ID: 968916399

View in Genome Browser
Species Human (GRCh38)
Location 4:3498753-3498775
Sequence TCATCTCGATGAAGGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968916392_968916399 13 Left 968916392 4:3498717-3498739 CCTGGGCACCAGAACTTGGCCGC 0: 1
1: 0
2: 0
3: 13
4: 107
Right 968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 60
968916395_968916399 -6 Left 968916395 4:3498736-3498758 CCGCTATGTTCTGTGGCTCATCT 0: 1
1: 0
2: 2
3: 13
4: 161
Right 968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 60
968916390_968916399 17 Left 968916390 4:3498713-3498735 CCTGCCTGGGCACCAGAACTTGG 0: 1
1: 0
2: 7
3: 218
4: 5208
Right 968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 60
968916388_968916399 25 Left 968916388 4:3498705-3498727 CCCAGGTGCCTGCCTGGGCACCA 0: 1
1: 0
2: 1
3: 42
4: 407
Right 968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 60
968916393_968916399 5 Left 968916393 4:3498725-3498747 CCAGAACTTGGCCGCTATGTTCT No data
Right 968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 60
968916389_968916399 24 Left 968916389 4:3498706-3498728 CCAGGTGCCTGCCTGGGCACCAG No data
Right 968916399 4:3498753-3498775 TCATCTCGATGAAGGGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968916399 Original CRISPR TCATCTCGATGAAGGGGTCC TGG Intronic