ID: 968914442

View in Genome Browser
Species Human (GRCh38)
Location 4:3491156-3491178
Sequence ATGAATGAGCAGGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1104
Summary {0: 1, 1: 2, 2: 11, 3: 99, 4: 991}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968914442 Original CRISPR ATGAATGAGCAGGAGGAAGA AGG (reversed) Intronic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900732595 1:4272042-4272064 AAGAAAGAGTAGGAGGAAGAAGG - Intergenic
900858261 1:5203706-5203728 TGGCAGGAGCAGGAGGAAGAGGG + Intergenic
901269662 1:7942175-7942197 AAGAATGAGGAGAAGGAAAAAGG + Intronic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
902091081 1:13903747-13903769 AGTGATGGGCAGGAGGAAGACGG + Intergenic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902957580 1:19936290-19936312 TTGAATGAGAAAGAGGAAGCAGG - Intergenic
903829859 1:26168345-26168367 AGGAATGAGCAGTATGAAGTGGG - Intergenic
903916959 1:26771727-26771749 ATGAATGGGAAGGAGGGAGTGGG + Intronic
904087074 1:27916757-27916779 AGGAAAGAGGAGGAGGAAGGGGG - Intergenic
904719728 1:32499083-32499105 AGGAATGGGCAGGAGAAAGGTGG - Intronic
904829342 1:33296623-33296645 TTGGATGAGGAGGAGAAAGAGGG + Intronic
904855069 1:33491567-33491589 ATGGATGAGCAGGAGGAAGGGGG + Exonic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
906502259 1:46349883-46349905 TTGAACTAGGAGGAGGAAGAAGG + Intronic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907261263 1:53220447-53220469 CTGAAGGAGCAGGAGGCAGAAGG - Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
908856660 1:68437372-68437394 AAGAATGAGAAAGAGGGAGAAGG - Intronic
908936319 1:69381331-69381353 AAGACTGTGAAGGAGGAAGAGGG - Intergenic
909162549 1:72172081-72172103 ATGAATCAGCAGTAGGTGGAAGG + Intronic
910007902 1:82422289-82422311 GTGAAGTAGGAGGAGGAAGAAGG + Intergenic
910206307 1:84752240-84752262 AAGAAGGAGAAGGAGCAAGAAGG - Intergenic
910735129 1:90445173-90445195 GTGAGAGAGCAGGAGGAAAAGGG + Intergenic
910835809 1:91508850-91508872 ATGATGGAGCAGGTGGAAGAAGG - Intronic
911035032 1:93533462-93533484 ACCAATGAGGAGGAGGAAGGAGG + Intronic
911546938 1:99228570-99228592 AGAGATGTGCAGGAGGAAGATGG - Intergenic
911674071 1:100638980-100639002 CTGAATGATCTGGAGGAAGCAGG + Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
912657226 1:111497674-111497696 AGAAAGGAGGAGGAGGAAGAGGG + Intronic
913069298 1:115284941-115284963 AGGACAGAGCAGGAGGAGGAGGG - Intergenic
913197031 1:116465822-116465844 ATGATTGAGAGGGAGGGAGAAGG - Intergenic
913332696 1:117680465-117680487 ATGAATGAGCAGGAAGGGCAGGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914341035 1:146760766-146760788 ATGGCTGGGAAGGAGGAAGAAGG - Intergenic
914831037 1:151171120-151171142 AAGAAAGAACAGGAGCAAGAGGG + Intronic
915581633 1:156816424-156816446 AGGAGGGAGCAGGAGGATGAAGG - Intronic
915833471 1:159153200-159153222 ATAAATGAGTAGGTGGATGATGG - Intergenic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916414274 1:164578033-164578055 ATAAATGAGTAGGAGGATGGGGG - Intronic
916750707 1:167721027-167721049 ATGAGTGTGAAGGAGGAAAAGGG - Intergenic
917313593 1:173702591-173702613 AAGAAGGAGAAGGAGGAAGGAGG + Intergenic
917716584 1:177744527-177744549 ATGAATGAGCTGGAGTAACATGG - Intergenic
917745798 1:178005730-178005752 AGAAATTAGCAGAAGGAAGAGGG - Intergenic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918204329 1:182295835-182295857 AAGAAGGAGGAAGAGGAAGAAGG - Intergenic
918245087 1:182652037-182652059 GTGAATGAGGAGGAGAATGAGGG + Intronic
918273368 1:182925112-182925134 AAGAAGGAGGGGGAGGAAGAGGG + Intronic
918859139 1:189799016-189799038 ATGGAAGAGCAGCAGCAAGATGG + Intergenic
919103534 1:193122100-193122122 GCGAAGGAGGAGGAGGAAGAGGG + Exonic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919615782 1:199806776-199806798 ATTATTGAGCATGAGAAAGAAGG - Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920550447 1:206856228-206856250 AGGAAGGAGCAAGAGGAAGACGG - Intergenic
920724087 1:208417387-208417409 GTGATTGAGAAGGAGGTAGAGGG + Intergenic
920802138 1:209199352-209199374 ATTAATGTGCATGAGCAAGAGGG - Intergenic
920838493 1:209534157-209534179 ATAAATTAGCAGTAGGAAGGAGG + Intergenic
920873145 1:209810639-209810661 ATGAATGGGCAGAAGAATGAAGG - Intergenic
920932742 1:210404228-210404250 GTTAATGAGCAGTAGGAAAAAGG - Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921006593 1:211099970-211099992 CTTAGTGAGCAGGAGGTAGAGGG - Intronic
921299341 1:213735673-213735695 ATGAAGGGGGAGGAGGAAAAGGG + Intergenic
921326317 1:213988879-213988901 AAGAGAGAGCAGGAGAAAGAAGG - Intronic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921483284 1:215688312-215688334 AAGGATGAGCAGGAGCTAGATGG + Intronic
921780056 1:219152214-219152236 ATGAATGAGCAAGAGGAGAGCGG + Intergenic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922209486 1:223476670-223476692 AAGGAGGAGAAGGAGGAAGATGG + Intergenic
922357437 1:224789626-224789648 ATGAAGCAACTGGAGGAAGAGGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922722740 1:227906839-227906861 AGGAAGGAGGATGAGGAAGAGGG - Intergenic
922775648 1:228213212-228213234 AGGAGCGAGCAGGAGGCAGAGGG - Intronic
922912648 1:229230456-229230478 ATGAATTAGCAGGAGGTAGGCGG - Intergenic
923104596 1:230844329-230844351 ATGGCAGAGCAGGAGCAAGAGGG - Intronic
923239331 1:232065910-232065932 ATAAATAAGCAGGAAGCAGAAGG + Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923514412 1:234682368-234682390 ATCCATGAGCAGGAGCAAGGAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
924467425 1:244311205-244311227 GTGGAAGAGGAGGAGGAAGAGGG - Intergenic
924577870 1:245296735-245296757 ATGAATCAGCAGGGAGCAGAGGG - Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
924815815 1:247441088-247441110 AGAAAGGAGGAGGAGGAAGAAGG - Intronic
1063290276 10:4738670-4738692 AAAAAGGAGAAGGAGGAAGAAGG - Intergenic
1063290282 10:4738703-4738725 AAAAAGGAGAAGGAGGAAGAAGG - Intergenic
1063453215 10:6164953-6164975 AGGGATGAGCAGGAGACAGAAGG + Intronic
1063538129 10:6905386-6905408 TGGAATATGCAGGAGGAAGAAGG - Intergenic
1063850080 10:10177886-10177908 AGGAAGGAGAAGGAGAAAGAAGG - Intergenic
1063916065 10:10883905-10883927 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1064272705 10:13879773-13879795 AGGGAGGAGGAGGAGGAAGAAGG - Intronic
1064727348 10:18294230-18294252 AGGCATGAACAGGAGAAAGAAGG - Intronic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065960335 10:30728956-30728978 AGGAATGAGCAGAAGAAAGCAGG + Intergenic
1066226882 10:33392496-33392518 GAGAATGAGGATGAGGAAGAGGG - Intergenic
1067302944 10:45031162-45031184 ATGGATGAGCCAGAGGCAGATGG - Intergenic
1067908152 10:50315934-50315956 AAAAAAGAGCAGAAGGAAGAGGG + Intronic
1069109320 10:64425754-64425776 ATGCATGGGCAGTGGGAAGATGG + Intergenic
1069195299 10:65544124-65544146 AAGAATAAGAAGGAGGGAGAGGG - Intergenic
1069409525 10:68139075-68139097 ATGTTGGAGCAGGAGGAAGAAGG - Intronic
1069777182 10:70933999-70934021 CTCTAGGAGCAGGAGGAAGAAGG + Intergenic
1069842581 10:71348985-71349007 ATGGCTGAGCAGGAGGGAGCTGG + Intronic
1069861943 10:71477034-71477056 ATGAAGGCCAAGGAGGAAGATGG - Intronic
1070985916 10:80689761-80689783 ATGAATGGGCAAGAAGGAGAAGG + Intergenic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1071445963 10:85747519-85747541 AGGAAGGGGCAGGAGGAAGGAGG - Intronic
1071813124 10:89205213-89205235 ATGAATAGGCAGGAGTTAGATGG + Intergenic
1073155353 10:101342054-101342076 ATTAAAGAGCAGGAGGATGCTGG + Intergenic
1073703245 10:105954157-105954179 AGGAAAGAACAGGAGGAAGGAGG + Intergenic
1073887702 10:108059548-108059570 ATAAATGAGAAGGAAGAGGAAGG - Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074165261 10:110869447-110869469 ATGAAAGACAGGGAGGAAGAAGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074335542 10:112570790-112570812 ATGAATCAGAAGGAGGAACGTGG - Intronic
1074942843 10:118251720-118251742 TTGGATGATCAGGAGGAAAAAGG - Intergenic
1075127517 10:119712352-119712374 GTGAATCAGAAGGAGGCAGAGGG - Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075927691 10:126266360-126266382 ATGAAGGAGGAAGAGAAAGATGG + Intronic
1076219155 10:128719206-128719228 ATGGTGGAGCTGGAGGAAGATGG - Intergenic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1076736444 10:132461260-132461282 AGGAAAGAGGAGGAGGATGAAGG - Intergenic
1076856030 10:133116012-133116034 AGGAATGAGGGGGAGGGAGAGGG - Intronic
1077393188 11:2309126-2309148 GGGAATGAGGAGGAAGAAGAAGG + Intronic
1077506390 11:2931711-2931733 AGAAATGAGGGGGAGGAAGAGGG + Intergenic
