ID: 968916817

View in Genome Browser
Species Human (GRCh38)
Location 4:3500254-3500276
Sequence GTCCACAGCCACGGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968916817_968916826 3 Left 968916817 4:3500254-3500276 CCCCAGGACCCGTGGCTGTGGAC 0: 1
1: 0
2: 1
3: 26
4: 180
Right 968916826 4:3500280-3500302 CCAGGACCAGAGAGGCCGCGCGG 0: 1
1: 0
2: 2
3: 17
4: 210
968916817_968916823 -5 Left 968916817 4:3500254-3500276 CCCCAGGACCCGTGGCTGTGGAC 0: 1
1: 0
2: 1
3: 26
4: 180
Right 968916823 4:3500272-3500294 TGGACAGCCCAGGACCAGAGAGG 0: 1
1: 0
2: 1
3: 30
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968916817 Original CRISPR GTCCACAGCCACGGGTCCTG GGG (reversed) Intronic
900242278 1:1622821-1622843 GTCCCCAGACACTGCTCCTGGGG - Intronic
900337711 1:2172772-2172794 GTCCTCAGCCGCAGGGCCTGTGG - Intronic
900923790 1:5690561-5690583 GGCCACATTCACAGGTCCTGGGG - Intergenic
901302977 1:8212964-8212986 ATCCAGAGCCACGGGGCCTGTGG + Intergenic
904336294 1:29800459-29800481 CTCCACAGCCCCGGGTACAGAGG - Intergenic
904369646 1:30040315-30040337 GTCCACAGCCACCTCACCTGTGG - Intergenic
907319492 1:53593820-53593842 GCACACAGCCCCGGGCCCTGTGG + Intronic
913660488 1:121002565-121002587 GTCCACTGCCATGGTTCCTGTGG - Intergenic
914011851 1:143785722-143785744 GTCCACTGCCATGGTTCCTGTGG - Intergenic
914165981 1:145175412-145175434 GTCCACTGCCATGGTTCCTGTGG + Intergenic
914343617 1:146779959-146779981 GTGGGCAGCCACGAGTCCTGAGG + Intergenic
914650479 1:149694382-149694404 GTCCACTGCCATGGTTCCTGTGG - Intergenic
916843583 1:168625728-168625750 TTCCACAGCAGCGGCTCCTGGGG + Intergenic
916887269 1:169082001-169082023 GTCCACACTCAGGGGTGCTGGGG - Intergenic
919455808 1:197818546-197818568 GCCCACAGCCAGTGGACCTGGGG + Intergenic
919974334 1:202600876-202600898 GTCCACCACCAAGGGCCCTGGGG + Intronic
922042580 1:221911193-221911215 GCCCACAGACACGGGTCCTAAGG + Intergenic
922481425 1:225942044-225942066 GTCCAAAGCCACAGGTACTGGGG + Intergenic
922481642 1:225943439-225943461 GTACAAAGCCACAGGTACTGGGG - Intergenic
922504168 1:226116846-226116868 GTCCACAGGCAGGGGCCTTGGGG + Intergenic
1062771558 10:105190-105212 GTCCACAGCCACGGTTTGGGTGG + Intergenic
1067015300 10:42753675-42753697 GGCCACTGTCACGGGTCCTGTGG - Intergenic
1067750453 10:48968101-48968123 CTTACCAGCCACGGGTCCTGGGG + Intronic
1068955022 10:62814182-62814204 GCACACACCCAGGGGTCCTGTGG + Exonic
1069841347 10:71341265-71341287 GTCCACAGCCATTGGTCCCATGG - Intronic
1070669785 10:78369698-78369720 GCCCACAGCAAAGGCTCCTGGGG - Intergenic
1076140899 10:128077835-128077857 GCCCACAGCTGCGGGTACTGGGG - Intronic
1076648623 10:131971786-131971808 ACCCACAGCCAGGGCTCCTGGGG + Intronic
1077372979 11:2192361-2192383 GTCCCCAGCCATAGGCCCTGTGG + Intergenic
1077461616 11:2713652-2713674 GGCCACAGCCACAGGCTCTGCGG + Intronic
1079758835 11:24302714-24302736 TTCCACAAACACGGGGCCTGCGG - Intergenic
1080668926 11:34358432-34358454 CTCCGCAGCCAGGCGTCCTGGGG + Intergenic
1083724244 11:64620061-64620083 GTCCTTAGCCTGGGGTCCTGGGG - Intronic
