ID: 968914587

View in Genome Browser
Species Human (GRCh38)
Location 4:3491892-3491914
Sequence ACGGCTCCTGCACTTGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968914587_968914597 23 Left 968914587 4:3491892-3491914 CCACGGCCAAGTGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
968914587_968914596 22 Left 968914587 4:3491892-3491914 CCACGGCCAAGTGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968914587 Original CRISPR ACGGCTCCTGCACTTGGCCG TGG (reversed) Intronic
912542251 1:110425852-110425874 CCGGCTACTTCACTTGGCCATGG + Intergenic
914879944 1:151539525-151539547 ATGGCTTCTTCACTTGGCTGTGG - Intergenic
915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
922786881 1:228287256-228287278 GCGGCTCCTGCAGGTGGCAGAGG - Intronic
923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG + Intergenic
1064122998 10:12635472-12635494 AGAGCTCCTGCACTGCGCCGTGG - Intronic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1071651757 10:87399045-87399067 ACTGCTCCTGCATTTGGGTGGGG + Intergenic
1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG + Intergenic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1085066401 11:73499238-73499260 AGGGCTGCTGCAGTTTGCCGGGG - Intronic
1089144144 11:116312126-116312148 CCGGCTCCTTCACTGGGCCGTGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1091217294 11:133910257-133910279 ACGTGTCCTGCAGTTCGCCGTGG + Intronic
1092811576 12:12275848-12275870 ACTGCTGCTGCACTGGGCAGGGG - Intergenic
1095320291 12:40818943-40818965 AGGGCTGCTGCAGTTTGCCGGGG + Intronic
1105031441 12:132887256-132887278 ACGGCTCCTGCGTCTGGGCGCGG - Exonic
1113507263 13:110825835-110825857 ACTGGACCTGCACTTGACCGTGG - Intergenic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG + Intergenic
1124923594 15:34048938-34048960 AGGGCTGCTGCAGTTTGCCGTGG - Intronic
1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG + Exonic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127403118 15:58612300-58612322 ACAGCTCCTCAACTTGGCCAAGG - Intronic
1128055907 15:64700035-64700057 CAGGCTCCTCCACTTGGCCTGGG - Intronic
1129177223 15:73848669-73848691 TCTGCTCCTGCACTTGGCTCTGG - Intergenic
1132896798 16:2233132-2233154 ACAGCTCCTGCATCTGGACGTGG - Exonic
1133223586 16:4329421-4329443 AGGGCAGCTGCACTAGGCCGTGG - Intronic
1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG + Intronic
1142155020 16:88528995-88529017 ATGGCTCCTGTACCCGGCCGGGG - Intronic
1143853863 17:9834077-9834099 ATGGCCTCTACACTTGGCCGGGG + Intronic
1152572515 17:81127017-81127039 GCAGCTCCTGCACTGAGCCGAGG - Intronic
1153514564 18:5891743-5891765 ACTGCTACTGCTGTTGGCCGTGG + Exonic
1159937642 18:74381859-74381881 GCGGCTCCTGCAGTAGGACGAGG - Intergenic
1160269833 18:77373490-77373512 ATGGGTCCTGGACTTGGTCGGGG - Intergenic
1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG + Intronic
1166368596 19:42289666-42289688 TAGGCTCCTGCACTGGGCAGTGG + Intronic
930552371 2:52852131-52852153 AGGGCTGCTGCACTTTGCTGGGG + Intergenic
932605478 2:73162955-73162977 ACGGCTCCTGCCCATGGCCAAGG - Intergenic
932826846 2:74948592-74948614 AGGGCTGCTGCAGTTTGCCGAGG - Intergenic
934025746 2:88000335-88000357 ATGGCTCCTGCCCTTGTCCAGGG - Intergenic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG + Intronic
942653648 2:178194068-178194090 ACGGCTCCAGCGCTCGGCCCAGG - Intergenic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
948102431 2:235385418-235385440 ACTGCTGCTGGACTTGGCCTTGG - Intergenic
948593343 2:239064810-239064832 ACGCCTCCTGCACATGGGCGTGG - Intronic
1172240114 20:33407592-33407614 ACTGCTCATGCACATGGCTGTGG - Intergenic
1173147159 20:40534758-40534780 ACTGCTCCTGTGCTTGGCTGAGG - Intergenic
1175176178 20:57113818-57113840 ATGGATCCTCCTCTTGGCCGAGG - Intergenic
1177388209 21:20433834-20433856 AGGGCTGCTGCAGTTTGCCGGGG - Intergenic
1183434079 22:37783285-37783307 ACGCCTCCTGCCCTTTGCAGGGG - Intergenic
1184580328 22:45412956-45412978 ACTGCTCTTGCCCTTGGCCCTGG - Intronic
1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG + Exonic
952670035 3:35955308-35955330 ATGGGTCCAGCACTTGGCAGAGG + Intergenic
953032774 3:39188988-39189010 ACGTCTCCTCCACCTGGCTGGGG + Exonic
960477161 3:118144401-118144423 AGGGCTGCTGCAGTTTGCCGGGG + Intergenic
960989437 3:123301249-123301271 ACGGCTTCTGCCCTGGGCTGGGG + Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
976538109 4:86242114-86242136 AGGGCTCCTGCAGTTTGCTGGGG + Intronic
977177498 4:93834837-93834859 CCGTCTCCCGCACTCGGCCGGGG + Intergenic
984928172 4:184825312-184825334 GTGGCCCTTGCACTTGGCCGTGG - Intronic
995900052 5:117054986-117055008 ACTGGTCCTCCACTTGGCCATGG - Intergenic
1000121601 5:158203273-158203295 AAGGCTCCTGCCATTGGCCTGGG + Intergenic
1000782978 5:165507144-165507166 AAGGCTCTTGCACTTGTCGGGGG - Intergenic
1002559393 5:180071471-180071493 GCGGCGCCAGCACCTGGCCGCGG + Exonic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1019315998 7:387194-387216 CCGCATCCTGTACTTGGCCGTGG - Intergenic
1019525431 7:1478477-1478499 GGGGCTCCTGCGCCTGGCCGAGG - Exonic
1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG + Intronic
1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG + Intergenic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1044356047 8:91224447-91224469 AGGGCTGCTGCAGTTGGCTGGGG + Intronic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1056568240 9:87793708-87793730 ATGGCTCCTGCATTTGGGTGAGG + Intergenic
1057337551 9:94166998-94167020 AGGGAGGCTGCACTTGGCCGCGG - Intergenic
1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG + Intergenic
1061092296 9:128433518-128433540 ATGGCTCCTGGTCTTGGCCATGG + Intronic
1061093281 9:128439054-128439076 ATGGCTCCTGGCCTTGGCCATGG + Intergenic
1061176388 9:129000071-129000093 TCGGATCCTGCATTTGCCCGCGG - Intronic
1061572318 9:131485413-131485435 ACGGCTCCAGCACATGACCCAGG - Intronic
1193048284 X:77076402-77076424 AGGGCTGCTGCAGTTGGCTGGGG + Intergenic
1194445981 X:93987273-93987295 AGGGCTGCTGCAGTTTGCCGGGG - Intergenic
1196284413 X:113863332-113863354 AGGGCTCCTGCGCTTTGCTGGGG + Intergenic
1197711917 X:129677885-129677907 ACGGCGGCTGCCTTTGGCCGGGG - Intergenic