1077998916 11:7477080-7477102 AGGAAGGAGGAGGAGGAAGAGGG + Intergenic
1078143220 11:8706500-8706522 ATGAAGCAGGAGGAGGGAGATGG - Intronic
1078168227 11:8909423-8909445 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1078476584 11:11635327-11635349 CGGAAAGAGCAGGAGGCAGAGGG - Intergenic
1078960320 11:16259764-16259786 ATGATTGGGAGGGAGGAAGAGGG + Intronic
1079099315 11:17531088-17531110 ATGAATGAGGGGGAGGCAGGAGG + Intronic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079810962 11:24999418-24999440 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1079845221 11:25457939-25457961 AGGCAGGAGAAGGAGGAAGATGG - Intergenic
1080039504 11:27744508-27744530 ATGAATGAGAAATGGGAAGAGGG + Intergenic
1080237904 11:30092881-30092903 AGGAAGGAGAAGGAGGAAGGAGG - Intergenic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1080872366 11:36248096-36248118 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1081341571 11:41934181-41934203 AAGGAAGAGAAGGAGGAAGATGG + Intergenic
1081433928 11:43006126-43006148 AAGAAGGAAGAGGAGGAAGAAGG + Intergenic
1081522332 11:43894664-43894686 AAGAATGTAAAGGAGGAAGATGG - Intronic
1082731565 11:56804380-56804402 ATGAAAGAGAAGGGAGAAGAAGG + Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1083296982 11:61720220-61720242 ATGCAGGAGAAAGAGGAAGATGG - Exonic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083437887 11:62655262-62655284 AAGAAAGAGAAGGAGGGAGAGGG + Intronic
1083616368 11:64028485-64028507 AGGAAGGAGCAGGAGGCAGGAGG + Intronic
1084006451 11:66325994-66326016 AGTAAGGGGCAGGAGGAAGAGGG - Intergenic
1084347670 11:68566310-68566332 AGGAAAGAGAAGGAGGAAGGAGG - Intronic
1084441474 11:69176553-69176575 AAGAATGAGGAGGAGAAATAAGG - Intergenic
1084791341 11:71477098-71477120 TTGCTTGAGCAGGAGGCAGAAGG - Intronic
1085807659 11:79651055-79651077 AGGAAGGAGAAGAAGGAAGATGG - Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1086019973 11:82215924-82215946 ATGAATGATCAGAAGGCTGAGGG - Intergenic
1086048833 11:82565104-82565126 AAGAAGGAGGAGGAGGAACAAGG + Intergenic
1086246616 11:84760906-84760928 ATGGATGGGGAGCAGGAAGAGGG - Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086598188 11:88600260-88600282 GAGAAGGAGCAGGAGGAAGAAGG - Intronic
1087384923 11:97458776-97458798 AGGAATGAGTAGAAGGCAGAGGG + Intergenic
1087430011 11:98041631-98041653 AAGAAAGAGCAGGCAGAAGAAGG - Intergenic
1087567478 11:99879883-99879905 ATGAGTGTGCAGGAGGACTATGG - Intronic
1087979272 11:104590931-104590953 ATGGATGACCAGGAGGCTGAGGG + Intergenic
1088070140 11:105773108-105773130 AAGAATGAGAAGGAGGAGTAGGG - Intronic
1088447168 11:109944092-109944114 ATGAGGGAGAGGGAGGAAGAAGG + Intergenic
1088593158 11:111420440-111420462 ACCAAGGATCAGGAGGAAGAAGG + Intronic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1088986545 11:114914261-114914283 ATGACTGAGAAGAAGGAACAGGG - Intergenic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089325417 11:117653438-117653460 ATGAATGAGCTGGGGGAAGGGGG - Intronic
1089359250 11:117875446-117875468 AGGAATGGGCAGGAGAAAGAGGG + Intronic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089739705 11:120573924-120573946 ATGAATCAGCAGGAGCCCGAAGG - Intronic
1089831980 11:121336954-121336976 ATTAATCAAAAGGAGGAAGATGG - Intergenic
1090342300 11:126034960-126034982 GAGGATGAGCAGGAGGAATATGG + Intronic
1090664992 11:128909019-128909041 ATGAAGGAGCAGGAAGCAGGTGG + Intronic
1090751392 11:129749186-129749208 AAGTATGTGCAGGAGGCAGAAGG - Intergenic
1090974636 11:131671005-131671027 AGGACAGAGCAGGAGGAAGAGGG - Intronic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1091074181 11:132599357-132599379 GAGAAGGAGGAGGAGGAAGAAGG + Intronic
1091097806 11:132840440-132840462 ATGAATGAGAATGAGCAAAACGG - Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1093175239 12:15905992-15906014 ACGAATGAGTAGGGGCAAGAGGG - Intergenic
1093745066 12:22730999-22731021 ATGAATGACCCTGAGGAATAAGG - Intergenic
1093823239 12:23648015-23648037 ATGATTGAGCTTGATGAAGAAGG - Intronic
1093977842 12:25442100-25442122 ATGAAGGAGCAGGAATATGAGGG - Intronic
1094088138 12:26616818-26616840 ATTCAGGAGGAGGAGGAAGAGGG - Intronic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095833503 12:46612555-46612577 AAGAAAGAAAAGGAGGAAGATGG - Intergenic
1095958031 12:47817746-47817768 ATGAAAGGCCAGGAGAAAGAAGG + Intronic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1097159324 12:57035183-57035205 ATGAAAGAAAAGGAAGAAGAAGG + Intronic
1097880374 12:64681149-64681171 AAGAATGAGGAGAAGGAAAAGGG - Intronic
1097982299 12:65746844-65746866 TTGAATGAAGAGGAGAAAGAAGG + Intergenic
1097986172 12:65785509-65785531 ATGAATGATCAGGAGGCTGAGGG - Intergenic
1098461866 12:70741405-70741427 AGGAAGGAGGAGGAGGCAGAGGG + Intronic
1098495894 12:71135328-71135350 GAGAAGGAGGAGGAGGAAGAAGG + Intronic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1099417337 12:82407637-82407659 AAGAATAAGCAGGAGGAAACAGG + Intronic
1100086661 12:90918855-90918877 ATGAATGTGAAGGATGAAAATGG - Intronic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102042593 12:109810295-109810317 ACTAAAGAGAAGGAGGAAGATGG + Intronic
1102394298 12:112574366-112574388 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394321 12:112574435-112574457 ATGAAGGTGGAGGAGGTAGAGGG + Intronic
1102394332 12:112574474-112574496 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394340 12:112574501-112574523 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102394405 12:112574702-112574724 ATGAAGGTGGAGGAGGGAGAAGG + Intronic
1102394433 12:112574791-112574813 ATGAAGGTGGAGGAGGGAGAGGG + Intronic
1102751139 12:115295784-115295806 ATGAGAGACCAAGAGGAAGAGGG - Intergenic
1102792326 12:115657817-115657839 AAGAAGGAGGACGAGGAAGAAGG - Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1103448517 12:121010897-121010919 GTGAATGAGCATGAACAAGATGG - Exonic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103583910 12:121936915-121936937 ATGAAAGAGCAGGTGGCAGGAGG + Intronic
1103921557 12:124402059-124402081 AGGAAAGAGCGGGAGGAAGCAGG + Intronic
1103936739 12:124481143-124481165 AAGAAAGAGAGGGAGGAAGAAGG + Intronic
1104091464 12:125521275-125521297 AAGAAGGAGAAGGAGAAAGAAGG - Intronic
1104345706 12:127995126-127995148 ATGAAAGAACAAGAAGAAGAAGG + Intergenic
1104360955 12:128132684-128132706 ATGAAAGAGCAGGAAGAACTGGG - Intergenic
1104467455 12:129002534-129002556 CTGAAAGAACAGGAGAAAGAGGG - Intergenic
1104555769 12:129798682-129798704 ATGAATGTGCAGAAGAGAGAAGG + Intronic
1104622893 12:130331630-130331652 ATGCATGAGGAGGCGGGAGAAGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105717527 13:23082093-23082115 TTGCCTGAGGAGGAGGAAGAAGG - Intergenic
1105751713 13:23426939-23426961 AAGAAAGAGAAGGAGGAAGAAGG - Intronic
1106089630 13:26578655-26578677 GGGAAGGAGCAGGAGGGAGAGGG - Intronic
1106594845 13:31127258-31127280 AGGCCTGAGCAGCAGGAAGATGG + Intergenic
1106758327 13:32844235-32844257 ATGAGGGAGCAGGAGTGAGAAGG - Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107299319 13:38948517-38948539 ATGAATGGGCTAGAGGAGGAGGG - Intergenic
1107448966 13:40491646-40491668 AAGAAGGAACAGGAGCAAGATGG + Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108524252 13:51272392-51272414 AGAAAGGAGCAGGAGGGAGATGG + Intronic
1108546703 13:51502385-51502407 ATGAGTCAGCTGGAGGCAGAAGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1109733684 13:66452449-66452471 ATAAATGGGGATGAGGAAGAGGG - Intronic
1109835482 13:67851265-67851287 ATGGATGACCAGGAGGCTGAGGG - Intergenic
1110761777 13:79238626-79238648 AAGAAAGAGGAGGAGGAAGAGGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111638287 13:90933288-90933310 ATCACTGAGCAGGATGAAGTGGG + Intergenic
1111741505 13:92211348-92211370 AGGAATGAGGAAGAGCAAGATGG - Intronic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1112475727 13:99729724-99729746 ATAAAGGAGAAAGAGGAAGATGG + Intronic
1112689055 13:101868853-101868875 ATGAATGGGCAGGAAGAAGCAGG + Intronic
1113909865 13:113836682-113836704 GGGAATGAGGAGGAAGAAGAGGG + Intronic
1113909870 13:113836703-113836725 GGGAATGAGGAGGAAGAAGAGGG + Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1114726327 14:24941536-24941558 AGAAATGAGCAGGGGGAGGAGGG + Intronic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115474837 14:33802899-33802921 AGGAATGAAGAGGAGGGAGAGGG - Intronic
1115634277 14:35276321-35276343 AAGAATGAGAAGAAGGAACAGGG + Intronic
