ID: 968913430

View in Genome Browser
Species Human (GRCh38)
Location 4:3486923-3486945
Sequence CCCGGGGAGCAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 513}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968913417_968913430 8 Left 968913417 4:3486892-3486914 CCCTGCTCTCTCCTGCTCCCCTC 0: 1
1: 1
2: 13
3: 249
4: 1744
Right 968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 51
4: 513
968913425_968913430 -10 Left 968913425 4:3486910-3486932 CCCTCAGGCAGTTCCCGGGGAGC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 51
4: 513
968913418_968913430 7 Left 968913418 4:3486893-3486915 CCTGCTCTCTCCTGCTCCCCTCA 0: 1
1: 0
2: 10
3: 97
4: 1062
Right 968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 51
4: 513
968913424_968913430 -9 Left 968913424 4:3486909-3486931 CCCCTCAGGCAGTTCCCGGGGAG 0: 1
1: 0
2: 3
3: 9
4: 123
Right 968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 51
4: 513
968913420_968913430 -3 Left 968913420 4:3486903-3486925 CCTGCTCCCCTCAGGCAGTTCCC 0: 1
1: 0
2: 0
3: 23
4: 378
Right 968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG 0: 1
1: 0
2: 4
3: 51
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968913430 Original CRISPR CCCGGGGAGCAGAGGGAAGC AGG Intronic
900142677 1:1145164-1145186 CCCGGGGAGCACAGGCCAGGAGG - Intergenic
900310818 1:2032428-2032450 CCCAGGAAGCAGAGGGTAGGAGG - Intergenic
900320534 1:2081400-2081422 TGCAGGGAGCAGGGGGAAGCAGG + Intronic
900572052 1:3363452-3363474 CCCGGTGAGCACGGGGGAGCTGG + Intronic
900690406 1:3977380-3977402 ACGAGGGAGCAGACGGAAGCAGG + Intergenic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
901216776 1:7559499-7559521 ATCAGAGAGCAGAGGGAAGCGGG + Intronic
901254464 1:7809928-7809950 CCTGGGGAGCAGCGGGTCGCAGG + Exonic
901896742 1:12319991-12320013 CCAGGTGAGGAGAGGGATGCAGG - Intronic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902429490 1:16352214-16352236 CCCGGGCCGCAGAGGGGAGCCGG - Intronic
902598674 1:17526212-17526234 CCCAGGGAGCACAGGAATGCAGG + Intergenic
902969647 1:20038017-20038039 CCAGGGAAGTAGGGGGAAGCTGG + Intronic
903007252 1:20306983-20307005 CCAGGGGAGAAGAGGGAGGGAGG - Intronic
903142184 1:21345396-21345418 CGCGGGGAGCTGCGCGAAGCCGG - Intronic
903172605 1:21563290-21563312 TCGGGGGAGCAGTGGGGAGCAGG + Intronic
903238105 1:21963821-21963843 CCCAGAGATCAGAGGGGAGCTGG - Intergenic
903318127 1:22524913-22524935 TCTGGGAAGCAAAGGGAAGCTGG - Intronic
903420752 1:23216925-23216947 CCCCGGGCGCCAAGGGAAGCCGG - Intergenic
903649555 1:24914485-24914507 CCCTGTGAGCAGATGAAAGCCGG + Intronic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
903854442 1:26328474-26328496 CCCAGGGCGGAGAGGGAGGCTGG + Intronic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906318668 1:44803734-44803756 CCCTAGCAGCTGAGGGAAGCCGG + Intronic
906519057 1:46456640-46456662 AGCGAGGAGTAGAGGGAAGCAGG + Intergenic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907117044 1:51978100-51978122 TTCTGGGAGCACAGGGAAGCTGG - Intronic
907520170 1:55018613-55018635 CCGGGGCAGCTGTGGGAAGCCGG + Intergenic
907569338 1:55468502-55468524 AACGGGGAGGAGAGGGGAGCAGG - Intergenic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
911073153 1:93847815-93847837 CCCGGGGAGCTGAGGGGCTCGGG - Intergenic
911154475 1:94624936-94624958 CCCAAGGAGGAGAGCGAAGCAGG + Intergenic
912517549 1:110225808-110225830 GCCGGGGAGCAGAGGGCAAAAGG - Intronic
913216793 1:116627634-116627656 ACCAGGCAGCAGAGGGATGCGGG + Intronic
917513590 1:175688565-175688587 CCCAGGAAGCAGAGGGCAGTGGG + Intronic
917576102 1:176323322-176323344 CCCTGGGAGCTGAGGAAAGGTGG - Intergenic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
918093002 1:181313696-181313718 TCCTGGGAGCAGACGGAGGCTGG - Intergenic
918471934 1:184884174-184884196 CCAGGGAAGAAGAGGGAAACAGG - Intronic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919744462 1:200999968-200999990 CTCAGGGAGGACAGGGAAGCTGG + Intronic
919764020 1:201114906-201114928 CCCGGGAGGCCGCGGGAAGCGGG + Exonic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922606857 1:226894917-226894939 CCAGGTGAGCACAGGGAACCAGG - Intronic
922698758 1:227745766-227745788 CTCTGGGGGCAGAGGTAAGCAGG - Intronic
922729289 1:227941616-227941638 CCCTGGGAGCACAGGGGAGATGG + Intronic
922802674 1:228371442-228371464 CCCGGGGAGCAGGCGGCACCCGG + Exonic
922813061 1:228428912-228428934 CCCGATGAGCAGAGGGCAGCAGG - Intergenic
923461623 1:234214152-234214174 CCCGGGGAGGAGGGCGGAGCAGG + Intronic
