ID: 968914596

View in Genome Browser
Species Human (GRCh38)
Location 4:3491937-3491959
Sequence GATCACTGCTTGTCCCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968914592_968914596 -7 Left 968914592 4:3491921-3491943 CCGGCCAGTGCCCTCTGATCACT 0: 1
1: 0
2: 0
3: 25
4: 198
Right 968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 197
968914591_968914596 3 Left 968914591 4:3491911-3491933 CCGTGCTGGTCCGGCCAGTGCCC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 197
968914586_968914596 23 Left 968914586 4:3491891-3491913 CCCACGGCCAAGTGCAGGAGCCG 0: 1
1: 0
2: 0
3: 10
4: 95
Right 968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 197
968914587_968914596 22 Left 968914587 4:3491892-3491914 CCACGGCCAAGTGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 197
968914589_968914596 16 Left 968914589 4:3491898-3491920 CCAAGTGCAGGAGCCGTGCTGGT 0: 1
1: 0
2: 2
3: 14
4: 116
Right 968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968914596 Original CRISPR GATCACTGCTTGTCCCCCAG AGG Intronic
902339015 1:15770596-15770618 GCTCACTGCCTGGCACCCAGAGG - Intronic
903803502 1:25987786-25987808 GAGCACTGCTTGAGCCCAAGAGG + Intronic
904642348 1:31939836-31939858 GATCACTGCTTCTCCCCGCAGGG - Intronic
904730798 1:32589637-32589659 GAGAATTGCTTGACCCCCAGAGG - Intronic
906807034 1:48789189-48789211 GAACACTGCTTGTCATCCACTGG + Intronic
908226048 1:62056914-62056936 GAGAACTGCTTGAACCCCAGAGG - Intronic
908380097 1:63589639-63589661 GAGCATTGCTTGAACCCCAGAGG + Intronic
909590850 1:77347363-77347385 GATAAGTGCTTGTTGCCCAGAGG - Intronic
912400545 1:109387858-109387880 GAGAACTGCTTGAGCCCCAGAGG + Intronic
915740928 1:158117940-158117962 CTGCACTGCTTCTCCCCCAGGGG + Intergenic
916530524 1:165652384-165652406 GATCACTGCTTTACCCCAGGTGG - Intronic
920246734 1:204593441-204593463 GATAACTCCTCCTCCCCCAGTGG - Intergenic
921384741 1:214557410-214557432 GAGAACTGCTTGAACCCCAGAGG - Intergenic
921516815 1:216103194-216103216 GAACACTACTGGGCCCCCAGTGG - Intronic
922567287 1:226608914-226608936 GAACCCTGCTTGGCCCCTAGAGG - Exonic
924176144 1:241393199-241393221 CATCAATTCCTGTCCCCCAGTGG + Intergenic
924274870 1:242375404-242375426 CATAACTGCTTGCCTCCCAGAGG + Intronic
924689645 1:246333794-246333816 GAGGACTGCTTGAGCCCCAGAGG + Intronic
1065422970 10:25567635-25567657 GATAACTGCATGTCATCCAGAGG + Intronic
1065720735 10:28626564-28626586 TTTCACTGCTTTTCCCTCAGTGG + Intergenic
1065851441 10:29793203-29793225 CATGACTGCTTGTCCCACATTGG + Intergenic
1067335546 10:45359829-45359851 GAGCACCGCTTCTCCTCCAGAGG + Intergenic
1074151380 10:110762739-110762761 CATCACTGCTTCTCCCACAATGG + Intronic
1076155841 10:128205076-128205098 GAGGACTGCTTGAGCCCCAGAGG - Intergenic
1077372875 11:2191925-2191947 GGTCACAGATTGTTCCCCAGGGG - Intergenic
1077792239 11:5453601-5453623 GATCACTGTATTTCCCCCAAGGG - Exonic
1088068241 11:105748467-105748489 AATCATTGCTTGAACCCCAGAGG - Intronic
1090796328 11:130138673-130138695 GAGGACTGCTTGAGCCCCAGAGG - Intronic
1090935919 11:131342130-131342152 GAGCAATGCTTGCCTCCCAGTGG - Intergenic
1091713567 12:2760211-2760233 GATCACTACTGGCCCCGCAGTGG - Intergenic