1115864272 14:37726059-37726081 AGAAAAGAGGAGGAGGAAGAAGG - Intronic
1116524776 14:45891124-45891146 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1116705664 14:48295502-48295524 TTAAATGAGCAGGAGGGAGGTGG - Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117256026 14:53978663-53978685 AAGAAAGAGTAGGAGGAAGAAGG + Intergenic
1117294060 14:54362787-54362809 GTGTATGACCAGGAGGAAGCAGG + Intergenic
1117362550 14:54991346-54991368 CTCAAAGAGGAGGAGGAAGATGG - Exonic
1117601554 14:57381135-57381157 AAGAAAGAGAAAGAGGAAGAAGG + Intergenic
1118197517 14:63641461-63641483 AGGAAAGAGCAGGAGGAAACAGG + Intronic
1118440337 14:65806196-65806218 ATGAGGGAGCAGGATGATGAGGG - Intergenic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1118774770 14:68966902-68966924 AGGAAGGGGCAGGATGAAGAGGG + Intronic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119227671 14:72956464-72956486 CTGCATGTGCACGAGGAAGAAGG + Exonic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119996822 14:79262395-79262417 AGAAAGGAGGAGGAGGAAGAAGG + Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1120389485 14:83887947-83887969 ATGAAAGCACAGGAAGAAGATGG - Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120690551 14:87588093-87588115 AGGAATGATGAGGAGGAAGTAGG + Intergenic
1120831440 14:89000891-89000913 ATGAAGGAGTAGGAGGGGGAAGG - Intergenic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121600145 14:95197264-95197286 AGAAAAGAGGAGGAGGAAGAAGG + Intronic
1121637720 14:95465165-95465187 ATTAAAGGGCAGGAGGAGGAAGG + Intronic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121735719 14:96216717-96216739 AGGAAGGAGGAGGAGGAAGGAGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121777151 14:96598361-96598383 AGGGAGGAGGAGGAGGAAGACGG - Intergenic
1121832841 14:97066636-97066658 ATGGATGGGAAGGAGGAAGGGGG - Intergenic
1122322237 14:100862038-100862060 AGGAAGGAAGAGGAGGAAGAAGG - Intergenic
1123796925 15:23781789-23781811 ATGAATTCGCAGTAGGAATAAGG - Intergenic
1124003446 15:25778191-25778213 ATGAATGATCAGTTGGAAGTGGG - Intronic
1124180807 15:27471746-27471768 TTAAATTAGTAGGAGGAAGAAGG - Intronic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1125513136 15:40303420-40303442 AAGAATGAGCAATAGGGAGAAGG + Intronic
1125515487 15:40317239-40317261 ATGAAAGACCAGGAGGTTGATGG - Intergenic
1125673798 15:41491986-41492008 ATGAAGGGGTAAGAGGAAGAAGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126375634 15:47994170-47994192 AAGAAGGAGAAGGAGGAAGACGG + Intergenic
1126480057 15:49109336-49109358 ATGGATGATGAGGAGGAAAAAGG + Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126733681 15:51710311-51710333 ATGAAAGAGGAGGAGAATGACGG + Intronic
1126881502 15:53103629-53103651 ATGAATGAGGAGGATGATGAAGG + Intergenic
1126914930 15:53455848-53455870 AAGAAAGATGAGGAGGAAGAGGG + Intergenic
1127352723 15:58169081-58169103 AAGAACCAGCAGGAAGAAGAAGG + Intronic
1127487675 15:59434630-59434652 AGGAACTAGCAGGAGAAAGAAGG - Intronic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128095718 15:64953419-64953441 AGGAAGGAGGAGGAAGAAGAAGG - Intronic
1128095812 15:64954524-64954546 AAGAAGGAGAAGGAGGAAGAAGG - Intronic
1128095835 15:64954727-64954749 AAGAAGGAGAAGGAAGAAGAAGG - Intronic
1128285883 15:66436732-66436754 ATGAATTAGCTGGAGAAAGGTGG - Exonic
1128441029 15:67708679-67708701 GGCAATGGGCAGGAGGAAGAAGG - Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128805030 15:70524415-70524437 TTCAATGAGCAGGAGCCAGATGG + Intergenic
1128844144 15:70874493-70874515 TTTAAAGAGCAGGTGGAAGAAGG + Intronic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1130241332 15:82195679-82195701 AAGTTTGAGCAGGAGGAAAATGG - Intronic
1130447862 15:84020967-84020989 ATGATTTAGCAGGAGGAACAGGG - Intronic
1130459091 15:84145474-84145496 AAGTTTGAGCAGGAGGAAAATGG + Intergenic
1130619424 15:85446434-85446456 ACGAATGAGCATGTAGAAGATGG + Intronic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901075 15:97088555-97088577 AGGAAAGAGGAGGAGGATGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901093 15:97088623-97088645 AGGAAGGAGGAGGAGGAAGGAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131938385 15:97533436-97533458 ATGCATATGCAGGAGGGAGATGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132196650 15:99918765-99918787 TTGATTGAGCAGGAAGAACAGGG - Intergenic
1133294311 16:4743463-4743485 AGGAAGGAGGAGGAGGGAGAAGG - Intronic
1133366719 16:5216138-5216160 AGGAATGGGCAGGAGGAATGTGG + Intergenic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133392790 16:5422904-5422926 AGGAAAGAGGAGGAGGGAGAAGG + Intergenic
1133485308 16:6214291-6214313 ATGAAAGAGTAGGAGGGAGAGGG + Intronic
1133499743 16:6354574-6354596 GGGAATGAGCCAGAGGAAGAGGG - Intronic
1133971598 16:10572085-10572107 ATGAGGGAGCAGGAGAAAGAGGG + Intronic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134410348 16:13998724-13998746 AAGAAGGAGGAGGAGGAACAAGG + Intergenic
1134650508 16:15904777-15904799 ACCAAAGAGCAGGTGGAAGATGG - Intergenic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1135596303 16:23745987-23746009 ATTAGTGAGCAGAAGGGAGATGG + Intergenic
1135662026 16:24305201-24305223 ATGAATGGGGATGAGGAATATGG + Intronic
1136539099 16:30918717-30918739 AGGAAGGAGGAGGAGGAAGGAGG - Intergenic
1136884224 16:33921724-33921746 CTGCATGAGAAGGAGGAAGGAGG - Intergenic
1137512566 16:49114583-49114605 AGGAAAGTGGAGGAGGAAGAAGG - Intergenic
1137637134 16:49996345-49996367 CTGCCTGAGCAGGTGGAAGAGGG - Intergenic
1137740684 16:50769796-50769818 AGGATGGGGCAGGAGGAAGAGGG - Intronic
1137841070 16:51641336-51641358 AGGAATGAGCAACAGGAAAAGGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138126165 16:54440468-54440490 ATGGAGGAGGAGGAGGAAGGAGG - Intergenic
1138372736 16:56540220-56540242 GTGAATGACCATGAGGAAGGAGG - Intergenic
1138538444 16:57673276-57673298 GTGAATGGGCTGGACGAAGATGG - Intronic
1138541608 16:57691080-57691102 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138541615 16:57691106-57691128 GAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1138541623 16:57691135-57691157 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138754675 16:59468980-59469002 AAGAATGATCCAGAGGAAGAGGG - Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1139201340 16:64980608-64980630 AAGAATGAGATGGAGGTAGAGGG + Intronic
1139993250 16:70956640-70956662 ATGGCTGGGAAGGAGGAAGAAGG + Intronic
1140342487 16:74178312-74178334 CAGAATGAGAAGGAGAAAGAAGG + Intergenic
1140740443 16:77936771-77936793 AGGAAGGAGAGGGAGGAAGAGGG + Intronic
1140858767 16:79001065-79001087 ATTAATCTGCAGGAGAAAGAAGG + Intronic
1141278045 16:82605888-82605910 AGGAAGCAGCAGTAGGAAGATGG - Intergenic
1141412320 16:83843956-83843978 ATGCATGAGTAGGAGGGAAAAGG + Intergenic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141609714 16:85174525-85174547 ATGAATGGGAAGGAGGGGGAGGG - Intronic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1141865486 16:86747134-86747156 AGCAAAGAGCAGGAGGACGAGGG + Intergenic
1203141786 16_KI270728v1_random:1771705-1771727 ATGATGGAGGAGGAGGAGGAGGG - Intergenic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143270052 17:5668724-5668746 ATGAAGGAGAAGGAAGAAAAAGG - Intergenic
1143301047 17:5910887-5910909 AAGGATGAGGAGGAGGTAGAGGG + Intronic
1143622178 17:8087009-8087031 ATGAAGGAGCAGGATGGAGAAGG + Intronic
1143794700 17:9327253-9327275 AGGAAGGAGGAGGAGGAAGGAGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1145908423 17:28528863-28528885 AGGAAGGAGCTGGAGGAAGAGGG + Intronic
1146446186 17:32934659-32934681 ATGAGTGTGCAGGGGGAAGCAGG - Intronic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1146956539 17:36939369-36939391 ACCAGGGAGCAGGAGGAAGAGGG + Intronic
1147309672 17:39587850-39587872 AAGAATGAGGGGGAGGAATATGG + Intergenic
1147355740 17:39894933-39894955 ATGAAACAAAAGGAGGAAGAAGG - Intergenic
1147498807 17:40942511-40942533 AAGAAGGAGGAGGAGGGAGAAGG - Intergenic
1147498848 17:40942743-40942765 AAGAAGGAGGAGGAGGGAGAAGG - Intergenic
1147498858 17:40942804-40942826 AAGAAGGAGGAGGAGGGAGAAGG - Intergenic
1147710453 17:42459552-42459574 ATTAAAGAGCAGGAGGACGGAGG + Intronic
1147977489 17:44256113-44256135 ATGAATGAGTGGGTGGATGATGG - Intronic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148477822 17:47940961-47940983 CTGAATGGGAAGGGGGAAGAAGG - Intergenic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1148643314 17:49204361-49204383 AGGACTGGGCAGGTGGAAGAAGG + Intronic
