ID: 968914769

View in Genome Browser
Species Human (GRCh38)
Location 4:3492606-3492628
Sequence CGGGGCCTACAGCAGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968914769_968914786 3 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914786 4:3492632-3492654 CTTGGGGGCTGGAAGGGGTGGGG 0: 1
1: 1
2: 4
3: 93
4: 822
968914769_968914788 29 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914788 4:3492658-3492680 GACCAGAGAGTGCTGGCCTGTGG 0: 1
1: 1
2: 0
3: 34
4: 234
968914769_968914789 30 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914789 4:3492659-3492681 ACCAGAGAGTGCTGGCCTGTGGG 0: 1
1: 0
2: 2
3: 16
4: 178
968914769_968914784 1 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914784 4:3492630-3492652 GGCTTGGGGGCTGGAAGGGGTGG 0: 1
1: 1
2: 10
3: 115
4: 1102
968914769_968914787 22 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914787 4:3492651-3492673 GGGGCGAGACCAGAGAGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 190
968914769_968914785 2 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914785 4:3492631-3492653 GCTTGGGGGCTGGAAGGGGTGGG 0: 1
1: 0
2: 5
3: 70
4: 687
968914769_968914777 -8 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914777 4:3492621-3492643 AGGCCCCGGGGCTTGGGGGCTGG 0: 1
1: 0
2: 5
3: 64
4: 639
968914769_968914783 -2 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914783 4:3492627-3492649 CGGGGCTTGGGGGCTGGAAGGGG 0: 1
1: 1
2: 2
3: 92
4: 803
968914769_968914782 -3 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914782 4:3492626-3492648 CCGGGGCTTGGGGGCTGGAAGGG 0: 1
1: 0
2: 2
3: 50
4: 457
968914769_968914780 -4 Left 968914769 4:3492606-3492628 CCAGGTTTCTGCTGTAGGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 968914780 4:3492625-3492647 CCCGGGGCTTGGGGGCTGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968914769 Original CRISPR CGGGGCCTACAGCAGAAACC TGG (reversed) Intronic
900342843 1:2196969-2196991 CGGGTCCAACAGCAGAACCCTGG - Intronic
903318726 1:22528834-22528856 CTGGGTCTCCAACAGAAACCTGG - Exonic
903331113 1:22597664-22597686 CGGGGCCTGCAGGAGACTCCGGG + Exonic
903498377 1:23787501-23787523 TGGGGCTTGCTGCAGAAACCTGG + Exonic
905016426 1:34781714-34781736 CGGGGCCCACAGCAGAGGCGAGG - Exonic
906523979 1:46483880-46483902 CTGGGCCCACAGCACCAACCTGG + Intergenic
908253827 1:62286262-62286284 CCGGCCCTGCAGCCGAAACCTGG - Intronic
909433761 1:75616897-75616919 CTTGGCCTCCAGCAGAAACTTGG + Intergenic
912386228 1:109272540-109272562 AGGGACCCACAGCAGGAACCAGG + Intronic
921164660 1:212498144-212498166 CGGGGGCCTGAGCAGAAACCTGG - Intergenic
1069682611 10:70296052-70296074 CGGGGCTCACAGCAAAAACCCGG + Intergenic
1069880339 10:71588826-71588848 GGGTGCCTACAGCAGAGGCCTGG - Intronic
1070708435 10:78658418-78658440 CTGGGCCCACATCAGAGACCTGG - Intergenic
1070835357 10:79444433-79444455 CAGCGCCTTCTGCAGAAACCTGG - Intronic
1072721980 10:97786815-97786837 GGGGGCCTACAGCAGGCACCAGG - Intergenic
1075787879 10:125062152-125062174 CGGTGCCTACAGGGGAAAACGGG + Intronic
1077335749 11:2003201-2003223 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1077434368 11:2531692-2531714 GGGGGACTACAGCAGAAAGGGGG - Intronic
1078069648 11:8100077-8100099 GAGGGCCAACAACAGAAACCAGG + Intronic
1078782530 11:14453224-14453246 AGGAGCCTACAGAAGTAACCAGG - Intronic
1078899796 11:15630958-15630980 CAGGGCCAACACCAGAGACCTGG - Intergenic
1079103861 11:17558283-17558305 CCGTGCCTACAGCAGAACCCAGG + Exonic
1084647183 11:70465322-70465344 TGGGGCCTACCGGAGAAAGCTGG + Intergenic