1084155694 11:67311411-67311433 GTCCACAGCCACGCTTCCTCGGG - Intronic
1084731302 11:71075454-71075476 ATCCACAGCCAGGGGTCTGGTGG - Intronic
1089348034 11:117804131-117804153 GGCCAAAGCCACGGCTCCTGGGG + Intronic
1090803839 11:130190368-130190390 GTCCACACCCACGGGGTCTCAGG + Intronic
1091406725 12:213926-213948 GTCCCCAGCACCGGCTCCTGTGG + Intronic
1091410652 12:237148-237170 GTCCACAGGCAAGGTTCGTGTGG - Exonic
1091789954 12:3266414-3266436 GTCCACAGCCACAGAACATGAGG + Intronic
1092281867 12:7103682-7103704 GTCCTCAGCCACTGCTCCTCGGG - Intronic
1096226425 12:49869423-49869445 GTCCCCAGCCAGGCCTCCTGAGG - Exonic
1100809652 12:98325415-98325437 GTCCACAGCCACAGCAGCTGTGG + Intergenic
1104895054 12:132159893-132159915 GGACACAGCCACGGGCTCTGGGG + Intergenic
1105281473 13:18965096-18965118 GTCCACAGTCAGGGCTCCCGGGG + Intergenic
1106139452 13:26999645-26999667 GTTCACCGCCACGTGTGCTGGGG - Intergenic
1106767071 13:32923790-32923812 CCCCACAACCAAGGGTCCTGTGG - Intergenic
1109762307 13:66845510-66845532 GTCCACAGCCATGGGTTGGGTGG + Intronic
1113006375 13:105707094-105707116 GTACACAGCCAAGGGTACTGAGG - Intergenic
1118646653 14:67846952-67846974 GTCCACACCCTGGGGTCGTGGGG + Intronic
1119179695 14:72597435-72597457 GCCCACAGCCCTGGCTCCTGGGG - Intergenic
1119715807 14:76858497-76858519 GTTCACATTCACGGGTCCTAGGG + Intronic
1120126409 14:80749063-80749085 GTCCACAACCACTGGGACTGTGG - Intronic
1125760123 15:42090618-42090640 GGGCACAGCCCCTGGTCCTGGGG + Intronic
1126141822 15:45445398-45445420 CTCCACAGCCACGGGTCTGCAGG - Intronic
1127625248 15:60774136-60774158 ACCCACAGCCACGGCTTCTGGGG + Intronic
1128141093 15:65301424-65301446 GTGCGCAGCCCCGGTTCCTGCGG + Intergenic
1128244518 15:66124096-66124118 CTCCACAGCCAAGTGTCCGGAGG + Intronic
1132038732 15:98506803-98506825 GTCCACAGCCCCTAGTGCTGGGG + Intronic
1132633694 16:932261-932283 ATCCTCAGCGATGGGTCCTGTGG + Intronic
1135396451 16:22135470-22135492 GGCCACATGCACAGGTCCTGAGG + Intronic
1138450562 16:57091692-57091714 GTCCACAGCCCTTGGCCCTGGGG - Intergenic
1139711123 16:68777213-68777235 GTCAAGAGCCACGGGCTCTGGGG + Intronic
1139990374 16:70935375-70935397 GTGGGCAGCCACGAGTCCTGAGG - Intronic
1140474930 16:75235050-75235072 GGCCACTGCCCCGGGGCCTGAGG - Exonic
1142119772 16:88381521-88381543 GTCCACAGCCAGGGGACCCCTGG + Intergenic
1142160054 16:88552666-88552688 TTCCACATCCACAGGTCCTGGGG - Intergenic
1142426105 16:90003162-90003184 GGCCACTGGCACTGGTCCTGGGG - Intergenic
1143002739 17:3805324-3805346 GTCCACAGCACCTGGTCATGTGG - Intergenic
1143550248 17:7626353-7626375 GTCCACAGACACTGATGCTGAGG - Exonic
1144515451 17:15914595-15914617 GTCTACAGCCTCAGCTCCTGTGG + Intergenic
1147242157 17:39097486-39097508 GGCCACAGCCTCTGCTCCTGGGG - Intronic
1147927668 17:43955357-43955379 GCCCACAGCCATCTGTCCTGGGG - Intronic
1149993181 17:61394022-61394044 TGCCACATCCACGTGTCCTGGGG - Intergenic
1151725332 17:75880565-75880587 GGTCACAGCCACAGGTCCTGGGG + Intronic
1151882577 17:76904161-76904183 GTGCACCCCCAGGGGTCCTGAGG - Intronic
1152374655 17:79912948-79912970 GTCCACCACCACGGGCCCTTAGG + Intergenic