1149302449 17:55317831-55317853 ATGCATGCGCTGGAGAAAGAAGG + Intronic
1149400419 17:56290171-56290193 CATATTGAGCAGGAGGAAGAAGG - Intronic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1149563777 17:57627738-57627760 AGGACGGAGCAGGAGGAGGAGGG - Intronic
1149618324 17:58021077-58021099 ATGAAAGTGCAGCAGAAAGATGG + Intergenic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151345264 17:73497573-73497595 ATGCAGGAGAGGGAGGAAGATGG - Intronic
1151405866 17:73885711-73885733 ATGAATGTGCCAGAGGAGGAAGG - Intergenic
1151432777 17:74075528-74075550 ATGGATGAGGAGGTGGAATAGGG + Intergenic
1151576612 17:74955660-74955682 ATGAATGAACTGGGGGCAGAAGG + Intronic
1152162765 17:78679309-78679331 ATGAAGCACCAGGAGGGAGAGGG + Intronic
1152249163 17:79202650-79202672 ATAAAAGAGCAGGAGGGAGGTGG - Intronic
1152336643 17:79702876-79702898 GAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1152594304 17:81230757-81230779 ATTGATGAGGAGGAAGAAGAGGG - Intronic
1152601945 17:81267503-81267525 GTGAGTTAGCAGGAGAAAGAAGG - Intronic
1153185218 18:2478757-2478779 AGGAAGGAGGAGGAGAAAGAAGG + Intergenic
1153185227 18:2478801-2478823 GAGAAAGAGGAGGAGGAAGAAGG + Intergenic
1153185232 18:2478823-2478845 GAGAAGGAGGAGGAGGAAGATGG + Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153381864 18:4449229-4449251 AAGAAGGAGGAGGAAGAAGAGGG + Intronic
1153794319 18:8609220-8609242 ATGAAAGAGCCGGCGGAAGAGGG + Intergenic
1153813319 18:8771008-8771030 ATGAGTGAACAGGAGGAAGGGGG + Intronic
1154055139 18:11005606-11005628 GTGAAGGAGCTTGAGGAAGATGG - Intronic
1154070044 18:11146152-11146174 AAGAATGAGCTGGATAAAGAAGG + Intronic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155170727 18:23265220-23265242 ATGAGAGAGCAGGAGGAGAACGG + Intronic
1155283652 18:24266534-24266556 ATGAAGGAAAAAGAGGAAGAAGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1155985630 18:32227813-32227835 AGGAAGGAGGAGGATGAAGAGGG + Intronic
1156111419 18:33731847-33731869 ATGTGTGAGGAGGAGGAAGGGGG - Intronic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1158372503 18:56824902-56824924 CTTAATGAGCAGGTGGAAGTTGG + Intronic
1158835882 18:61331729-61331751 GTGAAGGAGAAGGAGGAAGAGGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159546878 18:69850861-69850883 GAGAAGGAGGAGGAGGAAGAAGG - Intronic
1159657770 18:71053012-71053034 ATGAAATAGGAGGAGGACGAAGG - Intergenic
1159740950 18:72169446-72169468 ATACAGGAGCAGGAGGAAGATGG - Intergenic
1160007179 18:75076037-75076059 AGGGAGGAGGAGGAGGAAGAGGG + Intergenic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1160448663 18:78947080-78947102 AGGAAGGAGGAGGAGGGAGAAGG + Intergenic
1160841105 19:1147412-1147434 ATGAACGGGCTGGAGGGAGATGG + Exonic
1161261612 19:3340859-3340881 AGCAATGAGCAGGTGGATGATGG - Intergenic
1161989038 19:7673504-7673526 AAGGATGAGGAGGAGGAAGGAGG - Intergenic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1164290598 19:23865592-23865614 AATAATGAGCAGGAGAAAGGGGG + Intergenic
1164296036 19:23910923-23910945 AGGAAGGAGAAAGAGGAAGAAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164493086 19:28732139-28732161 AAGAAGGAGAAGGAGAAAGAAGG + Intergenic
1164592038 19:29512547-29512569 AGGAATGAGGAGGAAGAAGAGGG + Intergenic
1164592077 19:29512691-29512713 AGGAATGAGGAGGAAGAAGAGGG + Intergenic
1164592297 19:29513507-29513529 GTGGATGAGGAGGAAGAAGAGGG + Intergenic
1164718649 19:30415100-30415122 AAGAAGGAGAAGGAGGAAGAAGG - Intronic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1164725769 19:30464771-30464793 ATGAGTGCCCAGGAGGGAGAGGG + Intronic
1164891260 19:31825690-31825712 ATGAATGAGAAGGAGGTGTAGGG - Intergenic
1165071547 19:33258108-33258130 ATGAATGAGAAGGGCCAAGAAGG - Intergenic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165363346 19:35350190-35350212 AGGAAGGAGCGGGAGGAGGAAGG - Intergenic
1165416072 19:35694257-35694279 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1165431646 19:35776332-35776354 ATGAATGAGCGGGAGCAGCATGG - Intronic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165821183 19:38677099-38677121 AAGAATGAGGAGGAGGTAGGTGG - Intronic
1166104253 19:40589688-40589710 AGGAAGGAGCAGAAGAAAGAAGG + Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166343085 19:42150342-42150364 ATGGATGAGGAGGAAGAGGAGGG + Intronic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167172696 19:47843809-47843831 AAGAAGGAGGAGGAGGAACAGGG + Intergenic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167608344 19:50493579-50493601 AGGAAAGAGGAGGAGGAAGGAGG - Intergenic
1168028572 19:53661961-53661983 AAGAATGGGCAGGAGGCAGAAGG - Intergenic
1168145835 19:54419765-54419787 ATGAATGAGCTGGTGAATGACGG - Intronic
1168332374 19:55578144-55578166 AAGGCCGAGCAGGAGGAAGAAGG - Exonic
925358552 2:3261341-3261363 ATGAATGAGCAGAAGGCTGAGGG + Intronic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925961442 2:9020977-9020999 ATGAAAGAAAAGGAGGAAGAAGG - Intergenic
926208271 2:10849401-10849423 AGGCTGGAGCAGGAGGAAGAGGG + Intronic
926266840 2:11330879-11330901 AGGAATGAGGAGGAGGGAGGAGG + Intronic
926859899 2:17298649-17298671 ATGAGTGAGAAGGAAGGAGATGG - Intergenic
927277817 2:21276459-21276481 GTGAATGAGCAGGAGACAGTTGG + Intergenic
927417144 2:22891347-22891369 AGGAAAGAGCAGGAGGACCATGG + Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
927920928 2:26971149-26971171 AGGAGTGAGGAGGAGGGAGAAGG - Intronic
928260985 2:29766488-29766510 ATGAATGAACAGGAGGTGGTGGG - Intronic
928429137 2:31203490-31203512 AGGAATAAGAAGGAGGAATAGGG - Intronic
928644009 2:33332739-33332761 ATTAATGAGAGGGAGGAGGAGGG + Intronic
928952623 2:36826501-36826523 AAGAAGGAGCAGGGGCAAGAGGG - Intergenic
929566649 2:42990752-42990774 ATGAATGAAAAGAAGTAAGAAGG + Intergenic
929680890 2:43992598-43992620 ATGAAGGGGCTGGAGGAAAAGGG + Intronic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930586747 2:53276346-53276368 ATGAATGTACAGGAAGAATAGGG + Intergenic
931182209 2:59914393-59914415 ATGAAAAAACAGGAGCAAGAAGG - Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931992781 2:67807805-67807827 AAGAAGGAGAAGGAAGAAGAAGG - Intergenic
932208165 2:69902298-69902320 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
932406392 2:71515585-71515607 AGGAAAGAGCAGGAGGAAGGGGG - Intronic
932669926 2:73728505-73728527 GTGAATGTGGAGGAGGAAGACGG + Intergenic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933231069 2:79808256-79808278 ATGAAAGAGGAGAAGGGAGAAGG + Intronic
933496248 2:83053635-83053657 GAGAAAGAGGAGGAGGAAGAGGG + Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
935542132 2:104361118-104361140 TGGAATGAACAGGAGGATGAAGG + Intergenic
935543206 2:104373832-104373854 AGGAATGAGCAGGAGGCATTAGG - Intergenic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936386028 2:112030125-112030147 ATGCAGGAGCAGGAGCAAGAGGG + Intergenic
936711852 2:115140949-115140971 ATGAATGAACTAGAGGAATATGG + Intronic
936930133 2:117779568-117779590 ATGAATGAACTGAAGCAAGAAGG + Intergenic
936993700 2:118392265-118392287 AGGAAGGAGTAGGAGGAAGAAGG + Intergenic
937062698 2:118992244-118992266 ATGACTGAGCAGGAAGAAACGGG - Intronic
937419339 2:121741249-121741271 ATGAGAGACCAGGAGGGAGAGGG + Intronic
937493885 2:122398093-122398115 AAGGATGAGAAGGTGGAAGATGG + Intergenic
938017580 2:127880278-127880300 ATGGATGAACAGGAAGAAAAGGG - Intronic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938742283 2:134244363-134244385 ATCAATGAGCACAGGGAAGAAGG - Intronic
939097649 2:137852787-137852809 ATACAAGAGCAGGATGAAGAAGG + Intergenic
939450457 2:142367069-142367091 ATGGATGAGAAGCTGGAAGAGGG + Intergenic
939826771 2:147024734-147024756 GTAAAGGAGAAGGAGGAAGAGGG + Intergenic
940287793 2:152049479-152049501 AAGAATGAGAAGGAGAAATACGG - Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941657221 2:168157049-168157071 ATTAAGGAGCTAGAGGAAGATGG - Intronic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
942396350 2:175553798-175553820 ATGAATGAAAAGTGGGAAGAAGG - Intergenic
942783674 2:179675627-179675649 AGGCAAGAGCAGGAGGAAAAGGG + Intronic
942843019 2:180387022-180387044 ATGAATCAGTAGAATGAAGATGG - Intergenic
943413545 2:187569523-187569545 AGGAATGTGTAGGAAGAAGATGG - Intergenic
943794845 2:191979334-191979356 ATGAATCAGCTGGAAGAAAAGGG - Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
945047035 2:205790725-205790747 ATGAATCAACAAGAGGAAGGTGG - Intronic
945276713 2:207995147-207995169 ATGAATCTGCAAAAGGAAGATGG - Intronic