924641316 1:245836317-245836339 CGAGGGGAGCACAGGGATGCGGG - Intronic
1065590782 10:27259169-27259191 CCCGGGAGGGAAAGGGAAGCAGG - Intergenic
1065796230 10:29310968-29310990 CCTGAGGATGAGAGGGAAGCAGG - Exonic
1065816485 10:29487604-29487626 CCCCGGGAGAAGAGTGAAGGAGG - Intronic
1065956380 10:30697051-30697073 CCCCGGGAGAAGAGTGAAGGAGG + Intergenic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067562253 10:47312266-47312288 CCCGCGGAGCACCAGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067742212 10:48904225-48904247 CCCGGGCAGCAGTGGGTCGCTGG + Intronic
1069572841 10:69504797-69504819 CCCCAGGGGCAGAGGCAAGCTGG - Intronic
1069957587 10:72061416-72061438 CCCTGGGGGCTGAGGGAAGTGGG + Exonic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070655609 10:78269155-78269177 TATGGGGAGCTGAGGGAAGCAGG - Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1072546451 10:96443116-96443138 GCTGGGGAGCAGAGGCAAGGGGG + Intronic
1072691053 10:97572625-97572647 CCCAGGGAGCAGGGGGAGCCAGG - Exonic
1072808979 10:98445259-98445281 CCTGGGGAGGACAGGGAGGCAGG - Intronic
1072823555 10:98583028-98583050 CTAGGGGGGCATAGGGAAGCAGG + Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073067772 10:100773922-100773944 TCCTGGGAGCTGGGGGAAGCAGG - Intronic
1073117216 10:101098026-101098048 CTCAGGGAGCAATGGGAAGCAGG + Intronic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1074818570 10:117163098-117163120 CCCGGCCAGCAGACGGAGGCTGG - Intergenic
1075037357 10:119080540-119080562 GCGGCGGAGCAGTGGGAAGCAGG + Intronic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075687061 10:124371555-124371577 CCCAGGAAGCACAGGGAAGATGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075871020 10:125772967-125772989 GCCTGGGAGCAGAGGGGAGCGGG + Intronic
1076031500 10:127163024-127163046 CCCGGAGGGAAGAGAGAAGCCGG - Intronic
1076590374 10:131578314-131578336 CCAGGGATGCAGAGAGAAGCGGG + Intergenic
1076817586 10:132922450-132922472 CCCGGGGAAGTGAGGGAGGCTGG - Intronic
1076873710 10:133205807-133205829 CCTGGGCAGCAGAGCGAATCGGG + Intronic
1077121143 11:909170-909192 GCCGGTGAGCAGTGGGGAGCGGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077343818 11:2037413-2037435 CCCAGGCAGCCGAGGGGAGCGGG + Intergenic
1077708485 11:4512049-4512071 CAAGGGGAGCAGAGAAAAGCTGG + Intergenic
1079008809 11:16811813-16811835 CCAGGGCAGCAGAGGGGAGGTGG - Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1080874869 11:36266130-36266152 CCAGGGAAGCTGAGGGAAGGTGG - Intergenic
1081104156 11:39043998-39044020 CACGTGGAGCAGATGGAAACTGG - Intergenic
1081597299 11:44467834-44467856 TGCGGGGAGCAGAGGGCATCAGG - Intergenic
1081616342 11:44593513-44593535 CCCGGGAGGAAGAGGGAAGCTGG - Intronic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1083826423 11:65206563-65206585 CCCGGGTGGCAGGCGGAAGCGGG - Exonic
1084171070 11:67401377-67401399 CCCGAGGCGCTGAGGGTAGCTGG - Intronic
1084192431 11:67505114-67505136 GCCGGCGAGCAGAGGGAAGTGGG - Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084545531 11:69813336-69813358 CCCTGGGAGCAGATGGCACCTGG + Intronic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1084791633 11:71478635-71478657 GACGGGGAACAGATGGAAGCAGG - Intronic
1084893570 11:72249707-72249729 CCAGGGGACCAGAGGGATGGGGG - Intergenic
1084938281 11:72598940-72598962 CCCGGGAAGGAGAGGGACGTAGG + Intronic
1084949554 11:72657217-72657239 CCCGGGGAGCTGAGTGAGGTGGG - Intronic
1085831283 11:79903964-79903986 CCAGGAGAGCAGAGGTAAGGTGG - Intergenic
1086950735 11:92887810-92887832 CCAGGGCAGGGGAGGGAAGCAGG + Intronic
1086951052 11:92890588-92890610 CCAGGGGAGCACACGGGAGCTGG + Exonic
1088491535 11:110393132-110393154 ACTGGGGAGCAGAGGGGAGGTGG - Intergenic
1088853914 11:113729096-113729118 TCCTGGGAGCAGAGGCAAGCGGG + Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089296175 11:117469693-117469715 ACCAGGGAGGAGAGGGAAGTGGG + Intronic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089581678 11:119485297-119485319 TCCTGGGAGCAGAGGCAAGACGG - Intergenic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1090042311 11:123301834-123301856 CCCCGGGCGCCGAGGGAAGCGGG + Intergenic
1090188129 11:124751586-124751608 GCCGGGGACCAGAGGGAGGTGGG + Intronic
1202826804 11_KI270721v1_random:92602-92624 CCCAGGCAGCCGAGGGGAGCGGG + Intergenic
1091602184 12:1924651-1924673 GCCCGGGAGCAGAGGGCAGCGGG + Intergenic
1091641149 12:2238647-2238669 CTCTGGGAGCAGAGGGAACCTGG + Intronic