1152602775 17:81273292-81273314 GACCACAGCTGGGGGTCCTGGGG - Intronic
1152657271 17:81525852-81525874 GGCAACAGCCTGGGGTCCTGAGG + Intergenic
1152755340 17:82084828-82084850 GTCTACCGCGACGGGGCCTGGGG - Exonic
1152812781 17:82390295-82390317 GACCACAGCCACGGACCCTCTGG + Intronic
1152815905 17:82407652-82407674 CGCCACAGCCACTGGCCCTGCGG + Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1155162826 18:23209371-23209393 GGCCACAACCACAGGTACTGGGG + Intronic
1156459319 18:37312843-37312865 GTCCTTGGCCAAGGGTCCTGGGG - Intronic
1156481808 18:37441096-37441118 GTCCAGAGTCACTGGTCCAGCGG - Intronic
1157568206 18:48694378-48694400 CTCCACTGCCAGGGTTCCTGTGG - Intronic
1160546095 18:79657048-79657070 TTTCACAGCCCCGGGTCCTCAGG - Intergenic
1160933691 19:1582876-1582898 TTCCACAGCCAGGGATCCAGTGG + Intronic
1161384792 19:3985236-3985258 TTCCCCAGCCCCGGGTCCTCCGG + Intronic
1161416570 19:4150397-4150419 CCCCACAGCCACGGGATCTGGGG - Intergenic
1161614108 19:5260582-5260604 TTCCACAGCCAGGTGACCTGAGG + Intronic
1161750448 19:6092472-6092494 GTTTACAGCCACGCGTCCAGAGG + Intronic
1162190206 19:8939055-8939077 TTCCACAGCCACCAGTCATGGGG - Exonic
1163631188 19:18418696-18418718 CTCCACAGTCACAGGGCCTGCGG - Intergenic
1164632621 19:29771595-29771617 GGCCACAGTCACAGGTACTGGGG - Intergenic
1165375069 19:35436068-35436090 ATCCACAGCCTGGGGTCCTCTGG - Intergenic
1166284005 19:41812302-41812324 GCACAGAGCCACGGTTCCTGAGG + Intergenic
1166301930 19:41915888-41915910 ATCCACAGCCACTGGGGCTGGGG - Intronic
926588160 2:14711764-14711786 GTAGACATCCAAGGGTCCTGTGG + Intergenic
927485537 2:23486172-23486194 GGCCACAGCAGAGGGTCCTGGGG + Intronic
927963852 2:27257299-27257321 CCCCACAGCCACGGGTCTAGGGG - Exonic
929492348 2:42407875-42407897 GTCCACAGCCACGGTTTGGGTGG - Intronic
931005917 2:57850045-57850067 GTCCACAGCCATGGCTTCAGCGG + Intergenic
931134257 2:59378327-59378349 GTGCACTGCCAGGGGGCCTGAGG + Intergenic
933208520 2:79537853-79537875 GTCCAAAACCACAGATCCTGAGG - Intronic
933599480 2:84315320-84315342 GTCTACAGGCAGGTGTCCTGGGG - Intergenic
936558222 2:113514343-113514365 GACCACAGCCAAGGGTGCAGAGG + Intergenic
936992183 2:118377877-118377899 GTCCAGACCCACGGCTCTTGAGG + Intergenic
941749681 2:169121161-169121183 GCACACAGCCCAGGGTCCTGGGG + Intergenic
944356237 2:198791977-198791999 GCTCACAGCCACTGGTCATGTGG - Intergenic
944519159 2:200545996-200546018 GTTCACACCCAGGGGACCTGGGG - Intronic
946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG + Exonic
948977947 2:241475344-241475366 GTCCATAGCCATGGGCACTGGGG - Intronic
1172233405 20:33352488-33352510 GTCAACAGCCACGTGTCCTCAGG + Intergenic
1173676578 20:44840932-44840954 GGTCACAGCCACGGTTCCTGTGG - Intergenic
1175312308 20:58020294-58020316 GTACACAGCCCCAGGTTCTGAGG - Intergenic
1175985113 20:62760730-62760752 GCCCAAAGCCACGGAGCCTGCGG - Exonic
1176031979 20:63017184-63017206 GGCCACATCAACGGGTCCTGGGG + Intergenic
1176070673 20:63224675-63224697 GGCCACAGCCACGGGAGGTGTGG + Intergenic
1178786253 21:35656496-35656518 GGCCACAGTCACAGGTCCTGAGG - Intronic