945463153 2:210135306-210135328 ATGAATGAGAAAGAGGTACATGG + Intronic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946866825 2:224048494-224048516 AAGAATGAGGAAAAGGAAGAGGG + Intergenic
947129168 2:226903992-226904014 ATGGATGGGGAGGTGGAAGAAGG - Intronic
947151937 2:227124497-227124519 ATGAATGAGCATGAAGAAAAGGG - Intronic
948049583 2:234969459-234969481 ATGAATGGGCAGGAGGAACAAGG - Intronic
948091824 2:235301856-235301878 AGGAGGGAGGAGGAGGAAGAAGG - Intergenic
948279578 2:236736549-236736571 ATGAATGGGCAGTAGGAATCTGG + Intergenic
948997928 2:241593428-241593450 ATGAATCCGCAGGAGAAAGATGG + Intronic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169228382 20:3870334-3870356 ATGATTCAGCGGGAGAAAGAAGG - Exonic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1169957867 20:11125640-11125662 ATTAATAAGTAGGAGGAAGCTGG + Intergenic
1170953932 20:20961414-20961436 ATGGCTGAGGAGGAGGAATAGGG + Intergenic
1171174456 20:23040979-23041001 ATGATATAGAAGGAGGAAGAGGG + Intergenic
1171523775 20:25794532-25794554 ATGCATGTGCCGGGGGAAGAGGG + Intronic
1171553052 20:26061351-26061373 ATGCATGTGCCGGGGGAAGAGGG - Intergenic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1172013505 20:31860188-31860210 ATGAATGAGGAGTAGGAAGTTGG + Intronic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172347346 20:34213157-34213179 ATGGAGGAGAAGGAGCAAGAAGG - Intronic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173355398 20:42282888-42282910 ATGAGTGAGCAGATGGAAGGAGG + Intronic
1173583248 20:44162200-44162222 ATAAATGTCCAGGAGCAAGATGG + Intronic
1173791620 20:45831644-45831666 AAGAAGCAGGAGGAGGAAGAAGG + Intronic
1173858290 20:46265307-46265329 GAGAAAGAGGAGGAGGAAGAGGG - Intronic
1174212528 20:48891162-48891184 AAGAAGGAGAAGGAAGAAGAAGG + Intergenic
1174720644 20:52808427-52808449 GAGAAAGAGGAGGAGGAAGAGGG - Intergenic
1175224515 20:57437254-57437276 AAGAAGGAGAAGGAGGAACAAGG - Intergenic
1175286410 20:57839763-57839785 GTGAATGAGCAGGAGGGTGGTGG + Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176669620 21:9720833-9720855 AGGAATGAGCAGGAGCAGAATGG + Intergenic
1176720411 21:10388120-10388142 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1177056753 21:16315216-16315238 AAGAATGGACAGGAGTAAGAAGG - Intergenic
1177816867 21:25987267-25987289 ATGAGTGAGCAGGCTGAAGGAGG - Intronic
1178085209 21:29105351-29105373 TGGAATGAGCAACAGGAAGAAGG - Intronic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178234269 21:30823238-30823260 TGGCTTGAGCAGGAGGAAGAGGG - Intergenic
1178406381 21:32326680-32326702 ATGCCAGAGCAGGAGGAAGTGGG - Intronic
1178505267 21:33157442-33157464 AGGAAGGAGGAGGAGAAAGAGGG - Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178701866 21:34840782-34840804 ATGAAACAGCTGGAGGCAGAGGG - Intronic
1179576515 21:42311546-42311568 ATGAATGAGCTGGTGGCAGTGGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179943729 21:44656263-44656285 AGGAAGGAGTAGGAGGAACAGGG - Intronic
1179981415 21:44897802-44897824 AGGACTGAGCTGGAGGAAGGAGG - Intronic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1180725022 22:17940413-17940435 AGGAAGGAGGAGGAGGAAGAAGG + Intronic
1181007415 22:20020647-20020669 AGGGATGACCAAGAGGAAGATGG + Intronic
1181170112 22:21003362-21003384 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1181316431 22:21973677-21973699 ATCAATGAGCAGCAAGAACAAGG + Intronic
1181323029 22:22023185-22023207 CGGAATGAGCAGGAGGGCGATGG + Intergenic
1181856998 22:25789075-25789097 AAGAAGGAGGAGGAAGAAGAAGG - Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1181977198 22:26738428-26738450 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1182050649 22:27310422-27310444 AAGAAAGAGATGGAGGAAGATGG + Intergenic
1182526676 22:30924767-30924789 ATGACTTGGAAGGAGGAAGATGG - Intergenic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182755882 22:32678549-32678571 AGGAAGGAGGAGGAGGATGAAGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183372454 22:37441552-37441574 ATGAAAATGCAGGAGAAAGAGGG - Intergenic
1184067775 22:42130006-42130028 AGGAGTGAGCAGGTGGAAGGAGG + Intronic
1184070510 22:42143678-42143700 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184072250 22:42153313-42153335 AGGAGTGAGCAGGTGGAAGGAGG + Intergenic
1184216304 22:43069683-43069705 AGGAAGGAGCTGGAGAAAGAAGG - Exonic
1184509341 22:44924034-44924056 AAGAAAGAGGAGGAAGAAGAGGG + Intronic
1184522393 22:45002807-45002829 ATGAACGAGGAGGAGAGAGAGGG - Intronic
1184639824 22:45864649-45864671 ATGAATGGGGATGAGGAAGCAGG - Intergenic
1184741598 22:46431828-46431850 AGGGCTGAGCAAGAGGAAGAGGG - Intronic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184946475 22:47807673-47807695 GAGAAGGAGGAGGAGGAAGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949626242 3:5869737-5869759 ATAAATGATCAGAAGAAAGAAGG - Intergenic
949627372 3:5882053-5882075 AGGAAAGAGAAGGAGGAAGATGG - Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950128007 3:10522458-10522480 TGGAATGACCAGGAGGTAGAAGG - Intronic
950902541 3:16511131-16511153 ATGACTGAGAATGAGGATGAAGG + Intronic
951033822 3:17911101-17911123 AGGAAGAAGCAAGAGGAAGAAGG - Intronic
951804291 3:26627520-26627542 AGGGATGAGGTGGAGGAAGATGG + Intronic
951979284 3:28547971-28547993 ATGCATGGGCAGGAGGAGAATGG + Intergenic
952530941 3:34261061-34261083 AGGAAAGAAAAGGAGGAAGAAGG - Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952948015 3:38494201-38494223 CTGAATGAGCAAGTAGAAGAGGG + Intergenic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
953370961 3:42388061-42388083 ATGAATGAACAGGGGGGAAAAGG - Intergenic
954090524 3:48280127-48280149 ATGAATGCGTGGGAGGGAGATGG + Intronic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954813464 3:53262397-53262419 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
954848812 3:53582937-53582959 TTGAAAGTGTAGGAGGAAGAGGG + Intronic
954853985 3:53626980-53627002 ATTAGTGAGAAGGAGGCAGAGGG + Intronic
955068449 3:55552413-55552435 AAGAATGAGGGGGAGGAAGAAGG - Intronic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955536001 3:59924313-59924335 ATGGATGGGAGGGAGGAAGAGGG - Intronic
955602705 3:60664440-60664462 AAGAAGGAGGAAGAGGAAGAAGG - Intronic
955974762 3:64469238-64469260 ATGACTGGGAAAGAGGAAGATGG + Intergenic
956198799 3:66683924-66683946 AGGAGGGAGGAGGAGGAAGAAGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956237664 3:67092590-67092612 AAGAAAGAGCAGCAGGAATATGG - Intergenic
956368723 3:68534846-68534868 CTGAAGGAGGAGGAGGAACAGGG + Intronic
956482664 3:69688609-69688631 GAGAAGGAGGAGGAGGAAGAGGG - Intergenic
956690762 3:71875923-71875945 TTGCATGAGCAGGAGGAAAGAGG + Intergenic
957459825 3:80501891-80501913 CTAAATGTGCAGGAGAAAGAAGG - Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958506134 3:94979316-94979338 ATGGTGGAGCAGGTGGAAGAGGG - Intergenic
958528542 3:95293020-95293042 ATTTATGAGCAGCATGAAGATGG + Intergenic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
959999273 3:112713815-112713837 TTGCCAGAGCAGGAGGAAGACGG - Intergenic
960034788 3:113091584-113091606 AAGAAAGAGAAGGAGGGAGAGGG + Intergenic
960044872 3:113186899-113186921 ATGGAGGAGCAGGAGGCTGAGGG + Intergenic
960174164 3:114497519-114497541 ATGAAAGAGCAGAAAGAAAAGGG - Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960846650 3:122010075-122010097 ACGCATGAGAAGTAGGAAGAAGG + Intronic
960885052 3:122384691-122384713 AGGAAGGAGCAGGGGGAAGAGGG - Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
962486631 3:135849911-135849933 AGGAAGGAAGAGGAGGAAGAGGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963046162 3:141104227-141104249 AGGAATGGGCTGGAGGGAGAGGG + Intronic
963321505 3:143814179-143814201 CTGACTCAGCAGGAGTAAGAGGG + Intronic
963488484 3:145967775-145967797 ATGTAAGAGTAGGAGAAAGAGGG - Intergenic
963598700 3:147359016-147359038 ATGACAGAGAAGGAGGAACAGGG - Intergenic
963657243 3:148070593-148070615 ATGGATGAGGAGGAAGAAAAAGG + Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964504629 3:157385267-157385289 ATGAATGAGATGTAGGAAAAAGG - Intronic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
965734083 3:171802740-171802762 ATGAATGAGCATGAGAAATCAGG + Intronic
965765945 3:172130108-172130130 ATGAATGAGCTGGCGGCAAAAGG - Intronic
966022446 3:175232102-175232124 AAGAAGGAGAAGGAGAAAGAAGG + Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966351251 3:179034619-179034641 ATGGATGACCAGGAGGAAGCTGG - Intronic