1202818733 11_KI270721v1_random:58383-58405 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1092898771 12:13039221-13039243 TGCGGCCAACAGCAGAGACCTGG + Intergenic
1096629425 12:52916271-52916293 AGGGGGCTACTGCAGAAAGCAGG + Intronic
1097820861 12:64128000-64128022 CGGGGCCTGCTGCAGAACCGTGG + Exonic
1098096632 12:66963939-66963961 CAGTGCCTACACCAGGAACCTGG + Intergenic
1100847746 12:98678436-98678458 GGGCGGCTACAGCAGGAACCAGG - Intronic
1105672946 13:22641181-22641203 ATGGGTCTACAGCAGAAAACGGG - Intergenic
1109419750 13:62096066-62096088 CGGAGCCAGCAGCAGCAACCTGG - Intergenic
1112686151 13:101830147-101830169 CAGTGGCTGCAGCAGAAACCTGG + Intronic
1113733416 13:112658081-112658103 CGGGGGCTCCAGCAAAAGCCTGG - Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1125540068 15:40465106-40465128 CAGGGGCTAGAGCAGATACCTGG + Intronic
1127608630 15:60615501-60615523 CGGGGGCTCCAGCAGCAGCCGGG + Intronic
1128710758 15:69869733-69869755 TGGGGCCATCAGCAGAAACTGGG + Intergenic
1128809570 15:70561092-70561114 CTGGGCCTACTGCAGTACCCAGG + Intergenic
1129120072 15:73390897-73390919 CTGAGCTGACAGCAGAAACCAGG + Intergenic
1134641090 16:15829773-15829795 CGGGGCCTGCAGCAGAAATGAGG + Intronic
1136682595 16:31976721-31976743 CGGGGCCCACAGCAGAGGGCTGG - Intergenic
1136782856 16:32917889-32917911 CGGGGCCCACAGCAGAGGGCCGG - Intergenic
1136886940 16:33935961-33935983 CGGGGCCCACAGCAGAGGGCCGG + Intergenic
1203085504 16_KI270728v1_random:1181873-1181895 CGGGGCCCACAGCAGAGGGCCGG - Intergenic
1144411841 17:15009300-15009322 TGGAGCTTAAAGCAGAAACCTGG - Intergenic
1144767791 17:17742177-17742199 CAGGGCCCACAGCAGATGCCAGG + Intronic
1147143116 17:38470061-38470083 CGGGGCCCACAGCAGAGGGCGGG - Intronic
1149450226 17:56744312-56744334 CAGGGGCTACAGCAGAAAGTTGG + Intergenic
1152465044 17:80461605-80461627 CGGGGGCTGCTGCAGAACCCGGG - Intergenic
1152469609 17:80483374-80483396 CGGGGCTGACAGCAGAGTCCTGG + Intergenic
1153514461 18:5891273-5891295 CGGGGCCTGGAGCTGAAGCCCGG - Exonic
1153654142 18:7267123-7267145 CGGGGCCGACAGCAGGCACAGGG + Intergenic
1160772634 19:839881-839903 TGGGGCGTACGGCATAAACCCGG - Intergenic
1161028351 19:2046872-2046894 AGGGGCAGACAGCATAAACCAGG + Intronic
1161294918 19:3514698-3514720 TGGGGCAGACAGCACAAACCAGG - Intronic
1162130124 19:8521349-8521371 CGGGGGCTGCAGCAGTGACCTGG + Exonic
1162721247 19:12664331-12664353 CGGGTCCAACATCAGAACCCAGG + Intronic
1163059686 19:14751594-14751616 CAGGGCCTCCAGCAGCATCCAGG + Exonic
1164761280 19:30730168-30730190 TGGGGCCTACAGGAGACACTAGG - Intergenic
1164912690 19:32025609-32025631 CTGGGCCTAGATCAGAAACCTGG + Intergenic
1166885948 19:45960975-45960997 GGGGGCCTAGGGCAGAGACCTGG + Intronic
1167428345 19:49441174-49441196 CGGAGCCCACGGCAGAAAACTGG + Intronic
1167586260 19:50377349-50377371 CGGGGCCTACAGCAGGGGCGGGG + Intronic
926636136 2:15181848-15181870 CAGGGCCTACAGCAGGAACTAGG + Intronic
926944020 2:18168312-18168334 CAGTGCCTACAGCACAAAACTGG - Intronic
929918588 2:46156164-46156186 CGGGGCCTGATGCAGAACCCTGG - Intronic
937539021 2:122925666-122925688 TGGGGCCTGCAGCAGCATCCAGG + Intergenic
942326731 2:174782309-174782331 CGGGGCCCAGAGCAGAAATGCGG + Intergenic
943211469 2:184972982-184973004 CGGGGCCAGCAGCAGCAACCTGG - Intergenic
947461250 2:230306494-230306516 CCAGGCCTACAGCTGCAACCTGG - Intronic
948053360 2:234994436-234994458 CGGGGCCTTCAGAGGAATCCAGG - Intronic
1170000472 20:11608525-11608547 CTGGGCCTTCAGCAGACACGAGG + Intergenic