1092465456 12:8727809-8727831 GAGAACTGCTTGAACCCCAGGGG + Intronic
1093012634 12:14125236-14125258 TAACTCTGCTTGTCTCCCAGTGG - Intergenic
1094823862 12:34251196-34251218 CATCACTGCTTCCCCCACAGTGG - Intergenic
1095087831 12:38077232-38077254 CATCACTGCTTCTCCCACAGTGG + Intergenic
1096109819 12:49021893-49021915 AATCAATGCTAGTCCCCCACAGG + Intronic
1096329423 12:50697567-50697589 GATCTCTCTTTGTCACCCAGTGG + Intronic
1096673839 12:53215792-53215814 CATCACTGCTTCCCTCCCAGCGG - Exonic
1097222185 12:57457421-57457443 TATAAATGCTTGTCTCCCAGTGG - Exonic
1097888278 12:64751896-64751918 GAGAACTGCTTGATCCCCAGAGG + Intronic
1098822876 12:75254991-75255013 GAGGACTGCTTGAGCCCCAGAGG - Intergenic
1101143674 12:101821255-101821277 GTTCACTGCTGGATCCCCAGGGG + Intronic
1102133638 12:110553687-110553709 GAGGACTGCTTGAGCCCCAGTGG + Intronic
1102510183 12:113410021-113410043 GGTGACAGCTTGTCCCACAGAGG - Intronic
1102642409 12:114378724-114378746 GAGCATTGCTTGAACCCCAGAGG - Intronic
1103352554 12:120294914-120294936 GAGAACTGCTTGAACCCCAGAGG - Intergenic
1105365412 13:19759770-19759792 GAGAACTGCTTGAACCCCAGAGG + Intronic
1113719451 13:112543058-112543080 GAGAACTGCTTGAACCCCAGAGG + Intronic
1114409232 14:22485212-22485234 GATCAAACCCTGTCCCCCAGGGG - Intergenic
1116513984 14:45784333-45784355 GAGCACTGCTTGTCCCAGATGGG + Intergenic
1116723389 14:48529355-48529377 GATCACTGGTTGGCTGCCAGGGG - Intergenic
1120850450 14:89164568-89164590 GGTTACTGCTAGGCCCCCAGTGG + Intronic
1121023511 14:90597566-90597588 GAGAACTGCTTGAACCCCAGAGG + Intronic
1121546929 14:94769681-94769703 GAGCACTGCTGGGCGCCCAGCGG + Exonic
1123047723 14:105526834-105526856 CGTCTCTGCTTGTCCCCCCGAGG - Intronic
1124106207 15:26740315-26740337 GATCACTACTTCTACCCCATTGG - Intronic
1125487405 15:40121766-40121788 GATGCCTGTTTGTCCTCCAGAGG - Intergenic
1125899913 15:43336129-43336151 GAGGACTGCTTGAGCCCCAGAGG - Intronic
1126596183 15:50386286-50386308 GAGAACTGCTTGAACCCCAGAGG + Intergenic
1128955629 15:71940400-71940422 GAGAACTGCTTGGGCCCCAGAGG + Intronic
1129308513 15:74686942-74686964 GATAACTGCTTGAACCCAAGAGG + Intronic
1129462694 15:75707839-75707861 GCTCACAGCCTGGCCCCCAGAGG - Intronic
1129722178 15:77883577-77883599 GCTCACAGCCTGGCCCCCAGAGG + Intergenic
1131082993 15:89552881-89552903 GATAACTGCTTGAACCCGAGAGG - Intergenic
1131594384 15:93781954-93781976 CATCATTGCTTGATCCCCAGGGG - Intergenic
1132324643 15:100958680-100958702 GAACACTGCCTGACCCCGAGAGG - Intronic
1132701346 16:1223452-1223474 GGTCACTGCTCAGCCCCCAGTGG - Exonic
1132738687 16:1399948-1399970 GATGTGTGCTTGTCACCCAGAGG - Intronic
1133150588 16:3826121-3826143 GAGGACTGCTTGTGCCCCAGAGG + Intronic
1133250877 16:4480135-4480157 GAGAACTGCTTGAACCCCAGAGG - Intronic
1133287578 16:4697759-4697781 GAAAACTGCCTATCCCCCAGGGG - Intronic
1135492740 16:22923901-22923923 GAGAACTGCTTGAACCCCAGAGG - Intergenic
1136557214 16:31014480-31014502 GTTCACTGCTGGTTCTCCAGTGG + Intergenic
1138621594 16:58215692-58215714 CATCATTCCTTATCCCCCAGTGG - Intergenic
1141859934 16:86709648-86709670 GCTCACTGCTTCTCCCCGAAGGG - Intergenic
