ID: 968914597

View in Genome Browser
Species Human (GRCh38)
Location 4:3491938-3491960
Sequence ATCACTGCTTGTCCCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968914587_968914597 23 Left 968914587 4:3491892-3491914 CCACGGCCAAGTGCAGGAGCCGT 0: 1
1: 0
2: 0
3: 5
4: 82
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
968914589_968914597 17 Left 968914589 4:3491898-3491920 CCAAGTGCAGGAGCCGTGCTGGT 0: 1
1: 0
2: 2
3: 14
4: 116
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
968914591_968914597 4 Left 968914591 4:3491911-3491933 CCGTGCTGGTCCGGCCAGTGCCC 0: 1
1: 0
2: 2
3: 14
4: 143
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
968914593_968914597 -10 Left 968914593 4:3491925-3491947 CCAGTGCCCTCTGATCACTGCTT 0: 1
1: 0
2: 2
3: 16
4: 255
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
968914586_968914597 24 Left 968914586 4:3491891-3491913 CCCACGGCCAAGTGCAGGAGCCG 0: 1
1: 0
2: 0
3: 10
4: 95
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117
968914592_968914597 -6 Left 968914592 4:3491921-3491943 CCGGCCAGTGCCCTCTGATCACT 0: 1
1: 0
2: 0
3: 25
4: 198
Right 968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968914597 Original CRISPR ATCACTGCTTGTCCCCCAGA GGG Intronic
900563819 1:3322674-3322696 AGAGCTGCTTCTCCCCCAGATGG + Intronic
901439975 1:9272032-9272054 GTCCCTGCCTGTCCCTCAGATGG + Intergenic
902398355 1:16144390-16144412 ATCACAGTTGGTCCCCCAGGTGG - Intronic
908387043 1:63652751-63652773 TTCACTGCCTGCTCCCCAGAGGG - Intronic
913179892 1:116311249-116311271 ATCACTGCGTATCCCGCGGAGGG - Intergenic
915740929 1:158117941-158117963 TGCACTGCTTCTCCCCCAGGGGG + Intergenic
916434016 1:164759913-164759935 ATGACTGCTTGACCTCCACATGG + Intronic
917616108 1:176746079-176746101 ACCACTGGTTGTCCCACACATGG + Intronic
917651064 1:177077852-177077874 ATCACTGCCCATCCCACAGACGG - Intronic
921794562 1:219327206-219327228 ATCACTGCTTCTCCTCCTCAGGG + Intergenic
922567286 1:226608913-226608935 AACCCTGCTTGGCCCCTAGAGGG - Exonic
1065033590 10:21613814-21613836 AGCATTGCTTGAGCCCCAGAAGG + Intronic
1065422971 10:25567636-25567658 ATAACTGCATGTCATCCAGAGGG + Intronic
1065509589 10:26464890-26464912 ATCCCTGTTTGTCCTTCAGATGG - Intronic
1065720736 10:28626565-28626587 TTCACTGCTTTTCCCTCAGTGGG + Intergenic
1068971461 10:62962635-62962657 ATCAGTGATTGTGACCCAGATGG + Intergenic
1070698044 10:78577581-78577603 ATCACTTCTTGTCCCCCTTAAGG + Intergenic
1071668382 10:87583341-87583363 ATCACTTCTTATCCGTCAGATGG + Intergenic
1073563828 10:104518920-104518942 GTCCCCGCTTGTCCCACAGAAGG - Intergenic
1075314516 10:121442031-121442053 TTCTCTGCTTTTCCTCCAGAGGG - Intergenic
1081554524 11:44146076-44146098 TTCTCTGCTTGTCTCGCAGATGG + Intronic
1091445187 12:541121-541143 ATCTCAGCTTCTCCCCCACACGG - Intronic
1091454992 12:600171-600193 TTCATTGCATGTCTCCCAGAAGG - Intronic
1095432299 12:42146863-42146885 ATAACTCCTTGACCCACAGATGG + Intergenic
1097222184 12:57457420-57457442 ATAAATGCTTGTCTCCCAGTGGG - Exonic
1097746694 12:63311074-63311096 ACCAATTCTTGTCACCCAGAGGG - Intergenic
1100186858 12:92148141-92148163 ATACCTGCTTGTTTCCCAGATGG - Intergenic
1103017337 12:117505694-117505716 CTCACTGCATATCCCCCAGTTGG + Intronic
1103247556 12:119471079-119471101 ATCACTCCTTCTCCACCACAGGG + Intronic
1103299555 12:119917744-119917766 ATGACTGCTTGTCCCACAGGAGG + Intergenic
