ID: 968918067

View in Genome Browser
Species Human (GRCh38)
Location 4:3505982-3506004
Sequence CTGGGTTTCCAGGTATCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968918067 Original CRISPR CTGGGTTTCCAGGTATCTCT AGG (reversed) Intergenic
900763433 1:4488117-4488139 ATGGGTTTCCAGGTACCTCTTGG - Intergenic
900917257 1:5647470-5647492 CTGGGTGTCCAGGCTTCACTGGG - Intergenic
901185998 1:7373580-7373602 TTGGGTTTCCTGTTGTCTCTTGG - Intronic
901187818 1:7386458-7386480 CTGGGTTTCCAGCCATGGCTGGG + Intronic
901511542 1:9720344-9720366 CTGGGCTACCAGGCATATCTGGG + Intronic
902090777 1:13901507-13901529 TTGGGACTCCAGGTTTCTCTTGG - Intergenic
902965122 1:19995575-19995597 CTGGGGTTCCAGGCACCACTAGG + Intergenic
903342066 1:22660861-22660883 CTGGATTCCCAGGAATCCCTGGG - Exonic
903348749 1:22704820-22704842 CTGGGTTCGCAGGTACCTCCAGG + Intergenic
905331509 1:37203837-37203859 CTGGGTGTACAAATATCTCTTGG - Intergenic
906579586 1:46925432-46925454 CTGGGGTTCCAGGCACCACTAGG + Intergenic
906604136 1:47153454-47153476 TTGGGGTTCCAGGTACCACTAGG - Intergenic
907565603 1:55430682-55430704 CTGGGATTCCAGGTGCCACTGGG - Intergenic
908384552 1:63628457-63628479 CAGGGAATCCAGGTATCTCACGG + Intronic
908598309 1:65711567-65711589 CTGGGGTTCCAGGCACCACTGGG + Intergenic
908611431 1:65865400-65865422 CTGGGGTTCCAGGTGCCTCTGGG + Intronic
909724505 1:78818045-78818067 CAGAGTTCACAGGTATCTCTTGG + Intergenic
910604820 1:89071993-89072015 CTGGGGTTCCAGGTGCCACTAGG - Intergenic
910723121 1:90309511-90309533 GTGGTTTACCAGGTTTCTCTAGG + Intergenic
911632626 1:100200020-100200042 CTGGTGTTCCAGGCATCACTGGG - Intronic
911993524 1:104733607-104733629 CTGCGTTTCCAGGTGTTCCTAGG - Intergenic
912307606 1:108585893-108585915 CTGTATTTCCAAGTATGTCTTGG + Intronic
912387291 1:109277896-109277918 CTGGGATTCCAGGAATCGGTGGG - Intergenic
912675768 1:111679530-111679552 CTGGGGTTCCAGGTGCCACTGGG - Intronic
913021480 1:114792358-114792380 CTGGGGTTCCAGGCACCACTGGG + Intergenic
913525239 1:119685236-119685258 ATGGTTTTCAAGGTCTCTCTGGG + Intronic
914756057 1:150562163-150562185 CTGGGCTTCCAGGAATCGCTGGG - Intergenic
914949624 1:152101274-152101296 CATGTTTTCCATGTATCTCTTGG + Intergenic
914967157 1:152270171-152270193 CTGGGGTTCCAGGTACCACTGGG + Intergenic
914969210 1:152291946-152291968 CTGGGGTTCCAGGTACCACTGGG - Intergenic
915511741 1:156390425-156390447 CTGGATTTCCAGGGATCTCTGGG + Intergenic
917007019 1:170426577-170426599 CTGGGGTTCCAGGCACCACTGGG - Intergenic
917232842 1:172856289-172856311 CTGGGGTTCCAGGTACCACGGGG + Intergenic
917274606 1:173318962-173318984 CTGGGGTTCCAGGCATCACTGGG - Intergenic
918159992 1:181889496-181889518 CTGGGGTTCCAGGCACCACTGGG - Intergenic
918188423 1:182148303-182148325 CTGGGTTTCCAGGTAGGGCTGGG - Intergenic
918360420 1:183751571-183751593 CTGGGGTTCCAGGCACCACTAGG + Intronic
918487864 1:185048082-185048104 CTGGGTCTTCTGGTATTTCTTGG + Intronic
921236924 1:213141686-213141708 CTTGTTTTTCAGGTTTCTCTAGG + Intronic
921484891 1:215703834-215703856 CTGGGGTTCCAGGTGCCACTGGG + Intronic
921626153 1:217379785-217379807 CTGGCATTCCAGGTATCACTGGG - Intergenic
921659298 1:217780143-217780165 CTGGGTTCCCATGTCACTCTAGG + Intronic
922411542 1:225380752-225380774 CTGGGTTTGGAGTCATCTCTGGG - Intronic
922666507 1:227474010-227474032 CTGGCATTCCAGGTACCACTAGG - Intergenic
923200850 1:231709977-231709999 CTGGGATTCCAGGTAGGTCTTGG + Intronic
923232403 1:231999513-231999535 CTGGCTAACCAGGTGTCTCTGGG - Intronic
923621075 1:235579944-235579966 ATGGGTGTGCAGGTATCTGTTGG - Intronic
1062852199 10:753265-753287 CTGGCTTTCCAGGGCTCCCTTGG - Intergenic
1063235832 10:4115441-4115463 CTGGGTTTCCTGTTGTCTTTGGG + Intergenic
1063837708 10:10034794-10034816 CTGGGATTACAGGCATCTTTAGG - Intergenic
1065380545 10:25085820-25085842 CTGAGTTTCCAGATATCTAGAGG + Intergenic