1142626762 17:1197225-1197247 GATCACGGCCTGTTTCCCAGAGG - Intronic
1146069675 17:29668645-29668667 GAGGACTGCTTGAGCCCCAGAGG + Intronic
1147296680 17:39489168-39489190 GAGAACTGCTTGAACCCCAGGGG - Intronic
1151991030 17:77574373-77574395 GATCTCTGCTTCTCCCCCACAGG - Intergenic
1154453747 18:14502500-14502522 CATCACTTCTTGTACCCAAGAGG + Intergenic
1155601699 18:27556157-27556179 GAGAATTGCTTGTACCCCAGAGG + Intergenic
1161284990 19:3464206-3464228 CATCACGGCTGGGCCCCCAGAGG + Intronic
1162567693 19:11453305-11453327 GATCTCTCCTGGACCCCCAGCGG - Exonic
1162936700 19:13984948-13984970 GATAATTGCTTGAACCCCAGGGG - Intronic
1163656167 19:18546318-18546340 GAGGACTGCTTGAACCCCAGGGG + Intergenic
1164247215 19:23441677-23441699 GATAATTGCTTGAGCCCCAGAGG - Intergenic
1166110477 19:40619771-40619793 GATCACTGTCTGTCCTCAAGGGG + Intronic
925125696 2:1454187-1454209 GATGACTGCTTTACTCCCAGAGG + Intronic
925496995 2:4462647-4462669 GAGGACTGCTTGAACCCCAGAGG - Intergenic
927950871 2:27168053-27168075 GATGACTGCTTGAGCCCCGGGGG + Intergenic
928450492 2:31374150-31374172 CTTCACTGCTAGCCCCCCAGTGG + Intronic
930629715 2:53738999-53739021 GAACACTGCTTTTCCCACAATGG + Intronic
930805244 2:55483807-55483829 AATCATTGTTTGACCCCCAGTGG + Intergenic
931257506 2:60585939-60585961 GGTCACTGCTGGACACCCAGTGG - Intergenic
935428358 2:102945095-102945117 GATCAAAGCTTCTCTCCCAGAGG + Intergenic
937682947 2:124664231-124664253 GATGACTGCTTGAGCCCAAGTGG + Intronic
938865165 2:135411147-135411169 GAAGACTGCTTGAGCCCCAGAGG + Intronic
938992122 2:136640346-136640368 GAGAATTGCTTGTACCCCAGAGG - Intergenic
944436186 2:199692590-199692612 GATCAGTGCTTCTGCCCCAGGGG + Intergenic
944781149 2:203018556-203018578 AAAAACTGCTTGTCCCTCAGAGG - Intronic
945296469 2:208176029-208176051 GATCACTGGTTGTCCAAAAGAGG + Intronic
947503686 2:230690834-230690856 GGTCACTGGTTGTCCTCTAGTGG + Intergenic
947668196 2:231920173-231920195 GAGGATTGCTTGTGCCCCAGAGG - Intergenic
947674942 2:231970033-231970055 GAGGACTGCTTGAGCCCCAGAGG - Intronic
948609353 2:239156980-239157002 AAGCACTGCTGGTCCCGCAGAGG - Intronic
1169431246 20:5538340-5538362 GAGAACTGCTTGAACCCCAGAGG + Intergenic
1169433310 20:5559493-5559515 GAGGACTGCTTGTGCCCGAGAGG + Intronic
1170096062 20:12647099-12647121 GAGCAATGCGTGTCCCACAGAGG + Intergenic
1174121833 20:48271647-48271669 CATCTCTGCTTGACACCCAGCGG + Intergenic
1174447911 20:50602687-50602709 GACCACAGCAAGTCCCCCAGAGG + Intronic
1175099613 20:56569606-56569628 GATAATTGCTTGAACCCCAGAGG - Intergenic
1176023455 20:62974124-62974146 GATCTCTGCTTGCCCCCTTGGGG + Intergenic
1178559952 21:33629349-33629371 GATCATTGCTTGAACCCAAGAGG - Intronic
1179472798 21:41622768-41622790 GCTCCCTGCTTCTCACCCAGTGG - Intergenic
1180086413 21:45509769-45509791 GACCACTGCTTGGCCACCAGAGG - Intronic
1181363186 22:22354445-22354467 CATCAGTGATTGTCCCTCAGGGG + Intergenic
1181441735 22:22939563-22939585 GAGAACTGCAGGTCCCCCAGGGG - Intergenic
1182500854 22:30746332-30746354 GAGGATTGCTTGACCCCCAGAGG + Intronic
1183241961 22:36664365-36664387 GTTCACTGCTGGAGCCCCAGTGG - Intronic
1183522370 22:38303007-38303029 GCCCTCTGCTTGACCCCCAGTGG - Exonic