966898422 3:184463058-184463080 ATTAATAAGCAGGAGGCTGAGGG + Intronic
966912674 3:184568343-184568365 ATGTATCTGCAGGAGGCAGAGGG - Intronic
966981358 3:185139141-185139163 AGGAAGGAGGAGGAGGAAGGAGG + Intronic
968161612 3:196431965-196431987 ATGAAGGAGGAGGAGGAGGGCGG + Intronic
968313556 3:197703741-197703763 ATGAATGAGGAGGAGGGTGAAGG + Intronic
968335883 3:197913165-197913187 AAGAAAGAGCAGCAGGCAGATGG - Intronic
968762310 4:2449130-2449152 ATGAAGGAGCAGGAGGGGGCCGG - Intronic
968914165 4:3489913-3489935 ATGAATGAGCAGGAGACAGAAGG - Intronic
968914192 4:3490033-3490055 ATTAATGAGTAGGAGGAAGAAGG - Intronic
968914216 4:3490146-3490168 ATGAATGAGCAGGGTGGGGAAGG - Intronic
968914350 4:3490741-3490763 AGGAATGAGCAGGAGGAAGAAGG - Intronic
968914387 4:3490899-3490921 ATGAATGAGCAGAGGAGAGAAGG - Intronic
968914403 4:3491000-3491022 ATGAATGAGCAGGAAGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
968914509 4:3491536-3491558 ATGAATGAATAGGTGGGAGAAGG - Intronic
969047111 4:4344428-4344450 ATGAACCAGCAGGAGGAGGCTGG - Intergenic
969307737 4:6335463-6335485 AGGAGTGAGCAGGGGGAACAGGG + Intronic
969405052 4:6986232-6986254 ATGCATGAGCAGCAGGGAAATGG - Intronic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
970017160 4:11524978-11525000 ATGAAATAGCAGCAGGAACATGG - Intergenic
970073372 4:12189184-12189206 ATAATTGAGAAGGAGTAAGAGGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970782434 4:19754245-19754267 ATCCATGGGAAGGAGGAAGATGG - Intergenic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971744491 4:30561660-30561682 ATGAATGAACACGTAGAAGAAGG + Intergenic
971990515 4:33886565-33886587 ATGAAAGAACAGCTGGAAGAGGG - Intergenic
972591609 4:40493342-40493364 ATGGTTGAGGAGGAGGAAGAAGG + Intronic
972749110 4:41970944-41970966 ATGAGTGTGCATGAGGCAGAGGG - Intergenic
972750462 4:41982750-41982772 CTGCATGTGCACGAGGAAGAGGG + Exonic
973157750 4:46978240-46978262 ATGAGTGAGAAGGAGGCAGAAGG + Intronic
974373223 4:61044021-61044043 AGGCCTGAGCAGGAGGAAGCAGG + Intergenic
975372863 4:73608066-73608088 AGCAAGGAGGAGGAGGAAGAGGG - Intronic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976430071 4:84952577-84952599 AAGAATAAGCTGGAAGAAGAAGG - Intronic
977066537 4:92323536-92323558 ATGAAAGAGCAAGAGAATGAGGG - Intronic
977205247 4:94158613-94158635 AAGACAAAGCAGGAGGAAGAAGG - Intergenic
977518919 4:98056383-98056405 GTGAATGCCCACGAGGAAGAAGG + Intronic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978264747 4:106810305-106810327 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
978747891 4:112214747-112214769 ATAAATTGGCAGGAGAAAGAGGG + Intergenic
979000912 4:115217806-115217828 TAAAATGAGTAGGAGGAAGAAGG + Intergenic
979223690 4:118260306-118260328 TAGAATGAGAAGGTGGAAGAAGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980884957 4:138752352-138752374 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
980910789 4:138992510-138992532 AGGGAGGAGGAGGAGGAAGAAGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981754098 4:148122578-148122600 AAGGAAGAGAAGGAGGAAGAAGG - Intronic
981966355 4:150608340-150608362 TTGAAAGGGCAGGAGAAAGATGG + Intronic
982080161 4:151781806-151781828 ATGAATTAGCATTAGGAAAAAGG + Intergenic
982782404 4:159505006-159505028 ATGAGGGAGCAGGAGAGAGATGG + Intergenic
983139340 4:164129212-164129234 ATGATTAAGAAGGAGGAAGAAGG + Intronic
983329070 4:166301328-166301350 AGGAATGAGTAGGGGGGAGATGG + Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
984239962 4:177206398-177206420 ATGAAAGACCTGGATGAAGAAGG - Intergenic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
984628892 4:182039846-182039868 AAGAAAGAGAAGGAGGAAGTTGG + Intergenic
985067484 4:186137383-186137405 ATGAATGTGCATGAGGGACAGGG - Intronic
985405155 4:189630632-189630654 AGGAATGAGCAGGAGCAGAATGG - Intergenic
985519553 5:367094-367116 AAGCATAAGCAGGAGGAACAAGG + Intronic
985919872 5:2961950-2961972 ATGGTTGAACAGGAGGATGAAGG + Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986955494 5:13145359-13145381 ATGAATGGCCAGCAGGAAGGGGG + Intergenic
987322450 5:16783132-16783154 ATGAAGGGGCAGGAGGCAGAAGG + Intronic
987550452 5:19373194-19373216 ATGAGAGAGCAAGAGAAAGAAGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987985795 5:25144179-25144201 AAGGAGGAGGAGGAGGAAGAGGG + Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
989187471 5:38638985-38639007 AGGCATGAGCAGGCAGAAGAGGG - Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
989756214 5:44958755-44958777 AGGAAGGAGGAGAAGGAAGAAGG - Intergenic
990272301 5:54156798-54156820 GTAAATGAGCAGGAGGAAAGAGG + Intronic
990449232 5:55919411-55919433 ATGAAGGAGCAGGGGCCAGAGGG - Intronic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
991057088 5:62333420-62333442 AGGAAGGAACGGGAGGAAGATGG + Intronic
991149132 5:63345675-63345697 ATAATAGAGCAGGTGGAAGAGGG + Intergenic
991524142 5:67537618-67537640 ATGAAGGGGCAGGAGGCAGACGG + Intergenic
991647033 5:68810545-68810567 ATGAATGAGATGGAGAAAAAAGG - Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
992864410 5:80942920-80942942 AAGCATGAGCATGATGAAGAGGG + Intergenic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
993664225 5:90675320-90675342 ATCACTGTGGAGGAGGAAGATGG + Exonic
994223788 5:97228587-97228609 TTGACTGAGCTGGGGGAAGAAGG + Intergenic
994243434 5:97450505-97450527 ATACATGAGCATGAGGAAAATGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995016789 5:107318878-107318900 AAGAAGGAGGAGGAGGAAGGAGG + Intergenic
995235844 5:109829334-109829356 AGGAATGAGCAGGAGCATTATGG + Intronic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995566955 5:113440755-113440777 AAGAAAGAAGAGGAGGAAGAAGG + Intronic
996060839 5:119031625-119031647 AAGAATGAACAGGAGGATGTGGG - Intergenic
996351064 5:122542343-122542365 ATAAGTCAGCAGGCGGAAGAAGG - Intergenic
996938709 5:128977521-128977543 GGGAATGAGCAGGAGGAGAAAGG + Intronic
997251416 5:132391598-132391620 ATGTTTGAGGAGGAGGGAGAAGG + Intronic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997822594 5:137079316-137079338 ATGCATGGGCAGGAGGATGGAGG + Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998566092 5:143217167-143217189 ATGAATAAGGAAGAGGAAAAGGG + Intronic
998651445 5:144125666-144125688 AGGAATGGTCAGGAGGCAGACGG - Intergenic
998684519 5:144508551-144508573 AAGAGAGAGCAGGAGAAAGAGGG + Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999063707 5:148662178-148662200 ATGCATGAGAAGGTGGAATAGGG + Intronic
999517204 5:152313503-152313525 AATAAAGAGGAGGAGGAAGAAGG - Intergenic
999655503 5:153806663-153806685 ATGAAAGAACGAGAGGAAGAGGG + Intronic
1000127647 5:158262330-158262352 ATAAAAGAGCATGAGAAAGAGGG - Intergenic
1000714282 5:164621697-164621719 ATGAAAGAGCTGGAGTAAGCAGG - Intergenic
1000795243 5:165656632-165656654 ATGACTGAGGAGGATGATGAGGG + Intergenic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1001108370 5:168875129-168875151 AAGAATGAGAGGGAGGAAGGAGG + Intronic
1001132901 5:169079526-169079548 AGGAAGGAGGAGGAGGAAGAAGG + Intronic
1001132908 5:169079552-169079574 AAGAAGGAGGAGGAGGAAGGAGG + Intronic
1001135236 5:169097359-169097381 ATAAATGGGGAGGAGGAAAAGGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1001770935 5:174295277-174295299 AAGAAATAGGAGGAGGAAGAGGG + Intergenic
1001878929 5:175225960-175225982 AGGAATGAATAGGAGGTAGATGG + Intergenic
1001917530 5:175574197-175574219 GTGAAAGTGAAGGAGGAAGACGG - Intergenic
1002969139 6:1996159-1996181 AAGAATGAGAAAGAGGAAGGAGG - Intronic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003955980 6:11165317-11165339 AGGAAGGTGCAGCAGGAAGAAGG - Intergenic
1004052406 6:12099148-12099170 GTGAAGGAGCAGGAGCCAGAGGG + Intronic
1004055683 6:12136053-12136075 ATGAATAGGAAGGAGGAAGGAGG - Intronic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004372761 6:15066784-15066806 ATAAATAGGGAGGAGGAAGAAGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005101750 6:22179584-22179606 ATGAATGAACTGAAGCAAGAAGG - Intergenic
1005704877 6:28441540-28441562 ATGAGTGGGCAGTTGGAAGAGGG - Intronic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1006430448 6:33992731-33992753 CTCAATGAGCAGGAGGGTGAGGG - Intergenic
1006609743 6:35287147-35287169 CAGAATGAGCAGGAGGAAACTGG + Intronic
1006715571 6:36117398-36117420 AGGAATGAGGAGGAGGAAGAGGG - Intergenic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007405591 6:41634463-41634485 AAGAATGTGCAGTAGGATGAAGG - Intergenic