1066333614 10:34452789-34452811 CTCAGTTTCGAGGTATCTTTGGG - Intronic
1067081014 10:43212194-43212216 CTGGCATCCCAGGCATCTCTGGG - Intronic
1068469987 10:57448500-57448522 CTGGTGTTCCAGGTACCACTGGG + Intergenic
1068707222 10:60090387-60090409 CTGGGTTTCCAGTTTTGTATAGG - Intronic
1068918877 10:62462487-62462509 GTGGGATGCCAGGGATCTCTAGG - Intronic
1069718143 10:70533874-70533896 CAGGGTTTCCTGGTCTCACTGGG + Intronic
1070753569 10:78977792-78977814 CTGGGTTTCCAGCTGCCTCCTGG + Intergenic
1070999702 10:80817990-80818012 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1072394718 10:95026802-95026824 CTGGTTTTCCAGGTGCCACTGGG + Intergenic
1072800272 10:98387984-98388006 CTGGGTTTCCAAGGATGACTAGG - Intronic
1073265474 10:102225936-102225958 CTGGGTTTCCCAGGATCTCAGGG + Intergenic
1075210604 10:120487940-120487962 TTGGATTTCCAGGTGCCTCTGGG - Intronic
1075297583 10:121291893-121291915 CTGGGTTTCCACGTGTGTCCTGG - Intergenic
1075609924 10:123844835-123844857 CTGGGTTTCAAGATACCTTTGGG + Intronic
1076307685 10:129476511-129476533 CTGGGTTCCCAGGAATCCCATGG + Intronic
1077428342 11:2498706-2498728 CTGGGGTTCCAGGCACCACTGGG + Intronic
1078686221 11:13534692-13534714 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1078759835 11:14243122-14243144 CTGAGTGTCCAGGTATGTCCTGG - Intronic
1079329307 11:19520767-19520789 GTGTGTCTCCAGGTACCTCTGGG + Intronic
1079564141 11:21860254-21860276 CTGAGTTTCCAGGTTTTTTTAGG + Intergenic
1079799808 11:24854640-24854662 CTGGCATTCCAGGCATCACTGGG + Intronic
1080111614 11:28574446-28574468 ATGGTTTTCCAGGTTTCTCGAGG - Intergenic
1080502627 11:32885266-32885288 CTGGGGTTCCAGGTTTATATGGG - Intergenic
1081252373 11:40851149-40851171 CTGGCTTTCCAGGCGTCACTGGG + Intronic
1083307484 11:61768895-61768917 CTGTGTTTCCAGGAAGCTGTGGG + Intronic
1084309132 11:68306026-68306048 CTGGGGCTCCAGGTATTCCTTGG + Intergenic
1090311710 11:125746958-125746980 CTGGCTTTTCAGGTGTCGCTTGG + Intronic
1090995148 11:131859399-131859421 CTGGGAATCCAGGTGTCTCAAGG + Intronic
1091393688 12:141015-141037 CTGGATTTCCAAGAACCTCTGGG + Intronic
1091582630 12:1798433-1798455 CTGGGTTTCCAGCTCTGGCTGGG - Intronic
1093237351 12:16627799-16627821 ATGGATTTCCACGTTTCTCTAGG + Intergenic
1093714468 12:22366056-22366078 CTGGCATTCCAGGCACCTCTGGG - Intronic
1094061112 12:26316326-26316348 CTGGGCTTCCAAGTACCACTGGG + Intergenic
1094140060 12:27171896-27171918 CTGGTGTTCCAGGCATCCCTGGG + Intergenic
1095606248 12:44071176-44071198 CTGGGTTTCCAAATAGCTCTGGG + Intronic
1095831504 12:46591682-46591704 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1096220784 12:49827409-49827431 CTGGTTTTCCAGGCATCCCAGGG - Intronic
1096805468 12:54138481-54138503 CTTGATCACCAGGTATCTCTGGG - Intergenic
1097498128 12:60368845-60368867 ATGAGTTTGCAGGTATCCCTTGG - Intergenic
1097809046 12:63998648-63998670 CTGGATTTCCAAATATCTCAAGG - Intronic
1098316870 12:69202030-69202052 CTGTGTTTCCAGGTGTTCCTGGG - Intergenic
1098910253 12:76201849-76201871 CTGGGTTTCCATCTGTCTCAGGG - Intergenic
1099053493 12:77809194-77809216 CTGGCTTTCCAGGTGTCACTGGG + Intergenic
1099253748 12:80289917-80289939 CTGGGGTTCCAGGTGCCTCTGGG + Intronic
1099486278 12:83232832-83232854 CTGGCATTCCAGGTACCACTGGG + Intergenic
1101514489 12:105421618-105421640 CTGGGATTACAGGTATAGCTGGG + Intergenic
1101630670 12:106490899-106490921 CTGGGGTTGCAGATATCTATTGG - Intronic
1101878593 12:108611264-108611286 CTGGGTTTCCAGAAATCTTTGGG + Intergenic
1103169188 12:118799162-118799184 CTGGGGTTCCAGGCACCACTGGG + Intergenic
1103705716 12:122870930-122870952 CTGGAGTTCCTGGTATTTCTGGG + Exonic
1104366254 12:128180504-128180526 CAGGCTTTGCAGGAATCTCTTGG + Intergenic
1104675608 12:130710029-130710051 CCTGGTTTCCGGGTATCCCTGGG + Intronic
1105316440 13:19269926-19269948 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1106336620 13:28789207-28789229 CTGGGGTTCCAGGCACCACTGGG + Intergenic