1091748761 12:3009948-3009970 CCCGGGGAGGTGAGGGGAGTGGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092986192 12:13848409-13848431 TGCCAGGAGCAGAGGGAAGCAGG + Intronic
1093353873 12:18138721-18138743 ACTGGGGAGCAGAAGGAAGCTGG + Intronic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1097053679 12:56238042-56238064 CCCAGGGTGCCGAGGGCAGCAGG - Exonic
1097271864 12:57780435-57780457 CCCCAGCAGCAGAGGGAAGGTGG - Exonic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1098893457 12:76031953-76031975 GCCGGGGAGAAGCGGGACGCGGG - Exonic
1098955378 12:76684163-76684185 GCCGAGGAGCCGAGGGGAGCAGG + Intergenic
1101504077 12:105330707-105330729 CCCGGGGCGCAGCGGGCTGCGGG - Exonic
1102068175 12:109996131-109996153 CCAGGAAAGCAGAGGGGAGCGGG + Intronic
1102713848 12:114952839-114952861 CCTGGGGAGCTGGGAGAAGCAGG - Intergenic
1103173416 12:118841906-118841928 CCAGGCCAGCAGAGGGATGCTGG + Intergenic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104947756 12:132424225-132424247 GCGGGGGAGTAGAAGGAAGCGGG + Intergenic
1104974999 12:132548349-132548371 CCTGGGCAGCAGAGGGCAGCTGG + Intronic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106602057 13:31196668-31196690 CCCGTGGAGAAGAGGGAGACAGG - Intergenic
1108992334 13:56675980-56676002 CCCTGAAAGCAGAGGGTAGCAGG - Intergenic
1110371304 13:74743559-74743581 CCTGGGGACCAGGGGGAAGTGGG - Intergenic
1111096022 13:83516901-83516923 CTCGGAGAGCAGAGGGGAGCCGG - Intergenic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113737802 13:112690484-112690506 CCCGGGGACCAGACAGACGCGGG + Intronic
1113737843 13:112690587-112690609 CCCGGGGACGAGCGGGATGCTGG + Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1114269444 14:21092051-21092073 CCGGGAGAGCAGAGGACAGCGGG + Exonic
1114533436 14:23409276-23409298 CCCCAGGAGCAGAGGGTAGCAGG - Intergenic
1114756862 14:25269457-25269479 CCAGGGAAGTAGAGGAAAGCTGG + Intergenic
1117726744 14:58682240-58682262 CCTGGGGAGCAAAGGGAGGGAGG - Intergenic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119482271 14:74965455-74965477 CAAGGGGTGCAGAGGGGAGCCGG + Intergenic
1119740723 14:77012256-77012278 CCCGGTGTCCAGAGGGGAGCTGG + Intergenic
1120173915 14:81273763-81273785 CCCAGGCAGCAGAGGCCAGCAGG - Intronic
1120450938 14:84666004-84666026 CCAGGGAAGCAGGGGAAAGCTGG + Intergenic
1121120392 14:91372415-91372437 CACTGGGAGCAGAGGAGAGCGGG + Intronic
1121455564 14:94036762-94036784 CTCGGGGAGCACAGGGCAGGAGG - Intronic
1121706683 14:96001700-96001722 CACGGAGAGCAAAGAGAAGCAGG + Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122470991 14:101965438-101965460 CCCGCGGAGCTGGGGGCAGCCGG + Intronic
1122775246 14:104114069-104114091 CCTCAGGAGCTGAGGGAAGCAGG - Exonic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1122904909 14:104797166-104797188 CTCGGGGAGCAGTGGGCAGGTGG - Intergenic
1122947690 14:105020760-105020782 CCCGGGGAACAGAGGGGCCCGGG - Intronic
1124439161 15:29674703-29674725 CCGGGGGGGCGGAGGGAAGGAGG + Intergenic
1124597352 15:31102087-31102109 CCCGGGGAGCTGGGAGAAGGCGG + Intronic
1125594170 15:40873813-40873835 CCCGGGGAGGAGACTGGAGCAGG - Intronic
1125720361 15:41842346-41842368 CCCACGGAGAAGCGGGAAGCAGG - Intronic
1125766940 15:42142381-42142403 CCCAGGGAGCAGAGGGCCACAGG + Intronic
1127373317 15:58360005-58360027 CCAGGACAGCAGAGGGAACCAGG - Intronic
1127785992 15:62355131-62355153 CACTGGGTGCAGAGTGAAGCAGG + Intergenic
1128090908 15:64918335-64918357 GCCTGGGAGCAGAGAGAAGCCGG - Intronic
1128795434 15:70463177-70463199 GCCCTGGAGCAGAGGGGAGCTGG + Intergenic
1130399865 15:83540920-83540942 GCAGGGGAGTAGAGGGAATCGGG - Intronic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132414805 15:101612560-101612582 CCCGGGGAGCAGGGGTCAGGTGG - Intergenic
1132572241 16:649192-649214 CCCGCGGGGCAAAGGGCAGCGGG + Intronic
1132591393 16:727844-727866 CCCGGGGAGCGCCGGGGAGCGGG - Intronic
1132595674 16:748216-748238 CCCGGGTGGCAGAGGGAACATGG + Intronic
1132612724 16:825267-825289 TCCGGGAAGCAGAGGAGAGCGGG + Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132686336 16:1163670-1163692 CCCGGGCTGCTGGGGGAAGCTGG + Intronic
1132728418 16:1348779-1348801 GCCGGGGAGCCCAAGGAAGCGGG - Exonic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1132872109 16:2119865-2119887 ACCAGGGAGCACAGGGGAGCAGG + Intronic
1133304640 16:4801585-4801607 CCTGTGGAACAGAGGGAAGGAGG + Exonic
1133989058 16:10690821-10690843 GCCCAGGAGCAGAAGGAAGCAGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134520416 16:14917031-14917053 ACCAGGGAGCACAGGGGAGCAGG - Intronic