1007408665 6:41649062-41649084 TGGAAGGAGCAGGAGGTAGAGGG + Intronic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1008048339 6:46874336-46874358 AAGAATCAGCAGGAGGAAGAGGG - Intronic
1008206316 6:48662954-48662976 ATAAATGGTCAGGAGGAAGAAGG - Intergenic
1008419718 6:51284033-51284055 ATGAAGGAGGTGGGGGAAGAGGG + Intergenic
1008546352 6:52587134-52587156 ATGAGTGAGCAGAAGATAGATGG + Intergenic
1009567311 6:65325218-65325240 AAGGATGAGGAGGATGAAGAAGG - Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1010018605 6:71134528-71134550 ATCAAGGAGGAGGAGCAAGATGG + Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010676719 6:78753969-78753991 ATGGAAGAGCAGGAAGAACATGG + Intergenic
1011484747 6:87829967-87829989 GGGAAGGAGAAGGAGGAAGAAGG - Intergenic
1011484783 6:87830104-87830126 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1011484788 6:87830123-87830145 AGGAGGGAGGAGGAGGAAGAAGG - Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011484798 6:87830155-87830177 AGGAGGGAGGAGGAGGAAGAAGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1011936145 6:92780561-92780583 GAGAAGGAGAAGGAGGAAGAAGG - Intergenic
1012030510 6:94054654-94054676 ATGCATGAGCAGCATTAAGAAGG - Intergenic
1012633442 6:101503349-101503371 ATGAATAGAAAGGAGGAAGAAGG + Intronic
1013801554 6:113951284-113951306 ATGAATTAGCAGGCAGAAAAAGG + Intronic
1013811556 6:114050140-114050162 ATGAAGGTGGAGGAGGAAGGAGG - Intergenic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014573740 6:123044494-123044516 ATGAGTGGGCAGGAGGGAAAGGG + Intronic
1015067955 6:129053779-129053801 ATGAATGATGAAGAAGAAGAGGG + Intronic
1015159492 6:130136564-130136586 ATGAATGGGCAGCAGGAGCAGGG - Intronic
1015303461 6:131680103-131680125 AGGAATGAGTTGGAGGAAGCAGG + Intronic
1015404460 6:132821502-132821524 AAGAAAGAGGAGGAGGAAAAGGG - Intergenic
1015484537 6:133753550-133753572 AGAAATGAGTAGAAGGAAGAAGG - Intergenic
1015874450 6:137808853-137808875 CCGAATGAGAGGGAGGAAGATGG + Intergenic
1016700291 6:147046963-147046985 ATGAATGATGAGGATGAAAATGG + Intergenic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016925962 6:149348402-149348424 AGGAAAGAGTAGGAGAAAGAAGG + Intronic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017055763 6:150434356-150434378 ATGAATGAGTCGGAGGAGGTAGG + Intergenic
1017058144 6:150456234-150456256 AGGACTGAGGAGAAGGAAGAGGG - Intergenic
1017462964 6:154668401-154668423 AAGAAAGAGGAGGAGGAAGGAGG + Intergenic
1017770101 6:157638298-157638320 AGGAAGGAGTAGGAGGAGGACGG - Intronic
1018038038 6:159898519-159898541 AGGAGGGAGGAGGAGGAAGAAGG - Intergenic
1018038072 6:159898642-159898664 AGGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018291005 6:162292636-162292658 CTGAATCAGCTGGAGGAAGGTGG + Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019260023 7:76788-76810 ATGGATGAGGAGGAGGGAGTAGG - Intergenic
1019702213 7:2479508-2479530 AAGAATGAGTAGGAGTTAGAAGG + Intergenic
1019860237 7:3651994-3652016 ATGAATGAGTTTGAGGAAGAAGG + Intronic
1019869267 7:3743702-3743724 ATGTCGGAGGAGGAGGAAGAGGG + Intronic
1020080180 7:5282684-5282706 AGGAATGGGGAGGAGGAAGAAGG + Intronic
1021116086 7:16747996-16748018 TTAAACGAGCAGGAAGAAGAAGG + Intergenic
1021267792 7:18546536-18546558 GAGAATGAGAAGGAGAAAGAAGG - Intronic
1021382614 7:19985662-19985684 TGGCAAGAGCAGGAGGAAGAGGG - Intergenic
1021690768 7:23228804-23228826 GTGACTGAGCAGGAGGGACAAGG + Intergenic
1021807387 7:24370869-24370891 ATTAATGAGCTGGAGGAGGTGGG + Intergenic
1022060429 7:26787678-26787700 ATGGCAGAGCAGGAGCAAGAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022678554 7:32523048-32523070 ATGAATCAGCAGCATGAAAATGG + Intronic
1022810954 7:33868499-33868521 ATAAATGAGTACGAGAAAGAAGG - Intergenic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023295553 7:38711619-38711641 ATGCCAGAGCAGGAGGAAGAGGG - Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1024282010 7:47726179-47726201 ATGATTGAGTGAGAGGAAGAAGG + Intronic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024846255 7:53646173-53646195 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1024846258 7:53646189-53646211 AAGAAGGAGGAGGAGGAAGGAGG - Intergenic
1025057869 7:55779679-55779701 AAGAAGGAGGAGGAAGAAGAAGG - Intergenic
1025887753 7:65614429-65614451 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
1025887794 7:65614614-65614636 AAGAAGGAGGAAGAGGAAGAAGG - Intergenic
1025945393 7:66100450-66100472 AAGAATGAGGAGGAGGAAAGAGG + Intronic
1026191896 7:68136464-68136486 AAGAAGGAGGAGGAAGAAGATGG + Intergenic
1026217649 7:68363973-68363995 AGGAGGGAGGAGGAGGAAGAAGG - Intergenic
1026518456 7:71093788-71093810 ATAAATGACCAGGAGGGAGAAGG + Intergenic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026684923 7:72501457-72501479 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1026849707 7:73717200-73717222 AGGGAGGAGGAGGAGGAAGAGGG + Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026905077 7:74058172-74058194 AAGCAGGAGGAGGAGGAAGAGGG - Intronic
1026925330 7:74188327-74188349 AGCAAAGAGCAGGAAGAAGAAGG + Intronic
1027683113 7:81245213-81245235 AGGAAGGAGGAGAAGGAAGAAGG + Intergenic
1027898880 7:84082326-84082348 AAGAATGAGCAGCAGGAAGTGGG + Intronic
1027916377 7:84328423-84328445 ATGAAAGAGCAGGAGATAGAGGG + Intronic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1028943043 7:96546570-96546592 TTAATTGAGCAGGAGAAAGAAGG + Intronic
1029474569 7:100775471-100775493 AAGCATGAGAAGGAGGAAGGTGG + Exonic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029672087 7:102040331-102040353 GGGAAAGAGCAGCAGGAAGATGG + Intronic
1029898972 7:104020113-104020135 ATGAAAGAGCAAGAGAGAGAGGG + Intergenic
1031124921 7:117762832-117762854 AGGAAAGAGAAGCAGGAAGACGG - Intronic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031831621 7:126634384-126634406 ATGAATGAGAAGGGGAAATAAGG - Intronic
1031854590 7:126907128-126907150 AAGAAGGAGGAAGAGGAAGAAGG + Intronic
1031854624 7:126907280-126907302 AAGAAAGGGGAGGAGGAAGAGGG + Intronic
1032256257 7:130299419-130299441 ATGCAAGAGCAGGAGGCAGGAGG - Intronic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032523110 7:132561274-132561296 AAGGAGGAGGAGGAGGAAGAGGG - Intronic
1032523617 7:132563412-132563434 AGGAAGGAGAAGGAGGAGGAGGG - Intronic
1032590360 7:133186663-133186685 AAGAAGGAGGAGGAGGAAAAAGG + Intergenic
1032846393 7:135755257-135755279 ATGAATGAATAGGAGCATGATGG - Intergenic
1032984796 7:137326053-137326075 GTGAATGCTCAGGAAGAAGAAGG + Intronic
1033099614 7:138459649-138459671 ATGAATGAGTATGAAGAATAAGG - Intergenic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033820784 7:145131802-145131824 ATGACTGATCTGGAGCAAGATGG - Intergenic
1033832593 7:145271494-145271516 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1033890703 7:146009384-146009406 ATGAAAGAAGAGCAGGAAGATGG + Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034555939 7:151850406-151850428 AGAAATGAACAGGAGGCAGAAGG + Intronic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035316450 7:158000482-158000504 AATAAAGAGGAGGAGGAAGAAGG - Intronic
1036108960 8:5876655-5876677 ATGAATTAACACGGGGAAGAGGG - Intergenic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036570856 8:9978709-9978731 AGGAATGAGCAGGATGTATAGGG - Intergenic
1036599130 8:10242937-10242959 ATGAATGACCAGGATGCAGGTGG - Intronic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1037041671 8:14244141-14244163 AAGGAAGAGGAGGAGGAAGAAGG - Intronic
1037041675 8:14244160-14244182 AAGGAAGAGGAGGAGGAAGAAGG - Intronic
1037041679 8:14244179-14244201 AAGGAAGAGGAGGAGGAAGAAGG - Intronic
1037041683 8:14244198-14244220 AAGAAGGAAGAGGAGGAAGAAGG - Intronic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037497039 8:19450201-19450223 GAGAAAGAGCGGGAGGAAGAGGG + Intronic
1037743913 8:21628477-21628499 ATGAAAGAGAGGTAGGAAGATGG + Intergenic
1038020759 8:23550412-23550434 AGGAATGAGCAAGAGGAGGCTGG + Intronic
1038425895 8:27463498-27463520 AGTGATGAGCAGCAGGAAGACGG + Exonic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038890730 8:31719897-31719919 ATGATTTAGTAGGAGAAAGAAGG + Intronic
1038943377 8:32330476-32330498 AAGGATGTGGAGGAGGAAGATGG + Intronic
1039188763 8:34947991-34948013 CTCAATCAGCGGGAGGAAGAAGG + Intergenic
1039247447 8:35624462-35624484 ATGAATGTGCAAGACGAATACGG - Intronic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039659489 8:39447330-39447352 ATGGATGAGGAGCTGGAAGAGGG - Intergenic