1106378840 13:29216396-29216418 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1106426621 13:29636680-29636702 CTGGCTTTCCAGGTGTCAATGGG + Intergenic
1106650831 13:31688364-31688386 CTGGGATTCCAGGCACCACTGGG - Intergenic
1107396264 13:40021145-40021167 CTGGGTGTGCAAGTATCCCTTGG + Intergenic
1107870737 13:44744382-44744404 CAGGGTGTCCAGCTAGCTCTAGG + Intergenic
1108422701 13:50266921-50266943 CTGGAGTCCCAGGAATCTCTGGG + Intronic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1111091633 13:83453719-83453741 CTGTGTTTCCTGGTGTCTCCAGG + Intergenic
1111787597 13:92809882-92809904 CTAGGTTTACAAGTTTCTCTAGG - Intronic
1112473022 13:99706416-99706438 CTGGGGTTCCAGTTATTTCAAGG + Intronic
1112980511 13:105378927-105378949 ATGGGTTTGCAGGTGTGTCTAGG - Intergenic
1113790743 13:113026741-113026763 CTGGATTTTCTGGTACCTCTGGG - Intronic
1114695516 14:24623736-24623758 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1115339051 14:32272826-32272848 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1115359847 14:32488552-32488574 CTGGGGTTCCAGGCACCACTGGG + Intronic
1115405008 14:33005521-33005543 TTGGGGTTCCAGCTATCTCAGGG - Intronic
1115691052 14:35844208-35844230 CTGGTGTTCCAGGTACCACTGGG + Intronic
1116383966 14:44308261-44308283 CTGGGTTTCCAAATATCTGGTGG + Intergenic
1118516128 14:66530468-66530490 CTGGTGTTCCAGGTACCACTGGG + Intronic
1118839312 14:69499364-69499386 CTGGGTGTCCCTGAATCTCTGGG + Intronic
1120137247 14:80884778-80884800 CTGGGGTTCCAGGCACCACTGGG - Intronic
1120271804 14:82322112-82322134 CTGGGATTCCAGGTGCCACTGGG + Intergenic
1120688909 14:87570569-87570591 ATGGTTTTCCAGCTACCTCTAGG - Intergenic
1121623812 14:95370183-95370205 CTGGCTATCCAGGCTTCTCTAGG - Intergenic
1122829959 14:104391051-104391073 CTGGGGCTCCATGTAGCTCTCGG + Intergenic
1124474707 15:30022908-30022930 CTGGGGTTCCAGGCACCACTGGG + Intergenic
1124732568 15:32211699-32211721 CTCAGTTTTCAGGTTTCTCTGGG - Intergenic
1125178500 15:36853768-36853790 CTGAGGTTCCAGGTATCTATTGG + Intergenic
1125246415 15:37646439-37646461 CTGAGGTTCCATGGATCTCTAGG - Intergenic
1128686119 15:69687013-69687035 CTGGGTTTCCAGGAAGCTCTGGG + Intergenic
1130311347 15:82758177-82758199 CTGGGTTTAGAGGCATCTGTGGG + Exonic
1131766212 15:95678269-95678291 CTGGGTTACCAGTACTCTCTTGG + Intergenic
1134331397 16:13254445-13254467 CTTGGTTGCTAGGTCTCTCTGGG + Intergenic
1138194648 16:55043411-55043433 CTGGGTCTCCAGCCAACTCTTGG + Intergenic
1139597216 16:67965209-67965231 CTGGGTTTTCAGATTTTTCTTGG - Intronic
1143427176 17:6849215-6849237 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1143437927 17:6943068-6943090 CTGGCTTTCCAGGTAACAGTCGG + Intronic
1144371742 17:14597886-14597908 CTGGGGTTCCAGGCATCAATCGG - Intergenic
1145995416 17:29102253-29102275 CTGGGTTCCCAGGCCTATCTTGG - Intronic
1146284821 17:31567267-31567289 CTGGGTTTCCAGGCAGGACTCGG - Intergenic
1146674979 17:34767206-34767228 CTGTGGTTTCAGGTATCTCTGGG - Intergenic
1146675979 17:34774230-34774252 CTAAGTTTCCAGGGATCTCTGGG + Intergenic
1148244663 17:46022715-46022737 CTGTGTTTCCTGGTATCCTTTGG + Intronic
1148403278 17:47386654-47386676 CTGGGATTCCAGGTGCCTCTGGG + Intronic
1148745404 17:49915295-49915317 CTGGGGTTCCAGCTCCCTCTAGG + Intergenic
1148884752 17:50764179-50764201 CTGGGTTTCTTGTTATCACTTGG + Intergenic
1149021044 17:51964834-51964856 CTTGTTTTTCAGGTTTCTCTAGG - Intronic
1149222852 17:54435967-54435989 CTGGCATTCCAGGTACCACTAGG - Intergenic
1149264962 17:54918341-54918363 CTGAGTTCCCAGGGGTCTCTGGG - Intronic
1151070781 17:71208585-71208607 CTGGGTTCCAAGTTGTCTCTAGG - Intergenic
1151385645 17:73753709-73753731 CGGTGGTTCCAGGTATTTCTGGG - Intergenic
1151810019 17:76434217-76434239 CTGGGTTTCCATGTATGTCTAGG - Intronic