1134551159 16:15138943-15138965 ACCAGGGAGCACAGGGGAGCAGG + Intronic
1134715303 16:16355715-16355737 ACCAGGGAGCACAGGGGAGCAGG - Intergenic
1134959454 16:18396444-18396466 ACCAGGGAGCACAGGGGAGCAGG + Intergenic
1135615553 16:23908118-23908140 CCCTGGGAGCTGGGGGAAGGAGG + Intronic
1135677075 16:24424877-24424899 ATCGGGGAGGAGAGGGACGCTGG + Intergenic
1135776770 16:25263358-25263380 CTCAGGGTGCAGAGGGAATCAGG + Intergenic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137594838 16:49716692-49716714 GCCGGGGAGCAGGGAGAGGCGGG - Intronic
1137749062 16:50845254-50845276 CCAGAGGAGCAGAGGGAGACTGG + Intergenic
1138179535 16:54932408-54932430 CCCGGGGAGCGCAGGGAAAAGGG + Intronic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1142007360 16:87695834-87695856 CCCGGCAAGCACAGGGAAGGTGG + Intronic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142518846 17:491317-491339 CCTGGGGAGCCGCGCGAAGCCGG + Intergenic
1142560891 17:808189-808211 CCCCAGGAGCAGAGGGAGGTGGG - Intronic
1142671280 17:1488389-1488411 CCCCGGGCGGGGAGGGAAGCGGG + Intronic
1143030489 17:3964529-3964551 CCCGGGGCGCGGAGGGCGGCCGG - Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1143181509 17:4986995-4987017 CTCGGGGAACAGATGGGAGCTGG + Exonic
1143811308 17:9473982-9474004 CCCAGGGAGGGGAGGGAGGCTGG + Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145941205 17:28744262-28744284 GCCGGGGAGCAGGGGACAGCGGG + Intronic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1147248672 17:39139492-39139514 CCCGGGGAGGGGATGGAAGCAGG - Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1147967045 17:44199329-44199351 GCCGGGAAGCTGGGGGAAGCCGG + Intronic
1148208089 17:45792120-45792142 CACGGGCAGCTGAGGGATGCCGG - Intronic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1150130731 17:62667290-62667312 CCGAGGGAGCAGAGGGAGGTAGG + Intronic
1150692337 17:67377373-67377395 CCCGGGGAGCCGAGGGACTCGGG + Intronic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151358398 17:73573671-73573693 CTCAGGGAGCGGAGGGGAGCAGG - Intronic
1151370820 17:73645158-73645180 CCCGGGAAGCGGAGGGCGGCGGG - Intergenic
1151658313 17:75505981-75506003 CCCGGGTAGCTGAGAGAATCGGG - Intronic
1152040021 17:77897130-77897152 TCCTGGGAGCAGGGGGGAGCTGG - Intergenic
1152484159 17:80578844-80578866 GCCTGGGAGCAGAAGGAAGCAGG + Intronic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1156723509 18:40099469-40099491 CACAGGGATCAGAGGGAAGGTGG + Intergenic
1157095166 18:44680436-44680458 CCCGCGGCGCGGAGGGAGGCTGG - Intronic
1157833484 18:50878749-50878771 CCCGCGGAGGCCAGGGAAGCTGG - Intergenic
1158640943 18:59203054-59203076 AGCGGGGAGCAGTGGCAAGCCGG - Intergenic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1160227964 18:77025905-77025927 GCAGGGGAGCAGTGGGCAGCGGG + Intronic
1160329433 18:77978161-77978183 TCCAGGGTGCAGGGGGAAGCTGG - Intergenic
1160540854 18:79621663-79621685 CCCCGGGATCAGAGGTCAGCCGG - Intergenic
1160832155 19:1109102-1109124 GCCGGGGACCAGGGGGAAACCGG - Intronic
1160911195 19:1474542-1474564 CCCGGGGCCCAGAAGGAAGTGGG + Exonic
1161021390 19:2013296-2013318 ACCGGGGAGTGGAGGGAACCTGG + Intronic
1161085419 19:2332902-2332924 GCAGGGGAGCAGAAGGAAGGTGG + Intronic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161768666 19:6219985-6220007 CCCGGGGCTCAGAGGGAGGGCGG + Intronic
1161957970 19:7506765-7506787 CCAGGGGAGGAGAGAGGAGCTGG - Intronic
1162100470 19:8335630-8335652 CCCGGGGCGCGGCGGGCAGCGGG + Exonic
1162806392 19:13139944-13139966 CCCTGGGAGCAGTGGGTAGGTGG - Exonic
1162866663 19:13553166-13553188 CCCAGGGAGTGGAGAGAAGCTGG - Intronic
1163127624 19:15252815-15252837 CCTGGGAAGCAGAGGGCACCAGG + Intronic
1163397631 19:17073374-17073396 CCCAAGAAGCACAGGGAAGCCGG + Intronic
1164999467 19:32749164-32749186 ACCTGGGAGCAGTGGGAGGCTGG + Intronic
1165091121 19:33388912-33388934 CCCGGGGACCTGAGGCGAGCAGG - Intronic
1165449082 19:35871882-35871904 CCCGGGGAGCAGAGTAGAGGGGG + Exonic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166852290 19:45766630-45766652 CCCCGGGGGCAGAGGAAAGGTGG + Exonic
1166863111 19:45821051-45821073 CCCGAGGAACAGAAGGAAGCAGG - Intronic
1166984670 19:46652693-46652715 CCCGGGGCTCAGAGGGACCCAGG + Exonic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167612031 19:50512341-50512363 CCAGGTGAGCAGAGCTAAGCAGG - Exonic
1167641963 19:50687117-50687139 CCCGGGGCCCCGAGGGAGGCGGG - Intronic
1167792048 19:51689188-51689210 CCCGGGGAGGAGGAGGGAGCGGG - Intergenic