1039793752 8:40895546-40895568 AGGATTGAGGAGGAGGCAGAGGG + Intronic
1040626605 8:49157155-49157177 AGGAGTGAGCAGGGAGAAGATGG - Intergenic
1041203231 8:55471789-55471811 TTGCAAGAGCAGGAGCAAGAGGG - Intronic
1041291186 8:56310181-56310203 AGGAAGGAGGAGGAGGAAGGAGG + Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291225 8:56310306-56310328 AGGAAGGAGGAGGAGGAAGGAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041315755 8:56560389-56560411 ATGAATGATCCTGATGAAGACGG + Intergenic
1041317519 8:56579780-56579802 AAGAATGAGGAGGAGAAAGAAGG + Intergenic
1041329341 8:56707491-56707513 AGGTATGAGCAGGCGGGAGAGGG + Intergenic
1041721000 8:60975120-60975142 AGGAAATAGCAGGAGTAAGAGGG + Intergenic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1042675745 8:71319793-71319815 ATGAATGAGCAAAGGGGAGAAGG + Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043559935 8:81480683-81480705 GTGCATGTGCAGGAGGAAAAAGG + Intronic
1044296228 8:90530428-90530450 ATTAAGGAGCAAGAGGAAGTTGG + Intergenic
1044775397 8:95681707-95681729 AAGAATGAGCAGGAGTTAGGGGG + Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045811608 8:106227303-106227325 AAGAATGAGCAGGAGTTAGCTGG - Intergenic
1046111350 8:109729779-109729801 AAGAAAGAGAAGGAGGAAGAGGG + Intergenic
1046184472 8:110694611-110694633 AAGTATGAAAAGGAGGAAGAAGG + Intergenic
1046188043 8:110748673-110748695 TAGAAAGAGCAGGTGGAAGAAGG - Intergenic
1046404470 8:113754974-113754996 ATGAATGGCCACGAGGATGAAGG + Intergenic
1046909301 8:119608445-119608467 ATGAATGAGAAGGGGGAAAAAGG + Intronic
1047254797 8:123207032-123207054 AGGAAGGAGAAGGAGGGAGAGGG - Intronic
1047829826 8:128617109-128617131 AGCAAAGAGCAGGAGGAAGGGGG + Intergenic
1048213880 8:132479236-132479258 ATGCATGGCCAGAAGGAAGAAGG - Intronic
1048458964 8:134603898-134603920 ATGATAGAGGAGGAGGAAGATGG - Intronic
1048612582 8:136040009-136040031 AGGCAGGAGAAGGAGGAAGATGG - Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049096537 8:140551617-140551639 ATGGATGGGCTGGTGGAAGATGG + Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049450279 8:142657597-142657619 TAGCAAGAGCAGGAGGAAGAAGG + Exonic
1049579084 8:143402922-143402944 GTGAGTGAGCAGGAGAGAGATGG - Intergenic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1049861811 8:144903772-144903794 CTGAAGGAGCCAGAGGAAGAGGG - Intergenic
1049933517 9:478585-478607 AGGAGTGAGCAGGAGAAAGTGGG - Intronic
1050935028 9:11385669-11385691 TGGCATGAGCAGGAGGAAGGAGG - Intergenic
1052808567 9:33035809-33035831 AAGCATGAGAAGGAGGAAGTGGG + Intronic
1052918221 9:33940086-33940108 AAAAAGGAGGAGGAGGAAGAAGG + Intronic
1053016955 9:34667317-34667339 AAGAATGAGAGGGAGAAAGAGGG - Intergenic
1053832152 9:42094725-42094747 AGGAAGGAGAAGGAGGAGGAAGG + Intronic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1054598393 9:67092699-67092721 AGGAAGGAGAAGGAGGAGGAAGG - Intergenic
1054864249 9:69983669-69983691 CTGAAGGAGCAAGAGAAAGAAGG - Intergenic
1055114257 9:72590076-72590098 GTGAATAATCAGGAGGCAGATGG - Intronic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1057167273 9:92938889-92938911 ATGAGTGAGCAAGAGGAAGAAGG - Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057321046 9:94013099-94013121 AAGAGTGAGCAAGAGGGAGAAGG - Intergenic
1057718187 9:97512046-97512068 TTGAAGGACCAGGAGGAACATGG - Intronic
1057999732 9:99852745-99852767 AAGACTGAGAAGGAGGAAGGAGG + Intronic
1058561444 9:106233184-106233206 AGGAATGAGGAGGAGGAAGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561475 9:106233343-106233365 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1058561481 9:106233369-106233391 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1058985871 9:110207912-110207934 AAGAAAGAGAGGGAGGAAGATGG + Exonic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072468 9:111152975-111152997 AGGAAGGAGGAGGAGGAAGGAGG + Intergenic
1059072472 9:111152988-111153010 AGGAAGGAGGAGGAGGAAGGAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059287339 9:113186177-113186199 ATGAAGGAGGAGCAAGAAGAGGG + Intronic
1059460376 9:114425868-114425890 ATGAAAGAGAGGGAGGGAGAGGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059603776 9:115810875-115810897 ATGAGGGGGCAGGAGGAATATGG + Intergenic
1059704706 9:116811330-116811352 AGAAATGAGCAGGAGCATGAGGG - Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059858949 9:118435288-118435310 ATGAATGGGTAGAAGGATGATGG - Intergenic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061237522 9:129351460-129351482 ATGAATTAGGAGGATGGAGAAGG + Intergenic
1061244772 9:129395850-129395872 ATGGATGAGAAGGTGGAAGGAGG + Intergenic
1062394914 9:136348915-136348937 ATGGGTGAGCAGGTGGCAGATGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062638410 9:137503591-137503613 GAGAAGGAGAAGGAGGAAGAAGG + Intronic
1062673823 9:137728064-137728086 AGGAATGAGCAGGAGGGAGGAGG - Intronic
1203443324 Un_GL000219v1:31623-31645 AGGGATGAGCAGGAGACAGATGG + Intergenic
1203514132 Un_KI270741v1:150532-150554 AGGGATGAGCAGGAGACAGATGG + Intergenic
1203656245 Un_KI270753v1:34-56 AGGAATGAGCAGGAGCAGAATGG - Intergenic
1185603633 X:1355080-1355102 AAGGAGGGGCAGGAGGAAGAAGG + Intronic
1185853110 X:3507594-3507616 ATGAATGACCAGGATGAATGTGG + Intergenic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186212663 X:7266347-7266369 ATGAATGACAAGGAGGCATAAGG + Intronic
1186666399 X:11721577-11721599 ATGATTCAGCAGGAGCGAGATGG + Intergenic
1187025742 X:15433912-15433934 AAGAAGGAGGAGGAGGAAGGAGG + Intronic
1187025837 X:15434419-15434441 AGGAAGGAGGAGGAGGAAGAAGG + Intronic
1187312446 X:18158214-18158236 TGGCCTGAGCAGGAGGAAGAGGG - Intergenic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187498268 X:19814735-19814757 ATGTTTGAGGAGGAGAAAGAAGG - Intronic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187774056 X:22734997-22735019 TTGTATGAGCAGGATTAAGAAGG - Intergenic
1188236849 X:27741665-27741687 AGGAGTGAGAAGGATGAAGATGG + Intronic
1188344391 X:29045976-29045998 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
1189143704 X:38634701-38634723 ATGAAGGAAAAGGAGCAAGAAGG - Intronic
1190109582 X:47581502-47581524 ATGAATGAGCATTGGGAAGGGGG - Intronic
1190123397 X:47682630-47682652 AGGAAGGAGGAGGATGAAGAGGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191936695 X:66434633-66434655 ATGACTGAGAAGGTGGAGGAGGG + Intergenic
1192100135 X:68255568-68255590 ACGACTGAGGAAGAGGAAGAGGG + Intronic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192367197 X:70483710-70483732 AGCAGGGAGCAGGAGGAAGAAGG + Intronic
1192770594 X:74185594-74185616 ATGGATGATCAGGAGGCTGAGGG + Intergenic
1193103021 X:77637008-77637030 AAGAAGGAGGAGGAAGAAGAAGG + Intronic
1193244249 X:79210416-79210438 ATGAATGAGATGAAGCAAGAAGG - Intergenic
1193841109 X:86409543-86409565 ATGTAGGAGCAGGAGAGAGAAGG - Intronic
1194349703 X:92810694-92810716 ATTAAGGAGCAGCAGGAAAAAGG + Intergenic
1195450626 X:105008264-105008286 ATGCATGAGGATGATGAAGATGG + Intronic
1195469808 X:105219253-105219275 ATGTCTGAGAAGGAGGAAAAAGG + Exonic
1195725045 X:107906276-107906298 ATGAATGAGAAGGAGATATATGG - Intronic
1195804086 X:108743143-108743165 AGGAAAGGGCAGAAGGAAGAAGG + Intergenic
1196456985 X:115898028-115898050 AGAAATGAGCACCAGGAAGATGG + Intergenic
1196472455 X:116043915-116043937 ATGAAAGAGCTGGTGGATGAAGG + Intergenic
1196473595 X:116057413-116057435 ATGGTGGAGCAGGAGAAAGATGG - Intergenic
1197237359 X:124082452-124082474 CTAAATGAGCAAGAGGATGAAGG - Intronic
1197737309 X:129861264-129861286 ATGTATTAGCAGGAAGAAAAAGG + Intergenic
1197851792 X:130869983-130870005 ATGAAAGAGAGAGAGGAAGAAGG + Intronic
1197873958 X:131084718-131084740 AAGAAAGAGCAGGAGGAGGTGGG + Intronic
1197906097 X:131427349-131427371 AAGGATGAGAAGGAGGAAGGAGG - Intergenic
1198321215 X:135520871-135520893 AGCAAGGAGCAAGAGGAAGAGGG - Exonic
1198654538 X:138899264-138899286 ATGCATGAGTAGGAGAAACATGG + Intronic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199634551 X:149803140-149803162 ATAAATGAGCAGGATGAAAAGGG - Intergenic
1199717863 X:150519052-150519074 AAGAAGGAGGAGGAGAAAGAAGG + Intergenic
1199751573 X:150824242-150824264 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1199870770 X:151896431-151896453 ATGAAGGAGCAGGAGAGAAAAGG - Intergenic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200658025 Y:5927297-5927319 ATTAAGGAGCAGCAGGAAAAAGG + Intergenic
1201284913 Y:12370687-12370709 AGGAATGGTCAGGAGGAAGTAGG + Intergenic