1152038988 17:77891068-77891090 CTGGGCTTACAGGCATCCCTGGG - Intergenic
1152378594 17:79930769-79930791 GGGGGTCTCTAGGTATCTCTGGG + Intergenic
1154101579 18:11479453-11479475 CTGGGGTTCCAGGCACCACTGGG + Intergenic
1155247778 18:23926360-23926382 TTGGGTTTCAACATATCTCTTGG - Intronic
1156188409 18:34690166-34690188 CTGGCTTTCCAGGCACCACTGGG + Intronic
1156661383 18:39350620-39350642 TTGGTTTTCAAGGTTTCTCTGGG - Intergenic
1157067328 18:44366972-44366994 CTGGCATTCCAGGTGCCTCTGGG + Intergenic
1157106515 18:44779167-44779189 CTGGGTTTCCAGATATCCACCGG + Intronic
1159127590 18:64242630-64242652 TTGGGGTTGCAGGTATCTCTAGG - Intergenic
1160099099 18:75904066-75904088 CTGCTTCTCCAGTTATCTCTGGG + Intergenic
1160756548 19:760204-760226 CTTGGTGTCCTTGTATCTCTGGG + Intronic
1161040838 19:2110045-2110067 GTGGGTGTCCAGGTGTCCCTAGG - Intronic
1162409781 19:10498729-10498751 CTGGGCTCCCTGGTTTCTCTGGG - Intronic
1163989844 19:20988308-20988330 CTGGGGTTCCAGGTGCCTCTGGG - Intergenic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1164696658 19:30249855-30249877 CTAGGTTTGCAGCTATCTCTTGG - Intronic
1166287294 19:41839120-41839142 CTGGGTATCTAGGTTTCGCTGGG - Intronic
1166971261 19:46569851-46569873 ATGGGGGTGCAGGTATCTCTTGG - Intronic
1168274884 19:55272222-55272244 CCTGGTTTCCTTGTATCTCTGGG - Intronic
926603259 2:14869706-14869728 CTTGGTTTCCACGTCCCTCTTGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928396230 2:30945066-30945088 CTGGGATTGCAGGTTTCCCTAGG + Intronic
928877138 2:36053267-36053289 TGGGGTTTCCAGCTAACTCTGGG - Intergenic
929302525 2:40322195-40322217 CGAGTTTTCCAGGTATCCCTGGG + Intronic
932505833 2:72230907-72230929 CAGGCTTTCCAGGTATGTGTTGG + Intronic
935144224 2:100383601-100383623 ATGACTTTCCAGGTCTCTCTGGG + Intergenic
935961458 2:108429563-108429585 CTGGGGTTCCAGGTGTCACTGGG - Intergenic
936874960 2:117177654-117177676 GTGCTTTCCCAGGTATCTCTTGG - Intergenic
937153695 2:119703279-119703301 CATGGTTTCCAGGGACCTCTTGG + Intergenic
937562690 2:123244880-123244902 CTGGGGTTCCAGGTACCACTGGG - Intergenic
937616891 2:123935057-123935079 GTTGGTTTTCAGGTTTCTCTTGG + Intergenic
938090913 2:128434244-128434266 CTGGATGTCCAGGTGTCTCTGGG + Intergenic
938173008 2:129099009-129099031 CTGTGTTTCCAGGAATATGTAGG + Intergenic
939470628 2:142615824-142615846 CTGGGGTTCCAGATACCACTGGG - Intergenic
940124816 2:150311412-150311434 CTGGGGTTCCAGGCACCACTGGG - Intergenic
940400664 2:153244643-153244665 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
941119559 2:161513306-161513328 CTGGCTTTCCAGGTGCCACTGGG - Intronic
941239422 2:163017644-163017666 CTGGGGTTCCAGGCACCGCTGGG + Intergenic
941518755 2:166511600-166511622 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
942199867 2:173560033-173560055 ATGGCTTTCCAGGTGTCACTGGG - Intergenic
942966297 2:181896602-181896624 CTGGTTTTCCATGAAACTCTTGG + Intronic
943147720 2:184066179-184066201 CTGGGGTTCCAGGCACCACTGGG + Intergenic
943240412 2:185377049-185377071 CTGGGGTTCCAGGCACCACTAGG + Intergenic
943663542 2:190585028-190585050 CTGGTTATCCAGGTTTCTCAGGG - Intergenic
943836788 2:192524592-192524614 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
944764317 2:202849251-202849273 CTGGGGTTCCAGGCACCACTGGG - Intronic
946128092 2:217581972-217581994 TTGTGTGTCCAAGTATCTCTAGG - Intronic
946465943 2:219912298-219912320 CAGGGCTTCCAGATATTTCTGGG - Intergenic
947562611 2:231170554-231170576 CTGTGTTTCCAGCTCTCTATTGG + Exonic
948175752 2:235941427-235941449 CGGAGTTCCCAGGTCTCTCTAGG + Intronic
948566906 2:238893100-238893122 CTGAGTTCCCAGGGATTTCTGGG + Intronic
948991136 2:241554616-241554638 CGGGCTGTCCAGGTAGCTCTGGG - Intergenic
1169514891 20:6304907-6304929 CTTGGTTTCCATATCTCTCTTGG + Intergenic
1170595643 20:17803799-17803821 CTGGGTTTCCTCTTATCCCTAGG - Intergenic