1167822011 19:51936905-51936927 TCCAGGGAGCAGAGAGAGGCTGG + Intronic
1168269393 19:55241432-55241454 CTCGGGGAGGCGGGGGAAGCAGG - Intronic
925319172 2:2948811-2948833 CCCAGAGAGGAGAGGGGAGCTGG + Intergenic
925342616 2:3147706-3147728 CCCAGGGAGTGAAGGGAAGCAGG + Intergenic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
926127691 2:10282060-10282082 GGCAGGCAGCAGAGGGAAGCTGG + Intergenic
926222868 2:10947721-10947743 CCTGGGGAGGAGTGGGCAGCGGG + Intergenic
926423324 2:12718795-12718817 CCCGGGGAGGAGAGGGCGGCGGG + Intronic
927471958 2:23384135-23384157 CCGGGGGAGCGGAGGGAGGGTGG + Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
930762256 2:55049856-55049878 CCGGGGGAGGAGGGGGAGGCCGG + Exonic
931695049 2:64865194-64865216 CCCGGGGAGCAGAGAGGCGGAGG - Intergenic
931811856 2:65861987-65862009 CCCGGAGAGCAATGGGAATCTGG - Intergenic
932496936 2:72150214-72150236 CAAGGGGGGCTGAGGGAAGCAGG - Intergenic
933274835 2:80272534-80272556 CCCAGGGAAAAGAGGGAAACAGG + Intronic
934783149 2:96985917-96985939 CCCAGGGTGCAAAGGGTAGCTGG - Intronic
935567199 2:104621297-104621319 CTGGGGGAGAACAGGGAAGCCGG - Intergenic
935673382 2:105574125-105574147 CCTGCAGAGCAGAGGGAAGGTGG - Intergenic
935702126 2:105821908-105821930 CCCGGGAAGCAGAAGGAACGTGG - Intronic
936082801 2:109446471-109446493 CCTTGGGAGCAAAGGAAAGCTGG + Intronic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937071420 2:119066634-119066656 CCCAGGGAGCAGGAGGGAGCTGG - Intergenic
937285236 2:120746443-120746465 GCCGGGGAGCAGAGAGACCCAGG - Intronic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
938062289 2:128263038-128263060 CAAGGGGAGCAGTGGGGAGCAGG + Intronic
939419006 2:141941654-141941676 CACGTGGAACAGTGGGAAGCTGG + Intronic
939529165 2:143335932-143335954 CCAGGGGAGAGGAAGGAAGCTGG + Intronic
940141017 2:150490502-150490524 GTCGGGGAGCAAAAGGAAGCAGG + Intronic
940293261 2:152098426-152098448 CACGGGGGCCAGAGAGAAGCCGG + Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
943345754 2:186735003-186735025 CCCTGAGAGCAGAGGGATGCTGG + Intronic
943801130 2:192059390-192059412 CATGGGGATAAGAGGGAAGCTGG + Intronic
944508273 2:200438114-200438136 CCATGGGAGTAGAGAGAAGCAGG + Intronic
945213840 2:207412544-207412566 CTTGGGGAGCAAAGGGCAGCTGG + Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946347670 2:219124273-219124295 GCTGGGAAGCAGAGGAAAGCGGG + Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
948145233 2:235703571-235703593 GCGGGGGAGGGGAGGGAAGCGGG - Intronic
948151370 2:235747441-235747463 CCCGGGGTGAACAGGTAAGCTGG + Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948765344 2:240216558-240216580 CCTGGGGAGCAGGGGGAGGTGGG + Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169075017 20:2755038-2755060 CCCAGGGTGCAGGGGGAAGTGGG + Intronic
1171444797 20:25195800-25195822 TCCGGGGAGCAGGCGGCAGCCGG - Exonic
1171971560 20:31568250-31568272 CCGGGGCAGTAGGGGGAAGCGGG - Intronic
1172101283 20:32484796-32484818 CCCGGGGCGCAGGAGGAGGCAGG + Intronic
1172172399 20:32946283-32946305 CCCAGGGAGAAGCTGGAAGCTGG + Intronic
1172428584 20:34872720-34872742 CTCGGGCAGCCGCGGGAAGCTGG + Exonic
1173747952 20:45452477-45452499 TGGGTGGAGCAGAGGGAAGCAGG - Intergenic
1173800410 20:45891366-45891388 GCGGGGGAGCAGAGGTGAGCTGG + Exonic
1173844093 20:46177183-46177205 CCCAGGGAGCAGAGCAAGGCTGG + Intronic
1174173507 20:48631041-48631063 CCTGGGGAGCAGAGGGCTGGGGG - Intronic
1174258851 20:49278445-49278467 CCCGGCGTGTAGAGGGAAGGGGG + Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176107819 20:63397867-63397889 ACGGAGGAGCAGAGGGCAGCTGG - Intergenic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176302972 21:5107494-5107516 CCCGGGGAGCAGTGGGGTCCCGG - Intergenic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1177856341 21:26404602-26404624 CCCAGTGAGCAGAGAGCAGCAGG - Intergenic
1178257178 21:31064790-31064812 CACATGGAGCAGAGGCAAGCTGG + Intergenic
1178305055 21:31484451-31484473 CCCCGGAGGCAGAGGCAAGCTGG - Intronic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1178948278 21:36966272-36966294 CCCGGGGCCCAGAGAGAGGCCGG - Intronic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179819911 21:43930692-43930714 TGAGGGGAGCAGAGGGAAGCAGG + Intronic
1179854053 21:44154430-44154452 CCCGGGGAGCAGTGGGGTCCCGG + Intergenic
1179922292 21:44513764-44513786 CCAGGGGAGGGGAGGGAGGCAGG + Intronic
1181149773 22:20874935-20874957 CCCTTGGAGGAGTGGGAAGCTGG + Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1183009403 22:34932469-34932491 TCCGGGGAGCAAAGAGGAGCAGG + Intergenic