1179232584 21:39518529-39518551 GTTCACAGCCAGGGGACCTCGGG - Intergenic
1179491278 21:41743135-41743157 GGCTACAGCCACGGGGGCTGAGG - Intronic
1179629885 21:42669829-42669851 GCCCACAGCCACGGATAATGAGG + Intronic
1180030135 21:45201104-45201126 GTCCACAGCCACCTGTCCTGCGG - Intronic
1180043438 21:45292138-45292160 GTCCACAGACCCGGGTCCTACGG + Intergenic
1180058729 21:45374111-45374133 CTGCACCTCCACGGGTCCTGGGG - Intergenic
1180150237 21:45943536-45943558 CTCCACTGACACGGGTGCTGAGG - Intergenic
1182257807 22:29050726-29050748 ACCCACAGCCTCGGCTCCTGGGG + Exonic
1182765158 22:32753223-32753245 GTCAAAGGTCACGGGTCCTGTGG + Intronic
1184084772 22:42254443-42254465 GTCCAGAGCCAGGGTGCCTGTGG + Intronic
1184449566 22:44574898-44574920 GTCCCCAGCCACAGGCCCTAGGG + Intergenic
1184587097 22:45455340-45455362 TTCCACAGCCACGGGGGCTCGGG + Intergenic
1185009442 22:48305062-48305084 GTCCACAGCCAGGAGTCCTCTGG + Intergenic
949960410 3:9307349-9307371 GTGAACAGCCAGGGGTCCTGGGG + Intronic
950467424 3:13163499-13163521 TGCCCCAGCCACGGGGCCTGAGG - Intergenic
954154035 3:48674827-48674849 GTCCACAGCCCTGGGGTCTGTGG - Intronic
954218498 3:49137923-49137945 GTACACAGCCAGGGGGACTGTGG - Intergenic
954875524 3:53800615-53800637 GGCCACAGCCGCTGGCCCTGTGG + Intronic
955303711 3:57809194-57809216 GTCCACAGCCACAGTTTGTGTGG - Intronic
959078893 3:101779482-101779504 GCCCACAGCCACGACTCCAGGGG - Intronic
961756450 3:129130012-129130034 GTCTGCAGCCCTGGGTCCTGAGG + Exonic
962439091 3:135395324-135395346 GGCCTCAGTCACGGATCCTGTGG + Intergenic
962661857 3:137609669-137609691 GTGGACAGCCACAGGTGCTGAGG - Intergenic
963926974 3:150961048-150961070 GTCCACAGCCACCTGGCCTCAGG - Intronic
965730997 3:171772600-171772622 GTCATCAGCCACAGGTCTTGAGG - Intronic
968445838 4:651608-651630 CTCCACAGCCCCGGCGCCTGCGG - Intronic
968505467 4:969171-969193 AACCACACCCCCGGGTCCTGGGG + Intronic
968916817 4:3500254-3500276 GTCCACAGCCACGGGTCCTGGGG - Intronic
969971970 4:11057259-11057281 ATCCACAGCCTCTTGTCCTGTGG + Intergenic
975857720 4:78642225-78642247 GTCCACTGCCCAGGGTCCTAGGG + Intergenic
976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG + Intronic
977937930 4:102827409-102827431 GTCCACACCCACGCGTACAGAGG + Intronic
981270869 4:142846341-142846363 GTTCTCAGCCCCGGGTACTGAGG - Intronic
984771921 4:183444199-183444221 GCCCGCAGCCGCGGGGCCTGTGG - Intergenic
985590143 5:760245-760267 GGTCACATCCACGGGTGCTGCGG - Intronic
985644223 5:1077557-1077579 GCCCACAGCCACGTGTCCAGAGG - Intronic
985997787 5:3606383-3606405 GCCCACAGCCTGGGATCCTGCGG - Intergenic
989478347 5:41900279-41900301 GGCCACATCCACAGGTTCTGGGG + Intergenic
993310918 5:86331042-86331064 TTCCACAGCCATGGTTCATGTGG + Intergenic
997379629 5:133426345-133426367 GACCCAAGCCACTGGTCCTGCGG - Intronic
1002304230 5:178273928-178273950 GTTCACAGCCCAGGGTCCTCCGG - Intronic
1003558044 6:7158191-7158213 GGCCACAGGCAAGTGTCCTGGGG - Intronic
1004322401 6:14642187-14642209 GGGCACAGCCAAGGGTCCTCCGG + Intergenic
1006263105 6:32893826-32893848 TCCCACATCCACGGGACCTGCGG + Intergenic