1183604631 22:38861184-38861206 CATCACTGCCTGTCCCTCAGTGG - Intergenic
1183958753 22:41398178-41398200 GAGCACTTCTTTTCCCCCACAGG - Exonic
1184172026 22:42765516-42765538 GATCATTGCTTGTCTTCCTGCGG - Intergenic
950135625 3:10578896-10578918 GATCCCTCCTTGCCCTCCAGAGG - Intronic
951386541 3:22050270-22050292 GAAGACTGCTTGAGCCCCAGAGG + Intronic
952832301 3:37575281-37575303 GATCACTGGTTGACCTTCAGCGG + Intronic
953011253 3:39027410-39027432 AATCCCTGCTTGTTGCCCAGGGG + Intergenic
953945328 3:47142417-47142439 GAAGACTGCTTGAGCCCCAGAGG + Intronic
955046836 3:55368782-55368804 GACCAGTGCTTGACTCCCAGAGG - Intergenic
955198329 3:56826787-56826809 ACTCACTGCTTGTCACCCAATGG + Intronic
956736241 3:72240489-72240511 GATCACTGCTCATGCCTCAGGGG + Intergenic
960790927 3:121430081-121430103 GTTGATTGCTTGTCTCCCAGTGG - Intergenic
961867481 3:129964236-129964258 GACCACTGCTTGGCCCTGAGAGG + Intergenic
962485737 3:135840583-135840605 GATTACTGCTTGTCCTACATTGG + Intergenic
962606019 3:137033609-137033631 GATCACAGCTTGGTGCCCAGAGG - Intergenic
968599002 4:1500404-1500426 GGTCACAGCCTGTCCCCAAGGGG - Intergenic
968748487 4:2373407-2373429 GAAGACTGCTTGAGCCCCAGAGG + Intronic
968914596 4:3491937-3491959 GATCACTGCTTGTCCCCCAGAGG + Intronic
969686023 4:8674722-8674744 GCTCACTGCTTCACCCCCACAGG - Intergenic
972486464 4:39545664-39545686 GATAATTGCTTGAACCCCAGAGG + Intergenic
972950010 4:44309123-44309145 GAGAACTGCTTGAACCCCAGAGG - Intronic
974858602 4:67491938-67491960 TAGCACTACTTGTGCCCCAGAGG + Intronic
981383486 4:144099986-144100008 GAGAACTGCTTGAACCCCAGAGG + Intergenic
982320036 4:154067935-154067957 CATAACAGCTTGTCTCCCAGGGG + Intergenic
984654651 4:182304827-182304849 GATCCCTTATTGTCCTCCAGTGG + Intronic
986468310 5:8049408-8049430 GATGACTGTTTGCCCCTCAGAGG + Intergenic
986891227 5:12309554-12309576 CATCACTGTCTGTCCCCCACTGG - Intergenic
992795660 5:80253336-80253358 GAACACTGCTTGCCCCTAAGAGG + Intronic
993178664 5:84520287-84520309 GGTCACTGCTGTTCCTCCAGTGG + Intergenic
993333440 5:86627852-86627874 CATCTCTGCTTGTCTCCCATTGG - Intergenic
997233914 5:132261705-132261727 GAACACTGCTTGACCCCGAGGGG + Intronic
1000528223 5:162385372-162385394 GAGAACTGCTTGAACCCCAGAGG + Intergenic
1000719393 5:164688139-164688161 GAGAACTGCTTGAACCCCAGAGG - Intergenic
1004877772 6:19973000-19973022 GATCATTGCTTGAGCCTCAGAGG - Intergenic
1005169073 6:22960602-22960624 GACCACTGGATGTCACCCAGTGG - Intergenic
1005566750 6:27103643-27103665 GAGAACTGCTTGAACCCCAGGGG + Intergenic
1005868511 6:29956424-29956446 GATCTCCGCTGGTCCCGCAGCGG - Intergenic
1005873526 6:29994782-29994804 GATCTCTATTTGCCCCCCAGAGG - Intergenic
1005888678 6:30117881-30117903 GATCACTGGTTTTCCATCAGAGG - Intergenic
1006670052 6:35724664-35724686 GAGGACTGCTTGAGCCCCAGAGG + Intronic
1007517141 6:42421682-42421704 GAGAACTGCTTGAACCCCAGAGG + Intronic
1009558165 6:65202466-65202488 CATCACAGCTTGACCCCTAGCGG + Intronic
1011227822 6:85127135-85127157 TGTCACTGCTGGTTCCCCAGGGG + Intergenic
1011679216 6:89766977-89766999 TATCACTGTTTCTCCCTCAGAGG + Intronic
1013372271 6:109481585-109481607 GAACACTGCTGGTGCCCCAGTGG - Exonic
