCAGTGCGGG + Intergenic
1019721859 7:2577167-2577189 GGCCCAGGGAAGCACTGAGCTGG - Intronic
1023512116 7:40964452-40964474 GGTTCAGGAAAGCACAGTCCAGG + Intergenic
1024231553 7:47367521-47367543 TGCACAGAAAGGCACTGTGCTGG + Intronic
1024976970 7:55122363-55122385 GGCCCAGGCATGGACTTTGCAGG - Intronic
1025015109 7:55433124-55433146 TGCCCTGGAGAGCACCGTGCTGG - Exonic
1025077431 7:55955068-55955090 GTGACAGGAAAGCCCTGTGCTGG + Exonic
1027569580 7:79847363-79847385 GGACCAAGAAGGCACTGAGCTGG + Intergenic
1028347262 7:89798362-89798384 GCCCCAGCAAAGCAATGTGGTGG + Intergenic
1028635242 7:92981355-92981377 TGCCCAGGAAAGAACTGAGAAGG - Intergenic
1030468282 7:109930374-109930396 GGCCCAGGAAAGCTGAGAGCTGG - Intergenic
1031829388 7:126608156-126608178 GGCCCAGGAAATCAGTGCACAGG - Intronic
1034457835 7:151181031-151181053 GGCCCTGCAGAGCACAGTGCAGG + Exonic
1034844254 7:154429914-154429936 AGGCCAGGAACGCTCTGTGCTGG - Intronic
1035253760 7:157613506-157613528 GGCCCAGGAGAGCAGGGTCCGGG + Intronic
1035264776 7:157684839-157684861 GGCCCAGGAGGGCACAGGGCGGG - Intronic
1036770954 8:11578109-11578131 GGCCCTGGAGAGCACTTTGCAGG + Intergenic
1038474594 8:27856188-27856210 GGCATAGGAAAGTACTGTGTGGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039295762 8:36151829-36151851 GGCCAAAGAATGCACTGTGAAGG + Intergenic
1040634872 8:49261199-49261221 GCCCCAGGGAAGCATTGAGCGGG - Intergenic
1045501907 8:102749926-102749948 GCCCCAACAAAGCACAGTGCGGG + Intergenic
1046546246 8:115653813-115653835 GGCCCTGGAAACCGCTGGGCTGG - Intronic
1048260794 8:132943548-132943570 AGCCCTGGAAAACACTGGGCTGG - Intronic
1048923142 8:139248495-139248517 GGCACAGGAGGCCACTGTGCAGG + Intergenic
1049349006 8:142154129-142154151 GGCCCCGGAAAGCAAGGAGCTGG - Intergenic
1049782336 8:144434722-144434744 GGCCCAGGAATGAACCGGGCTGG + Intronic
1050019855 9:1271596-1271618 GGCACAGGAAAGGGCTGTGGTGG - Intergenic
1051500316 9:17769628-17769650 GGGGCAGGAAAGGACTGTACAGG - Intronic
1052062726 9:23980900-23980922 GGCACAGGAAAGCAGTTTGTAGG + Intergenic
1052766301 9:32644710-32644732 GGCACAGCTAAGCTCTGTGCAGG - Intergenic
1056803829 9:89712898-89712920 AGCCCAGGAAAGCAGGGTGAGGG + Intergenic
1057129351 9:92642232-92642254 GCCCCAGGAGAGTAATGTGCAGG + Intronic
1057271812 9:93655826-93655848 GGGCCGGGAAAGGCCTGTGCTGG + Intronic
1057799135 9:98179322-98179344 GGCCCAGGCCAGCACAATGCTGG - Intronic
1059651833 9:116322455-116322477 CTCCCAGGAAAGCACTGAGGAGG + Intronic
1060542075 9:124437964-124437986 GGAGCAGGAAAGCACTGGGCAGG + Intergenic
1060785597 9:126449615-126449637 GGCCCAGGCCAGCCCTGTCCAGG - Intronic
1061315670 9:129794384-129794406 GGTACAGGAAAGCACAGTGGGGG - Intergenic
1062112045 9:134787322-134787344 GACCCAGGAAACCTCAGTGCAGG - Intronic
1062200075 9:135297939-135297961 GACCCAGGCCAGCACTGCGCTGG - Intergenic
1062461748 9:136665334-136665356 GGCGCAGGTTAGCACTGAGCTGG - Intronic
1062529932 9:136995355-136995377 AGCCCAGGAAGGCGCTGTGGGGG - Intronic
1062562852 9:137149469-137149491 GGCCCAGGGAAGTGATGTGCAGG + Intronic
1186744220 X:12549258-12549280 GGCCCAGGAAAGAAGAGTTCTGG - Intronic
1189083544 X:37997643-37997665 GGCCAAGGACAGCTCAGTGCTGG + Intronic
1193268856 X:79506235-79506257 TGCCCAGACAAGCCCTGTGCAGG - Intergenic
1195086227 X:101416985-101417007 GGCCCAGGTTAGCATGGTGCAGG + Intergenic
1200080377 X:153573284-153573306 GGCCCTGGAAAGGAGTGTCCAGG - Intronic
1202024827 Y:20510509-20510531 GGCACAGGAGGGCACTGTGTGGG + Intergenic