1183187350 22:36299678-36299700 CCCAGGGAGCAGATAGCAGCCGG - Intronic
1183377498 22:37473680-37473702 CCCGGGGATCTGAAGGAAGGAGG + Intronic
1183620147 22:38967355-38967377 CCCAGTGAGCAGAGTGATGCAGG - Intronic
1183649545 22:39145924-39145946 CCCGGGGGGTCGGGGGAAGCGGG + Intronic
1184087951 22:42276827-42276849 CCAGGGGAGCAGAAAGCAGCAGG + Intronic
1184321597 22:43746113-43746135 TCCGGGGACAAGCGGGAAGCGGG + Intronic
1184601105 22:45543847-45543869 CCCGGGGAGGACACGGAGGCAGG - Intronic
1184755639 22:46514432-46514454 CCCGGGGATCAGAGTGCAGGTGG - Intronic
1184805908 22:46794734-46794756 CCCTGAGAGCAGTGGGGAGCAGG + Intronic
1184885843 22:47344001-47344023 CCCAGGGAGCATTGGGAAGAGGG + Intergenic
1184965674 22:47970308-47970330 CCCAGGGAGCAGGGGATAGCGGG - Intergenic
1185283024 22:49983705-49983727 CCCGGGGCCCTGAGGGAAGGCGG - Intergenic
949959574 3:9301006-9301028 CTCTGGGAGCAGAGGGTACCAGG + Intronic
950072682 3:10165059-10165081 CCCGGGGAGGGGAGGGGACCAGG + Intronic
950095053 3:10324188-10324210 CCCGGGCAGCTTACGGAAGCTGG + Exonic
950458945 3:13109653-13109675 GCAGGGGAGGAGAGGGGAGCAGG - Intergenic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950611635 3:14130801-14130823 CCCTGGGAGCAAAGGGGAGTGGG - Exonic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
954437304 3:50503085-50503107 CCCCGGGCGCAGCGGGCAGCCGG + Intronic
954866993 3:53738084-53738106 CCCGACCAGCAGAGGGAGGCTGG + Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
957417767 3:79929004-79929026 CCCTGAGAGCACAGGGATGCTGG - Intergenic
959120372 3:102224972-102224994 GCCGGGGAGCTGAAGGAAGGTGG + Intronic
959849626 3:111071630-111071652 CCCGGGGATCAGACGGGAGGTGG + Intronic
960052105 3:113248950-113248972 CACCGGGAGCAGAGAGAAGTGGG + Intronic
960846085 3:122005713-122005735 CCATGGGAGCAGAGAGAGGCTGG - Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
963015411 3:140819938-140819960 CTCAGGGAGGAGAGAGAAGCAGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964087402 3:152834978-152835000 TCCAGGGCGCAGTGGGAAGCAGG - Exonic
964570196 3:158102629-158102651 CCCAGGGAGCAGAGAGAGCCTGG - Intronic
968025812 3:195442283-195442305 CCCGGGGAGGAGAGAGTAGGGGG - Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968274502 3:197429656-197429678 ATCGGGGAGCTGAGGGAGGCGGG + Intergenic
968599855 4:1503739-1503761 CCCGGGGAGCCGGGGGAGCCCGG - Intergenic
968758073 4:2427071-2427093 CCCGGGGAGCCGAGGGCTGCAGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969206618 4:5652034-5652056 ACCAGGGAACAGGGGGAAGCTGG + Intronic
969480589 4:7445007-7445029 GGCGGGGAGCAGAGGGAGGGCGG + Intronic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
969633197 4:8350524-8350546 TCAGGGGAACAGAGGGGAGCCGG + Intergenic
970727107 4:19060031-19060053 CCCGGGAAGCAGAAGGAGTCAGG + Intergenic
971309741 4:25515051-25515073 GGAGGAGAGCAGAGGGAAGCGGG + Intergenic
971381146 4:26099075-26099097 CCTGGGTAGCAGTGAGAAGCAGG + Intergenic
973607808 4:52605197-52605219 GCGGGGGAGCAGTGGGGAGCAGG - Intronic
973619442 4:52712442-52712464 CGCGGGGCGGGGAGGGAAGCAGG - Intergenic
975668913 4:76760614-76760636 CCCTAGGAGCAGAGGGTAACTGG + Intronic
980940043 4:139265150-139265172 CCCAAGGAGCAGATTGAAGCTGG - Intergenic
982202622 4:152974917-152974939 CCCGGTCAGCAGAGGGACCCAGG - Exonic
982214057 4:153065015-153065037 CCCGTGGAGCCGTGGGAAGGGGG + Intergenic
985064126 4:186104932-186104954 CTCGGGGAGGAGAGGGAGCCAGG + Intronic
985471254 5:48270-48292 GCTGGGGAGCAGAGTGAAGGAGG + Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985783759 5:1883782-1883804 CGCGAGGGGCAGGGGGAAGCCGG - Intronic
985894243 5:2739545-2739567 ACCGGGGAGGAGAGGAAGGCTGG + Intergenic
985995422 5:3594861-3594883 CGCAGGGAGAAGAGGGACGCGGG + Intergenic
986152430 5:5140107-5140129 AGCGGGGAGCAGAGGGAAGGCGG - Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
987075770 5:14380430-14380452 CCAGGGCAGCAGTGGGAAGCGGG - Intronic
987440627 5:17951794-17951816 CCAGGGAAGCAGGGGAAAGCTGG + Intergenic
987684651 5:21181880-21181902 CCCAGAGAGCAAAGGGCAGCAGG + Intergenic
988999337 5:36744666-36744688 CCCGGGAAGCAGCGGGGCGCGGG - Intergenic
991036367 5:62131698-62131720 CCTGGCTAGCAGAGGGAAGTGGG - Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
993864172 5:93172473-93172495 CCCGGGAAGCACAAGGAATCAGG - Intergenic
997656586 5:135559616-135559638 CACGGGGAAGAGAGGGATGCTGG + Intergenic