1114027549 14:18542022-18542044 CTGAATGCTTGTCCCTCAGATGG + Intergenic
1121015730 14:90547882-90547904 ACCACTGCTTGTCCCTCTAACGG + Intronic
1125487404 15:40121765-40121787 ATGCCTGTTTGTCCTCCAGAGGG - Intergenic
1129462693 15:75707838-75707860 CTCACAGCCTGGCCCCCAGAGGG - Intronic
1129722179 15:77883578-77883600 CTCACAGCCTGGCCCCCAGAGGG + Intergenic
1134377370 16:13689850-13689872 ATCACTGGTTGTACTCCACAGGG + Intergenic
1136690655 16:32025839-32025861 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1136791240 16:32969400-32969422 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1136878574 16:33884532-33884554 CTCACTCCTGGCCCCCCAGAGGG + Intergenic
1138621593 16:58215691-58215713 ATCATTCCTTATCCCCCAGTGGG - Intergenic
1140187581 16:72788498-72788520 ACCCCTGCCTGTCCCCAAGAAGG - Exonic
1141834323 16:86528632-86528654 CCCACTGATTGCCCCCCAGACGG - Intergenic
1203093449 16_KI270728v1_random:1230862-1230884 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1146671142 17:34738795-34738817 CTCACTGCTACTCCACCAGACGG + Intergenic
1147134517 17:38427536-38427558 TTCTTTCCTTGTCCCCCAGAAGG - Intergenic
1147153519 17:38531982-38532004 CTCACTCCTGGCCCCCCAGAGGG - Exonic
1149353210 17:55812898-55812920 ATCACTGATTATCTTCCAGAAGG - Intronic
1150456718 17:65312198-65312220 ATCATTGATTTTCCCACAGAAGG - Intergenic
1156024064 18:32631447-32631469 ATCACTACTGGGGCCCCAGATGG - Intergenic
1157196049 18:45621143-45621165 ATCACCTCTTGGCCACCAGAGGG + Intronic
1162470411 19:10869624-10869646 ACCCCTTCTTGTCCCCCAGCTGG + Exonic
1162508986 19:11105657-11105679 ATCACTGCATGTCCCACACCTGG - Intronic
1163318869 19:16560358-16560380 GTCACTGCTTGACCCTCAAATGG - Intronic
1163561128 19:18020313-18020335 GTCACCCCTTGTCCCCCAGCTGG - Intergenic
1165998636 19:39863799-39863821 CTCCCTGCTAGTCCGCCAGAAGG - Exonic
925314743 2:2912810-2912832 CACAGTGCTTGTCCCCCAGGCGG + Intergenic
928815750 2:35292805-35292827 GCCACTGCTTGTCCCGCACATGG - Intergenic
929234738 2:39593919-39593941 TTGTCTGCTTGTCCACCAGAGGG + Intergenic
930658134 2:54027330-54027352 TTCCCTCCTTTTCCCCCAGAAGG + Intronic
930748050 2:54904759-54904781 CTCACTTCTTCTCCCCAAGATGG - Intronic
935428359 2:102945096-102945118 ATCAAAGCTTCTCTCCCAGAGGG + Intergenic
935619583 2:105117108-105117130 ACCATTGGTTTTCCCCCAGAAGG + Intergenic
938187623 2:129245939-129245961 ATCAGTGCCTGGCCCTCAGAAGG + Intergenic
943441029 2:187929092-187929114 AAGATTGCTTGTCCCCAAGAAGG - Intergenic
945183073 2:207111496-207111518 ATGGCTGCTAGTCCCCCAGCAGG - Intronic
946757775 2:222964359-222964381 ATCCCTGCATGTGCCTCAGAGGG + Intergenic
948099970 2:235365639-235365661 ATTACTGCTTTCCCCCCAGATGG - Intergenic
1168893181 20:1307450-1307472 CTCACTCCTTTTCCCCCACAGGG + Exonic
1170005875 20:11668246-11668268 AACACTGCATGTTCCCCAGGTGG - Intergenic
1170096063 20:12647100-12647122 AGCAATGCGTGTCCCACAGAGGG + Intergenic
1171385804 20:24768773-24768795 GTCACTGCATTTCCCACAGATGG + Intergenic
1174121834 20:48271648-48271670 ATCTCTGCTTGACACCCAGCGGG + Intergenic
1174290892 20:49507782-49507804 TTCCCTGCTTTTCTCCCAGAAGG - Exonic
1174447912 20:50602688-50602710 ACCACAGCAAGTCCCCCAGAGGG + Intronic
1174585181 20:51602932-51602954 ACCACTGTTTGTTCCCCAGGCGG + Intronic
1175953851 20:62597951-62597973 ATCACTTCTTGTTCAACAGATGG - Intergenic