1170761451 20:19254782-19254804 CTGGAGTTCCAGGTTTCTCCAGG + Intronic
1172834851 20:37866647-37866669 CTGGATCTCCATGTAACTCTGGG + Intronic
1173537454 20:43826922-43826944 ACGGGTATACAGGTATCTCTTGG + Intergenic
1173626586 20:44477225-44477247 ATGGGATTGCAGGCATCTCTTGG + Intronic
1173875426 20:46367477-46367499 CAGGGTGTCCAGGTCACTCTTGG + Exonic
1175220799 20:57415302-57415324 CTGGGCTTCCAGATACCTCCTGG + Intergenic
1175727955 20:61332329-61332351 ATGGGTTTCCCGGACTCTCTAGG - Intronic
1178382243 21:32120504-32120526 CTGGATTTCCATTTGTCTCTGGG + Intergenic
1179264911 21:39794852-39794874 CTGAGTTTCCAGGGAGCTCTGGG + Intronic
1181534776 22:23535690-23535712 CTGTGTTTCCTCGTATCTCATGG + Intergenic
1181579408 22:23819282-23819304 CTGGGTGTGCAGGTATCTGTTGG + Intronic
1183109498 22:35638533-35638555 CCGGGTTTCCAAGACTCTCTGGG + Intergenic
949226940 3:1705803-1705825 CTGGTTTTCCAGGCCTCACTGGG - Intergenic
949849122 3:8404089-8404111 CTGTCTTTAGAGGTATCTCTGGG + Intergenic
950437024 3:12986283-12986305 CTGGGGCTCCAGGGAACTCTAGG - Intronic
951415160 3:22414560-22414582 CTGGGGTTCCAGGCACCACTGGG + Intergenic
951694714 3:25434140-25434162 CAGGGATTCCAGGAGTCTCTAGG + Intronic
955510894 3:59679371-59679393 CTAGGTTTCCAGGTGTTTCTAGG + Intergenic
956157366 3:66312504-66312526 CTGGGGTTCCAGGTGTCACTGGG + Intronic
958919030 3:100082495-100082517 ATTCGTTTCCAGGAATCTCTTGG + Intronic
959332194 3:105020656-105020678 CTGGGTGTTCAGGTATTTATGGG - Intergenic
959345607 3:105191190-105191212 CTGGGGTTCCAGGCACCACTGGG + Intergenic
960022535 3:112971394-112971416 CTGTATTTCCAAGTATCTGTAGG + Intronic
960843571 3:121986045-121986067 CTGGGTTGCCAAGTGTCTCTTGG + Intergenic
961162438 3:124740417-124740439 CTGGGTCTCAAAGTTTCTCTTGG - Intronic
961380101 3:126491489-126491511 CTGGGCTTCCAGGAAGCACTGGG + Intronic
961470859 3:127111092-127111114 CTAGGTTTTCAGGTTTCTTTGGG - Intergenic
962634811 3:137319608-137319630 CTGGCATTCCAGGTACCACTGGG + Intergenic
964049506 3:152373313-152373335 CTGGCCTTCCAGGTGTCACTGGG + Intronic
964649128 3:158991582-158991604 CTGGCCTTCCAGGTAACACTGGG + Intronic
965091094 3:164163433-164163455 CTGGCATTCCAGGCATCACTGGG + Intergenic
965801337 3:172496934-172496956 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
966309376 3:178576461-178576483 CTGGTTTTCCAGGCACCACTGGG - Intronic
966585810 3:181622993-181623015 CTAAGTTTCCATGTCTCTCTAGG - Intergenic
967181532 3:186909558-186909580 CTGGCATTCCAGGTGCCTCTGGG + Intergenic
967312130 3:188116256-188116278 CTGGGTTTCCATGTGTCTGAAGG + Intergenic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
969164846 4:5298810-5298832 CTGGGGTTCCAGGTGCCACTGGG + Intronic
969587351 4:8102050-8102072 GTAGGTTTCCATGGATCTCTGGG - Intronic
969634350 4:8357909-8357931 CTGGTTTTTCAGGTTTCTTTGGG - Intergenic
970679338 4:18489287-18489309 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
971345886 4:25811141-25811163 TTGGGTTTACAGGTACCTCGTGG + Intronic
971589054 4:28443548-28443570 CTGGCTTTCCAGGCATCTTTTGG - Intergenic
972260996 4:37408147-37408169 CTGGGGTTCCAGGCACCACTGGG - Intronic
973567995 4:52207713-52207735 CTGGCTTTCCAGGTGCCACTGGG - Intergenic
973629074 4:52802077-52802099 CTGGGGTTCCAGGCACCACTGGG - Intergenic
973715253 4:53669838-53669860 CTGGCTTTCCAGGTGCCACTGGG + Intronic
973813506 4:54596467-54596489 ATGGGTATGCAGATATCTCTTGG - Intergenic
974420445 4:61665486-61665508 CTGAATTTCCAGGTATTACTTGG - Intronic
974599531 4:64059242-64059264 CTGGGTTTCTCTGTATTTCTTGG + Intergenic
975227486 4:71891529-71891551 CTGGGATTCCAGGTGCCACTGGG - Intergenic
975346732 4:73300248-73300270 ATGGGAATGCAGGTATCTCTTGG - Intergenic
976194443 4:82519346-82519368 CTGAGATTTCAGGCATCTCTTGG - Intronic
976669474 4:87636336-87636358 CTGGGGTTCCAGGTGTCACTGGG - Intergenic
977185685 4:93932820-93932842 CTGGCATTCCAGGTGTCACTGGG + Intergenic