997713200 5:136023347-136023369 CACGGGGAGCAGAGCAAGGCTGG + Intergenic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998130449 5:139648909-139648931 CCGGGGGAGGAGAGGGAGGTAGG - Intronic
998171188 5:139872881-139872903 CCCTGGGAGCTGAGGGGAGCAGG - Intronic
999791244 5:154941236-154941258 CCTGAGGAGCCGGGGGAAGCTGG + Exonic
1000209114 5:159095223-159095245 CCCGGGAAGCAGAGGGGCGAGGG - Intronic
1000345713 5:160312135-160312157 TCCGGCGAGCAGAGGGGAGGGGG - Intronic
1000882193 5:166711199-166711221 GCTGGGGAGCAGGGGAAAGCAGG - Intergenic
1001270759 5:170309854-170309876 CCAGGGGAGGAGATGGAGGCTGG + Intergenic
1001284930 5:170415972-170415994 GCTGGGGAGGAGAGGGGAGCGGG + Intronic
1001419180 5:171573903-171573925 GCCAGGGAGCAGGGAGAAGCGGG + Intergenic
1001489956 5:172148303-172148325 GGTGGGGGGCAGAGGGAAGCAGG + Intronic
1001576132 5:172765177-172765199 CTCGGTGGGCAGAGGGGAGCAGG + Intergenic
1001905577 5:175470042-175470064 CCAGGGGAGCAGGAGGAAGCTGG + Intergenic
1002182021 5:177435578-177435600 CCAGTGGAGCAGAGTGAGGCCGG - Intronic
1002446473 5:179293158-179293180 TTCGGGGAGCAGAGGAAAGTGGG - Intronic
1002485284 5:179530776-179530798 CCCCGGGAGGCGCGGGAAGCCGG - Intergenic
1002597268 5:180332246-180332268 CGGGGGGAGCAGGGGGATGCGGG + Intronic
1003600491 6:7512373-7512395 AGCGGGGAGCAGAAGGGAGCAGG + Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004722172 6:18277318-18277340 CCCGCGGGGCGGAGGGGAGCGGG + Intergenic
1005348022 6:24909495-24909517 CCCGGGTAGGGGAGGGAAGGAGG + Intronic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006429155 6:33984508-33984530 CCAGGGGCGCTGGGGGAAGCAGG + Intergenic
1006463902 6:34179516-34179538 CCCTGAGAGCACAGGGATGCTGG + Intergenic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1007451159 6:41941134-41941156 GCCGGGAGGCGGAGGGAAGCGGG + Intronic
1007656773 6:43455417-43455439 CCCGGGGCGCAGAGAGAGGCCGG + Intronic
1007716296 6:43858100-43858122 CCTGGGGACCTGAGGAAAGCTGG - Intergenic
1009789737 6:68386195-68386217 CTCTGGGAGCAGAGGGAACTAGG - Intergenic
1010194239 6:73223976-73223998 CTCAGGGAGGAGAGGGTAGCAGG - Intronic
1011304422 6:85910839-85910861 CACGGGGAGCAAGGGAAAGCAGG + Intergenic
1011908936 6:92410443-92410465 CTCTGGGAGCAGAGGGGAGTAGG - Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1014078576 6:117264777-117264799 CACCGGGAGCAGCCGGAAGCGGG + Intergenic
1015769626 6:136755241-136755263 GCCAGGGAGCAGAGAGGAGCTGG - Intronic
1016286648 6:142481170-142481192 TCTGGGGAGGAGAGGGAGGCTGG + Intergenic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1016919976 6:149283146-149283168 GCGGGAGAGCAGAGGGGAGCTGG - Intronic
1018147825 6:160909546-160909568 CACGTGAAGCAGAGGAAAGCTGG + Intergenic
1018168777 6:161127100-161127122 CCCAGGAAGCAGGGGAAAGCCGG + Intergenic
1018303582 6:162429746-162429768 CCTGGAGAGCAGTGGTAAGCAGG - Intronic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1018945788 6:168346012-168346034 CCGGGGCAGCCGGGGGAAGCCGG + Intergenic
1018995087 6:168704358-168704380 CTCGGGGGGCACAGTGAAGCCGG + Intergenic
1019177219 6:170166117-170166139 CCCCGGGAGCACAGGGAATGTGG + Intergenic
1019346217 7:531975-531997 CGCAGAGAGCAGGGGGAAGCTGG + Intergenic
1019354766 7:572706-572728 CCTGGAGAGCCGAGGGGAGCAGG + Intronic
1019404738 7:877451-877473 GGCGGGGGGCAGAGGGAGGCAGG - Intronic
1019563768 7:1670012-1670034 CGCGGGGAGCCGAGGAGAGCAGG + Intergenic
1019921106 7:4163750-4163772 CCCGGTGAGCAGAGCCAGGCTGG + Intronic
1019964848 7:4490500-4490522 AGCTGGGAGCAGAGGGAGGCTGG - Intergenic
1020017968 7:4842518-4842540 CCGGGGGTGCACAGGGAAACTGG + Intronic
1021098654 7:16562669-16562691 CCAGGGGAGCAGAGGGATTCTGG + Intronic
1021841657 7:24726128-24726150 CCTGGGGAGCTGATGGATGCTGG - Intronic
1022207681 7:28180010-28180032 CCCGAGGCGCTGAGGGCAGCGGG - Intronic
1022813398 7:33890864-33890886 GGAGAGGAGCAGAGGGAAGCAGG + Intergenic
1024533366 7:50410745-50410767 CCCCAAGAGCTGAGGGAAGCTGG + Intergenic
1026036007 7:66831131-66831153 CCCAGGGAGCAAAGGGAAAGGGG - Intergenic
1026037348 7:66839475-66839497 CCCAGGGAGCAAAGGGAAAGGGG - Intergenic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1032075962 7:128836314-128836336 GCCGGGGAGCAGAGGGTGGGAGG + Intronic
1032086158 7:128884942-128884964 CCCTGGGATCAGGGGGAGGCTGG - Intronic
1032359707 7:131244130-131244152 CCTGGGGAGTAGAGGGAAATCGG - Intronic
1032715211 7:134503323-134503345 CTCAAGGAGCAGAGTGAAGCTGG + Intergenic
1033253012 7:139777328-139777350 CCCGGGGAGGGCAGGGACGCCGG - Intronic
1034354662 7:150443119-150443141 CGCAGAGAGCACAGGGAAGCTGG + Intergenic