1013642307 6:112097810-112097832 GAACAGTGCTTGTCACACAGTGG - Intronic
1014447395 6:121544933-121544955 GAGCACTGCTTTTCCCTGAGAGG - Intergenic
1014942831 6:127463636-127463658 GAAGACTGCTTGAGCCCCAGAGG - Intronic
1016807272 6:148224448-148224470 GATCATTGCTTGAACCCCTGAGG - Intergenic
1017095873 6:150805023-150805045 AATAACTGCTTGAACCCCAGAGG - Intronic
1017400009 6:154049856-154049878 AATCACTCCTTGTAACCCAGTGG - Intronic
1018469838 6:164085569-164085591 CATCACTGCCTTTCCCACAGAGG + Intergenic
1018763190 6:166908320-166908342 GAGCAGAGCTTGTCACCCAGAGG - Intronic
1019654765 7:2185327-2185349 GAACAGTGCTTGTCTCCCGGGGG + Intronic
1020068360 7:5207853-5207875 GAGAACTGCTTGAACCCCAGAGG - Intronic
1022687871 7:32613519-32613541 GAGGACTGCTTGAGCCCCAGAGG - Intergenic
1022830109 7:34057274-34057296 CATCCCTGCCTGTCCTCCAGAGG + Intronic
1023865793 7:44237808-44237830 GGTCTCTCCTTGTCCCACAGAGG - Intronic
1025732615 7:64119869-64119891 GAGGACTGCTTGAGCCCCAGAGG - Intronic
1028693035 7:93675451-93675473 GATCACTGCTGGAACCACAGTGG - Intronic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1032491942 7:132330310-132330332 GGTCACTGCTGGTGTCCCAGAGG - Intronic
1034297495 7:149987098-149987120 GATTACCCTTTGTCCCCCAGTGG - Intergenic
1034808530 7:154109756-154109778 GATTACCCTTTGTCCCCCAGTGG + Intronic
1035852828 8:2938526-2938548 AATCACTGCTTGTCCATCAGAGG + Exonic
1036935073 8:12993776-12993798 AATCACAGCATGTACCCCAGTGG - Intronic
1037714556 8:21386185-21386207 GATGACGGTTTGTCACCCAGAGG + Intergenic
1041544393 8:59025602-59025624 GATCACTGGATGTTCGCCAGCGG - Intronic
1041688793 8:60669282-60669304 GATCAATGCTTTTCCCCAAATGG - Intergenic
1041811772 8:61919381-61919403 GATGGCTGAGTGTCCCCCAGAGG - Intergenic
1045901539 8:107287232-107287254 GATCACTGCGTGTTTCCCTGGGG - Intronic
1048021288 8:130541709-130541731 GATCATTTTTTGTACCCCAGTGG - Intergenic
1048770187 8:137886725-137886747 CTTTCCTGCTTGTCCCCCAGTGG - Intergenic
1051380554 9:16453725-16453747 GAGAACTGCTTGAACCCCAGAGG + Intronic
1059105455 9:111507360-111507382 GAGAATTGCTTGACCCCCAGAGG + Intergenic
1060190069 9:121586982-121587004 GATCACTGCCTGGCACCCAGTGG - Intronic
1060260371 9:122069347-122069369 GTTCACTGCTAGTCAGCCAGGGG + Intronic
1062363522 9:136198442-136198464 GACCACTGCTTTTCCCCTGGTGG - Intronic
1062707527 9:137953664-137953686 GCTCATTCCTAGTCCCCCAGTGG - Intronic
1185639516 X:1579328-1579350 GAAGACTGCTTGAGCCCCAGAGG + Intergenic
1187058892 X:15767029-15767051 GAGCTCTACTTGTCCCCCATGGG + Intronic
1190239319 X:48644998-48645020 GAGGACTGCTTGTGCCCAAGAGG - Intergenic
1191874720 X:65784574-65784596 GATCACTGCTTATCACCCCAGGG + Intergenic
1192249414 X:69399006-69399028 GATCACTGCTTGCAACCCTGTGG + Intergenic
1195494030 X:105508917-105508939 GATCCCTGCTTGTCACAAAGAGG + Intronic
1196473993 X:116061386-116061408 GATGACTGCATGTCTCCCAGGGG + Intergenic
1198921925 X:141738815-141738837 GATAACTGCTTGAACTCCAGAGG - Intergenic
1199472046 X:148206311-148206333 GATAATTGCTTGAACCCCAGAGG - Intergenic
1201760133 Y:17528119-17528141 GATAATTGCTTGGACCCCAGAGG - Intergenic
1201841421 Y:18377871-18377893 GATAATTGCTTGGACCCCAGAGG + Intergenic