1176079194 20:63263151-63263173 GTCAGTGCTTCTCCCCCAGAAGG + Intronic
1178896465 21:36562740-36562762 ATCACTGCCTATTCCCCAGGCGG - Intronic
1180086412 21:45509768-45509790 ACCACTGCTTGGCCACCAGAGGG - Intronic
1180451695 22:15469311-15469333 CTGAATGCTTGTCCCTCAGATGG + Intergenic
1183604630 22:38861183-38861205 ATCACTGCCTGTCCCTCAGTGGG - Intergenic
953740946 3:45538496-45538518 ATTCCTGCTTGTTCCTCAGATGG - Intronic
953804424 3:46055759-46055781 ATCCCTGCTTGTCCAGCAGTAGG + Intergenic
957638574 3:82818790-82818812 ATCACTACGTGTACACCAGAAGG - Intergenic
964902574 3:161677612-161677634 TTATCTTCTTGTCCCCCAGAAGG + Intergenic
967986666 3:195100419-195100441 ATCACAGCGCCTCCCCCAGAAGG + Intronic
968914597 4:3491938-3491960 ATCACTGCTTGTCCCCCAGAGGG + Intronic
969686022 4:8674721-8674743 CTCACTGCTTCACCCCCACAGGG - Intergenic
969959535 4:10929795-10929817 AACACTGCTTGCCCCCTGGACGG + Intergenic
971448585 4:26778627-26778649 TTCACTGCTTTTCCTTCAGATGG + Intergenic
982320037 4:154067936-154067958 ATAACAGCTTGTCTCCCAGGGGG + Intergenic
982613858 4:157615088-157615110 ATCCCTCCTTTTCTCCCAGAGGG + Intergenic
985698408 5:1356247-1356269 GTCACTGCTTGTCCCTGACACGG + Intergenic
993333439 5:86627851-86627873 ATCTCTGCTTGTCTCCCATTGGG - Intergenic
996471047 5:123860786-123860808 AACACTGCTGGCCCCCAAGATGG - Intergenic
997633744 5:135389651-135389673 AGCACTTCTAGTCCACCAGATGG + Intronic
1000009086 5:157215099-157215121 ATCACGCCATGTACCCCAGATGG - Intronic
1008793883 6:55275906-55275928 ATCACTGACTGTTCCCCTGAAGG - Intronic
1008907048 6:56689996-56690018 ATTACTCCTTGTCTCCCAAAAGG + Intronic
1011227823 6:85127136-85127158 GTCACTGCTGGTTCCCCAGGGGG + Intergenic
1014650521 6:124030828-124030850 AACACTGCTAGTACCCAAGATGG + Intronic
1017400008 6:154049855-154049877 ATCACTCCTTGTAACCCAGTGGG - Intronic
1018056530 6:160056879-160056901 CTCAGTGCCTGTCCCCTAGAGGG + Intronic
1020344469 7:7148186-7148208 ATAAATGCTTGTCCCTGAGATGG + Intergenic
1029864770 7:103615577-103615599 ATCCCTGATGGTCTCCCAGAGGG - Intronic
1034420102 7:150986079-150986101 TGGACTGCTGGTCCCCCAGAGGG - Intergenic
1036935072 8:12993775-12993797 ATCACAGCATGTACCCCAGTGGG - Intronic
1037714557 8:21386186-21386208 ATGACGGTTTGTCACCCAGAGGG + Intergenic
1041332198 8:56739088-56739110 ATCAGTGTTTGTGGCCCAGATGG + Intergenic
1044273347 8:90272375-90272397 ATCACCACTTGTTCCCAAGACGG - Intergenic
1048770186 8:137886724-137886746 TTTCCTGCTTGTCCCCCAGTGGG - Intergenic
1049980553 9:900317-900339 TTCACTGCTTGTCCGCCGTAAGG + Intronic
1053349104 9:37400607-37400629 ATCTCTCTCTGTCCCCCAGACGG + Intergenic
1060190068 9:121586981-121587003 ATCACTGCCTGGCACCCAGTGGG - Intronic
1062218765 9:135403274-135403296 ATCACTGTTTGTCTCCGTGAGGG - Intergenic
1190136852 X:47805986-47806008 ACTACTTCTGGTCCCCCAGAGGG - Intergenic
1190407755 X:50104560-50104582 ATCCCTCCTAGCCCCCCAGAAGG + Intergenic
1192129235 X:68532286-68532308 GTCACTGGTTGTCACCCAAATGG - Exonic
1192544758 X:72004384-72004406 GTCACTGCCTGTCCCCTAGGTGG - Intergenic
1195494031 X:105508918-105508940 ATCCCTGCTTGTCACAAAGAGGG + Intronic
1196473994 X:116061387-116061409 ATGACTGCATGTCTCCCAGGGGG + Intergenic
1198550582 X:137741296-137741318 CTCACTACTTTTTCCCCAGAAGG + Intergenic
1201760132 Y:17528118-17528140 ATAATTGCTTGGACCCCAGAGGG - Intergenic
1201841422 Y:18377872-18377894 ATAATTGCTTGGACCCCAGAGGG + Intergenic