977415176 4:96723426-96723448 CTGGGGTTTCAGGTATCTTAAGG + Intergenic
977897847 4:102384345-102384367 CTGGGGTTCCAGGCACCACTGGG + Intronic
978078912 4:104568172-104568194 CTGGCGTTCCAGGTGTCACTGGG + Intergenic
979998743 4:127464175-127464197 CTGGCGTTCCAGGTGTCACTGGG + Intergenic
980508483 4:133755106-133755128 CTAGGATTCCAGGTATTTTTTGG + Intergenic
980769297 4:137350997-137351019 CTGGGGTTCCAGGCACCACTAGG - Intergenic
980985591 4:139691563-139691585 ATGGGATTCCAGGTATTTCAAGG + Intronic
981134015 4:141189919-141189941 CTGGGGTTCCAGGTGCCACTGGG + Intronic
981603433 4:146518003-146518025 CTGGGTCACCACATATCTCTAGG - Intronic
982825704 4:160001772-160001794 CTGGCATTCCAGGTACCACTGGG - Intergenic
982918968 4:161250170-161250192 CTGGGTTCCCAGCTGTCACTGGG + Intergenic
983485929 4:168331385-168331407 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
984601608 4:181733651-181733673 CTGAGTATCCAAGTATCTCATGG + Intergenic
985317379 4:188672592-188672614 CTGGGGTTCCAGGCACCACTGGG - Intergenic
985963532 5:3322046-3322068 CTGGCTTTCCACGTGTCCCTCGG + Intergenic
986257141 5:6109853-6109875 TTGGGATTTCAGGTAGCTCTAGG - Intergenic
986333980 5:6739344-6739366 TTGGGTATCCAGGAATCTCTGGG + Intronic
986358513 5:6952215-6952237 CTGGGGTTCCAGGCACCACTGGG - Intergenic
986664945 5:10093707-10093729 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
987658660 5:20842972-20842994 ATGGATTTCCAGGTATATCAGGG + Intergenic
987692357 5:21283413-21283435 CTGCGTTTCCAGGTGTTCCTGGG + Intergenic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
988731612 5:33978088-33978110 CTAGGTTTTCAGGTTTCTTTGGG - Intronic
988765023 5:34362962-34362984 ATGGATTTCCAGGTATATCAGGG - Intergenic
988774949 5:34469214-34469236 CTGGGGTTCCAGGCACCACTGGG - Intergenic
988970755 5:36465353-36465375 CTGGGTTTCCAGGTGACACTGGG - Intergenic
989958850 5:50387154-50387176 CTGGATTTCCAGGTGCCACTGGG - Intergenic
990098828 5:52156761-52156783 CTGGGTTTCCAGTCACCACTGGG - Intergenic
991110774 5:62896857-62896879 CTGGGGTTCCAGGCACCACTGGG + Intergenic
991748000 5:69766637-69766659 CTGCGTTTCCAGGTGTTCCTGGG - Intergenic
991799577 5:70346485-70346507 CTGCGTTTCCAGGTGTTCCTGGG - Intergenic
991829020 5:70663553-70663575 CTGCGTTTCCAGGTGTTCCTGGG + Intergenic
991891936 5:71345914-71345936 CTGCGTTTCCAGGTGTTCCTGGG - Intergenic
992383879 5:76265471-76265493 CTGGGGTTCCAGGTGCCACTGGG + Intronic
992908678 5:81373487-81373509 CTGGTGTTCCAGGTACCACTGGG - Intronic
993073454 5:83195790-83195812 CTGGGTTTTCAACTTTCTCTAGG - Exonic
993119114 5:83753688-83753710 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
993145278 5:84086184-84086206 CTGGGATTCCAGGCACCGCTAGG + Intronic
993390209 5:87311689-87311711 CTTGGTGTCCAGGGATCTTTTGG + Intronic
993601974 5:89937436-89937458 CTGGGTTTCAACATATTTCTTGG + Intergenic
993923968 5:93842708-93842730 ACAGGATTCCAGGTATCTCTGGG + Intronic
994015014 5:94955385-94955407 CTGGCATTCCAGGTACCACTGGG - Intronic
994026711 5:95092920-95092942 CTGGTCTTCCAGGTATCTTAAGG + Intronic
994641931 5:102421240-102421262 CTGGGGTTCCAGGTGCCACTGGG - Intronic
995301888 5:110594425-110594447 CTGGGGTTCCAGGCACCACTGGG - Intronic
995658170 5:114450329-114450351 CTGGGGTTCCAGTTTCCTCTTGG + Intronic
995790686 5:115883225-115883247 CTGGTGTTCCAGGTGCCTCTAGG + Intronic
997252253 5:132398245-132398267 CTGGTGTTCCAGGCATCACTGGG - Intergenic
997299158 5:132789762-132789784 CAGGATTTCCAGGCAGCTCTGGG - Intronic
997417173 5:133738021-133738043 CAGGGTTATCAGGTAGCTCTTGG + Intergenic
997675036 5:135706643-135706665 CTGGGCATCCAGGCAGCTCTAGG - Intergenic
997897444 5:137732327-137732349 CTAGATTTCCAGGTCTCTCCTGG - Intronic
998110758 5:139500792-139500814 CTGGGATTACAGGTGTGTCTAGG + Intergenic
998859713 5:146430306-146430328 CTGGGGTCCCAGCTATTTCTTGG - Intergenic