1034491744 7:151396518-151396540 GTAGGGGAGCAGCGGGAAGCGGG + Intronic
1034649169 7:152675965-152675987 CGAGGGGAGCCGAGGGAACCCGG - Intronic
1035067745 7:156120694-156120716 CCCGGGGAGCAGATCAGAGCAGG - Intergenic
1035067755 7:156120755-156120777 CCCGGGGAGCAGATCAGAGCAGG - Intergenic
1035314296 7:157988631-157988653 CCCAGGGAGCACAGGGGGGCTGG + Intronic
1035399512 7:158555610-158555632 CCATGGGAGCTGAGGGAGGCTGG - Intronic
1036743735 8:11389637-11389659 CCCAGGGAGCAGGGACAAGCAGG + Intergenic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039212639 8:35235185-35235207 CGCGGGGAGCTGAGCGGAGCCGG - Intergenic
1039836183 8:41258257-41258279 CCCGGGGATCTCAGAGAAGCTGG + Intergenic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1042137370 8:65645005-65645027 CCGGAGGAGCTGAGGGAAGTCGG + Intronic
1042872749 8:73413039-73413061 CCTGGGGAGCCAGGGGAAGCTGG - Intergenic
1042932023 8:74023203-74023225 CACCAGGAGCAGAGGGTAGCAGG - Intronic
1043944195 8:86231367-86231389 CCCCAGGGGCAGAGGGAAGGAGG + Intronic
1044685707 8:94823616-94823638 GGCGGGGAGCGGAGGGAAGCTGG - Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046780649 8:118211086-118211108 CCAGGGGAGCAGAAGGGAGGGGG + Intronic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1048852303 8:138656779-138656801 CCCAGGCAGCAGAGGCAAGGTGG + Intronic
1049216026 8:141408804-141408826 GCTGGGGAACAGAGGGATGCTGG + Intronic
1049454919 8:142681899-142681921 CCTGGGGAGCAGCGGGATCCGGG - Exonic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049706238 8:144044198-144044220 ACAGGGGAGCAGAGAGAAGGTGG + Intronic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1049945618 9:592320-592342 CCCAGGGAGCAGCGGGAAGCCGG + Intronic
1053293133 9:36895177-36895199 CGAGAGGCGCAGAGGGAAGCAGG + Intronic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1058935489 9:109766028-109766050 CCCAGGGAGGAGAGGCAGGCAGG + Intronic
1059341304 9:113599016-113599038 GCCGGGGAGCAGAGGGAAGGGGG - Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1060102905 9:120856197-120856219 CCAGGGAAGCAGAGGAAAGTGGG + Exonic
1060223891 9:121779937-121779959 GCCTGGAAGCAGAGGGAAGGCGG - Intronic
1060523402 9:124307429-124307451 CCTGGGGAGCAGCAGGAAACTGG - Intronic
1060766599 9:126298650-126298672 CCCGGAGAGCAGGGGCAGGCGGG - Intergenic
1060991947 9:127854443-127854465 CACGGGGACCCGAGGGGAGCAGG + Exonic
1061147525 9:128808640-128808662 TCAGGGGAGCAGAGGCAAGCGGG - Exonic
1061151276 9:128829622-128829644 GCCTGGGATCAGCGGGAAGCAGG + Intronic
1061413070 9:130431448-130431470 GCTGGGGAGCAGACGGTAGCCGG - Exonic
1061571216 9:131478503-131478525 CCCGGGGAGGAGAGTGAGGTGGG + Exonic
1061773269 9:132944314-132944336 CCTGGGGAGGAGAGGCGAGCCGG - Intronic
1061840663 9:133356820-133356842 TCAGGGGAGGAGAGGGAAGGGGG + Intronic
1061920256 9:133778700-133778722 CCCAGGGAGCAGGGAGGAGCTGG + Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1062121575 9:134836645-134836667 CCCTGGGAGCAGAGTGGACCTGG + Intronic
1062399556 9:136366453-136366475 CACGGGGTGCAGAGGTGAGCAGG - Intronic
1062435704 9:136545796-136545818 GCCCGGGCGCAGAGGGCAGCCGG - Exonic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1062677180 9:137753416-137753438 TGCGGGGAGCACAGGGGAGCCGG + Intronic
1185595090 X:1301489-1301511 CCAGTGGAGCAGAGGGAGGTGGG - Intronic
1187050993 X:15695417-15695439 CCCGGGGAGGTGAGTGGAGCAGG + Intronic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1189308799 X:40006115-40006137 GCCTGGGGGCAGAGGGAAGTGGG + Intergenic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1190233860 X:48601461-48601483 GCCAGGGAGCAGGGGAAAGCTGG + Intronic
1190743506 X:53306335-53306357 CCAGGGGTCCAGAGGGAGGCAGG + Intronic
1194241568 X:91456324-91456346 CACAGGGAGCAGAGAGTAGCAGG - Intergenic
1196098857 X:111827930-111827952 CCAAGGGAGGAGAGGGAAGTAGG - Intronic
1197061808 X:122190411-122190433 CCCCGGGAGCAGTGGCAGGCAGG - Intergenic
1197372959 X:125646868-125646890 CCGGGGCAGCACAGGGCAGCAGG + Intergenic
1197755030 X:129987435-129987457 CCCAGGAAGCAGAGGTTAGCTGG + Intronic
1197795532 X:130293934-130293956 CCCTGGGGGCAGAGAGATGCAGG + Intergenic
1198518389 X:137429515-137429537 CCGGGGAGGCCGAGGGAAGCTGG + Intergenic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200138526 X:153886218-153886240 GCCGGGGAGGAGAGGGAGGGAGG + Intronic
1202349518 Y:23972731-23972753 CCTGGGGGGTAGAGGGAAGGTGG - Intergenic
1202521257 Y:25697373-25697395 CCTGGGGGGTAGAGGGAAGGTGG + Intergenic