1006347829 6:33497777-33497799 GTCCACAGCCAGGGTTTCGGTGG - Intergenic
1006744442 6:36331405-36331427 GTCCAAAGCCACTGGGTCTGGGG + Intronic
1014102834 6:117530542-117530564 GTCCACAGCCTGGGGGCTTGGGG + Intronic
1017526857 6:155248474-155248496 TTTCACAGCCACGTGACCTGAGG - Intronic
1019310354 7:357439-357461 TCCCACAGTCACAGGTCCTGGGG - Intergenic
1019658302 7:2209674-2209696 CTCCACACCCACGGGGCCTCGGG + Intronic
1023617846 7:42038584-42038606 GTGCACAGGGAGGGGTCCTGGGG - Intronic
1026359729 7:69591924-69591946 GTCTGCAGCCACGGGTGCGGCGG + Intergenic
1027430996 7:78112717-78112739 GTACACAGCCCTGGGCCCTGGGG + Intronic
1029357850 7:100065983-100066005 GTGAACAGCCACAGGTCCTTTGG + Intronic
1032264324 7:130360288-130360310 GGCCCCAGCCATGGGTGCTGGGG + Intronic
1033425480 7:141239824-141239846 GTTCACTGCCACAGGTCATGAGG - Intronic
1033551636 7:142452850-142452872 GTCAATAGCCAGGGCTCCTGGGG + Intergenic
1034164613 7:149015839-149015861 GACCACACCCAGGGGTCCTGAGG + Intronic
1035233877 7:157484074-157484096 GCCCACAGTCACGGGACCAGAGG - Intergenic
1035246427 7:157565419-157565441 GTCAACAGCCACAGCTGCTGGGG + Intronic
1035337311 7:158138251-158138273 GCCCACACCCAGGGGTGCTGCGG - Intronic
1035437382 7:158869178-158869200 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035437393 7:158869217-158869239 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035437403 7:158869255-158869277 TGCCACAGCCACGGGCCCAGAGG - Intronic
1036912243 8:12767053-12767075 GTCCACAGCCACCATTCCCGTGG - Intergenic
1039430444 8:37521429-37521451 GCCCACAGCCCTGTGTCCTGGGG + Intergenic
1039615565 8:38952354-38952376 GTCTACAGCCACTGGCTCTGAGG - Intronic
1041804626 8:61836723-61836745 GCACACAGCCCAGGGTCCTGGGG - Intergenic
1044166421 8:88989841-88989863 GTCCCAAGCCACGGGTTTTGAGG + Intergenic
1048198865 8:132354879-132354901 GTATACAGCCACTGGTTCTGGGG + Intronic
1048974957 8:139666098-139666120 GTCACCAGCCATGGGCCCTGTGG + Intronic
1049457402 8:142700647-142700669 CTCCACAGCCACGGGCCGAGAGG + Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1050058548 9:1680662-1680684 GTCCACAGCAGGGGGCCCTGGGG + Intergenic
1056967940 9:91179832-91179854 GGTCACACCCACGGGTTCTGGGG - Intergenic
1057548410 9:96034875-96034897 GTCTACAGCCATGGGTCAGGTGG - Intergenic
1057822200 9:98341310-98341332 GTCCACAGCCACGTGCCTTCTGG - Intronic
1059459954 9:114423395-114423417 GTCCCCAGCCCCGGGGCCTGGGG + Exonic
1061840212 9:133354357-133354379 GTCCTCAGCCACAGGGCCTTGGG + Intronic
1062243211 9:135550627-135550649 GTGCACAGCCAGCGGCCCTGGGG - Intergenic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1191136153 X:57067486-57067508 GTCCACAGACACCAGTCTTGTGG + Intergenic
1194097888 X:89665963-89665985 GTGCACCGCCAGGGGTCCTGAGG - Intergenic
1195803228 X:108735486-108735508 GTCCACAGCGACGGATGCTCAGG + Exonic
1198327316 X:135586600-135586622 GGCAGCAGCCAGGGGTCCTGGGG - Intergenic
1200319912 X:155177267-155177289 GACTCCAGCCACAGGTCCTGTGG - Intergenic
1200450910 Y:3327352-3327374 GTGCACCGCCAGGGGTCCTGAGG - Intergenic