999084552 5:148875548-148875570 CTGGGTTTCCCCCCATCTCTGGG - Intergenic
999468634 5:151831268-151831290 CTGGGGTTCCAGGTGCCACTGGG - Intronic
999602561 5:153283018-153283040 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1000417508 5:160998264-160998286 CTGGCTTTCCAGGTGCCACTGGG + Intergenic
1001147472 5:169197329-169197351 CTGTATTTCCAGGTAACTCCAGG + Intronic
1001547862 5:172581586-172581608 CTTGGTTTCCAGCAACCTCTAGG - Intergenic
1002673502 5:180889818-180889840 CTGGCATTCCAGGTACCACTGGG - Intergenic
1005778391 6:29162051-29162073 CTGGGGTTCCAGGCATCACTAGG + Intergenic
1007109231 6:39303544-39303566 CTGGGGTTCCAGGAGTCTCCCGG + Intronic
1007278229 6:40691245-40691267 CTTGGTTTCCAGGTCTGACTGGG - Intergenic
1007285013 6:40741355-40741377 TTGGGTCTCCAAGTACCTCTTGG - Intergenic
1007858104 6:44879044-44879066 CTGGCATTCCAGGTGTCACTGGG - Intronic
1007864316 6:44951615-44951637 CTGGATTTCCTGGGCTCTCTGGG - Intronic
1009455235 6:63848802-63848824 CTGGGGTTCCAGGTGCCACTGGG - Intronic
1009458728 6:63887776-63887798 CTGGGGTTCCAGGTACCACTGGG - Intronic
1009488662 6:64259116-64259138 CTGCTCTTCCAGGTATATCTAGG + Intronic
1009570151 6:65374521-65374543 CTGGAGTTCCAGGTATCAGTGGG - Intronic
1009718289 6:67428399-67428421 CTGGGTTTCCAGATGCCACTGGG + Intergenic
1009795301 6:68458455-68458477 CTCAGTTTCAAGGTTTCTCTGGG - Intergenic
1009797811 6:68494874-68494896 CTGGGGTTCCAGGTGCCTCTGGG - Intergenic
1009959544 6:70501515-70501537 CTGGGGTTCCAGGCACCACTGGG + Intronic
1012043379 6:94238801-94238823 CTGGCATTCCAGGTGTCACTGGG - Intergenic
1012905373 6:105058375-105058397 CAGGGTTTCCAGCTTTCTGTGGG + Intronic
1012922452 6:105234025-105234047 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1012967486 6:105690349-105690371 CTGGACCTCCAGGTATCTATAGG + Intergenic
1013388280 6:109654846-109654868 CTTGCTTTCCTTGTATCTCTTGG + Intronic
1014223578 6:118823128-118823150 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1015108883 6:129569098-129569120 CTGGCGTTCCAGGCATCACTGGG - Intergenic
1016698408 6:147025649-147025671 CTGTGTTTCCAAGTATCACCTGG + Intergenic
1019786706 7:2981727-2981749 TTGGGTCTCCAGGAAGCTCTGGG + Intronic
1019787112 7:2984051-2984073 TTGGGTCTCCAGGAAGCTCTGGG + Intronic
1021051871 7:15995282-15995304 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1021281817 7:18728992-18729014 CTGGGTTTTCCGGAATATCTGGG - Intronic
1021347697 7:19548264-19548286 CTGGAATTCCAGGTACCACTGGG + Intergenic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1022195344 7:28060861-28060883 CTGGGTTTCCAAATTTCACTTGG + Intronic
1023653192 7:42391604-42391626 CAGGGTTTCCAGTTCTCTCTTGG + Intergenic
1023731218 7:43194161-43194183 CTGGTTTTTCAGGTTTCTTTGGG + Intronic
1023894276 7:44419053-44419075 CTGGGGTTCCAGGTGCCACTGGG - Intronic
1024017686 7:45332951-45332973 CTGGAGTTCCAGGCATCACTGGG - Intergenic
1026205900 7:68257152-68257174 CTGGGTTTCTAGGGATATTTTGG - Intergenic
1026553166 7:71385189-71385211 CTGGGTTTCTCGGTATCGCTTGG - Intronic
1027532992 7:79358699-79358721 CTAGGCTTCCAAGTATCACTAGG - Intronic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1028444711 7:90908396-90908418 CTGGGTTTTAACGGATCTCTAGG - Intronic
1030422025 7:109319119-109319141 GTGGGTGTGCAGATATCTCTTGG - Intergenic
1031253875 7:119422443-119422465 ATTGGTTTCCAGATCTCTCTTGG - Intergenic
1033617629 7:143032133-143032155 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1034286455 7:149886477-149886499 CTGCTTTTCCAGGAATATCTTGG - Intergenic
1034372939 7:150615988-150616010 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1034715140 7:153235017-153235039 CTGGCATTCCAGGTACCACTGGG + Intergenic
1035667939 8:1392655-1392677 CTGGGCCTCCATGCATCTCTGGG + Intergenic
1037292011 8:17360980-17361002 GTGGATTTCCAGGTCTCTCTTGG - Intronic