1175780572 20:61679780-61679802 GCTGGCCTGCAGCAGAAACCTGG + Intronic
1175840973 20:62027182-62027204 CAGGGCCCAGTGCAGAAACCTGG + Intronic
1178633676 21:34283860-34283882 TGGGGCCTTTAGCAGAAACAAGG - Intergenic
1180908470 22:19431892-19431914 CGGGGCCTGCAGTTGCAACCCGG + Exonic
1183620319 22:38968266-38968288 GGGAGCCTAGAGCAGAAGCCAGG - Intronic
1184768834 22:46586466-46586488 TGGGGCCTAGAGCAGAGCCCGGG - Intronic
954205677 3:49057273-49057295 CTAGCCCTACAGGAGAAACCTGG - Exonic
956691113 3:71878318-71878340 AGGGGGCTGCAGCAGAAACCAGG + Intergenic
959849756 3:111072097-111072119 CGGGGGCTGCAGCAGGAGCCCGG - Exonic
960962498 3:123082188-123082210 CAGGGCCTACCGAAGCAACCAGG - Intronic
961659170 3:128459260-128459282 CTGGGTGCACAGCAGAAACCTGG - Intergenic
963925173 3:150943819-150943841 CAGGCCCTGCAGCAGCAACCAGG - Intronic
968914769 4:3492606-3492628 CGGGGCCTACAGCAGAAACCTGG - Intronic
969966389 4:11001099-11001121 CAGGGCCTACAGCAGGGCCCAGG + Intergenic
972341960 4:38159812-38159834 TAGGCCCTAAAGCAGAAACCTGG + Intergenic
972818834 4:42675853-42675875 CCAGGCCTAAAGCATAAACCAGG - Intergenic
975820726 4:78267809-78267831 TGGGGCCTACAGCAAGAGCCCGG - Intronic
980670832 4:136004727-136004749 CAGGGCTTACAGCAGAAAAAAGG - Intergenic
980926410 4:139142556-139142578 AGGGGACAACAGCAGAAACGGGG + Intronic
985778458 5:1857347-1857369 CTGGGCCTTCAGCAGACGCCGGG + Intergenic
986125663 5:4880597-4880619 CGGGGCTGACTCCAGAAACCAGG + Intergenic
986259906 5:6134980-6135002 TGGGGCCTTCAGCAGAGGCCAGG - Intergenic
987952039 5:24687753-24687775 GGGGGCCTACAGCTGCAACAGGG + Intergenic
994043630 5:95284697-95284719 CGGGCGCAGCAGCAGAAACCGGG + Intergenic
999638579 5:153648189-153648211 AGGAGCCAACAGAAGAAACCAGG + Intronic
999924604 5:156361087-156361109 TGGGGCCTGCAGCAGCACCCAGG - Intronic
1003218417 6:4135747-4135769 CGGGGCCGAGAGCAGAGCCCAGG + Intergenic
1006682164 6:35805252-35805274 CGGGGCCTGCAGCAGAGGCGGGG - Intergenic
1009608703 6:65908194-65908216 TGGGGCCTTCAGCAGTAGCCAGG + Intergenic
1014816620 6:125942816-125942838 TGGGGAGTACAGCAGAAAGCAGG + Intergenic
1015153200 6:130061867-130061889 AGGGGCCTGCAGTAGGAACCAGG + Intronic
1019934597 7:4246073-4246095 CTGGGCCTAAAGCAGATCCCAGG - Intronic
1020070516 7:5223938-5223960 CCAGGGCAACAGCAGAAACCAGG - Intronic
1024561304 7:50647782-50647804 TGGGTCCCACAGCAGAGACCAGG + Intronic
1025928888 7:65979839-65979861 CGAGGCCGACATCAGCAACCTGG - Exonic
1025951752 7:66150976-66150998 CTGGGACCACATCAGAAACCAGG + Intronic
1026340161 7:69427859-69427881 CGTGGCCTTCAACAGAAAGCGGG - Intergenic
1037613666 8:20497441-20497463 CTGGGGCTACAGCAGAGACTAGG - Intergenic
1040609875 8:48973361-48973383 CGGGGCCTTTAGCAGCACCCTGG - Intergenic
1046454081 8:114436442-114436464 CAGAGGCTACAGCAGATACCAGG + Intergenic
1049170037 8:141154207-141154229 CGGGGCCTTCCCCAGGAACCTGG + Intronic
1049221161 8:141429562-141429584 GGGTCCTTACAGCAGAAACCTGG - Intronic
1052941118 9:34132834-34132856 GGTGCCCTACAGGAGAAACCAGG + Intergenic
1056846909 9:90046327-90046349 CTGGGCCAACATCAGAAACCAGG - Intergenic
1057490113 9:95513940-95513962 AGGGGTCTACAGCACAAACCCGG + Intronic
1058028279 9:100166841-100166863 AGGGGGCAAGAGCAGAAACCAGG - Intronic
1060147400 9:121264800-121264822 AGGGTCCTACTGCACAAACCTGG - Intronic
1060900825 9:127256359-127256381 GGGTGCCCACAGCAGAAGCCGGG - Intronic
1189242998 X:39540277-39540299 TGGGACCTACATCAGCAACCAGG + Intergenic
1196861600 X:120033869-120033891 CTGGGCCTACAGCAATATCCAGG - Intergenic
1196877728 X:120170135-120170157 CGGGGCCTAGAGCACCAAGCAGG - Intergenic