1037387232 8:18356433-18356455 TTGTGTTTTCAGGTTTCTCTAGG + Intergenic
1037390976 8:18391458-18391480 TTAGTTTTCCAGGTTTCTCTGGG - Intronic
1038196372 8:25372058-25372080 CTAGGTTCCCAGGTTCCTCTAGG + Intronic
1039420028 8:37429853-37429875 CATGGTTTCCAGCTATCTATTGG - Intergenic
1041043798 8:53872733-53872755 TTGAGTTTGCAGCTATCTCTTGG - Intronic
1041589038 8:59555265-59555287 CTGTCTTTAAAGGTATCTCTAGG - Intergenic
1042110891 8:65380055-65380077 CTGGCATTCCAGGTACCACTAGG - Intergenic
1042411905 8:68475768-68475790 CAGGGTTTCCAGTGTTCTCTGGG + Intronic
1042627193 8:70770933-70770955 CTGGGGTTCCAGGCACCACTGGG + Intronic
1043036706 8:75208344-75208366 CTAGGGTTCCAGGTACCACTGGG + Intergenic
1043253698 8:78106614-78106636 CTGGGATTCCAGGCACCACTGGG + Intergenic
1044940286 8:97335161-97335183 CTGGCTTTCCAGGTGTCACTGGG + Intergenic
1045325067 8:101111930-101111952 CCCTGTTTCCAGGTATCTCTTGG - Intergenic
1046042279 8:108920203-108920225 CTGGGTTTCCTGTATTCTCTTGG + Intergenic
1047121268 8:121908039-121908061 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1047308939 8:123676277-123676299 CTGGCTGTCCAGGGATCTCTTGG + Intergenic
1048461706 8:134626597-134626619 CTGGGATTCCACGGATCTCTGGG + Intronic
1049860766 8:144897020-144897042 CTGGCTTTCCAGTTTTCTTTAGG + Intronic
1050031730 9:1393495-1393517 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1050269687 9:3929387-3929409 CTGGGATTTCAGGTTTTTCTTGG + Intronic
1050624159 9:7485930-7485952 CTTGATTTCCACGTATCACTGGG + Intergenic
1050746203 9:8879130-8879152 CTGGGTCCCCAAGTATCTATAGG + Intronic
1051134241 9:13900196-13900218 CTGGGCTTCCAGGTCACCCTGGG - Intergenic
1055339010 9:75261974-75261996 CTGGGGTTCCAGGTGGCACTGGG + Intergenic
1055823919 9:80301302-80301324 CTGGGGTTCCAGGCACCACTGGG + Intergenic
1056302665 9:85258170-85258192 CTGGTTTTCCAGGCACCACTGGG + Intergenic
1056703826 9:88934562-88934584 CTGTGGTTCCAGGTGTCCCTGGG - Intergenic
1056717162 9:89041638-89041660 CCGTGTTTCCACGGATCTCTAGG - Intronic
1057171993 9:92968537-92968559 CTGGGCTTCCAGGCACCGCTAGG + Intronic
1058034619 9:100237379-100237401 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1058265763 9:102897541-102897563 CTGGGGTTCCAGATATGACTGGG - Intergenic
1061702046 9:132423345-132423367 CTGGGTTTCCAGGAGGCTCCTGG + Intronic
1062341245 9:136094836-136094858 CTGGGTTTCCCTGGATTTCTGGG - Intronic
1185543930 X:926562-926584 CTGGGGCTCCAGGTGTCCCTGGG + Intergenic
1186326395 X:8482086-8482108 CTGAGTTGCCAGGGATGTCTTGG + Intergenic
1186495076 X:10006640-10006662 CTGGGTTTGGTGGGATCTCTGGG + Intergenic
1186774892 X:12854785-12854807 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1186823360 X:13313816-13313838 CTGTTTCTCCAGGTATCCCTCGG + Intergenic
1190995720 X:55606514-55606536 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1191174199 X:57482277-57482299 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1191802680 X:65098850-65098872 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1191908984 X:66127242-66127264 CTGGGCTTCCAGGCACCACTGGG + Intergenic
1192030675 X:67509308-67509330 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1192226590 X:69232445-69232467 CTGGGTTTCCAGGTAAGAGTTGG - Intergenic
1192524520 X:71830084-71830106 CTGGCATTCCAGGTGCCTCTGGG - Intergenic
1192759224 X:74078073-74078095 CTGGGGTTCCAGGCACCACTAGG + Intergenic
1192766072 X:74140742-74140764 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1192884304 X:75320573-75320595 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1193113800 X:77756368-77756390 CTGGGGTTCCAGGCACCACTGGG + Intronic
1193404447 X:81084041-81084063 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1193514358 X:82445716-82445738 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1193571639 X:83151790-83151812 CTGGGGTTCCAGGCACCACTGGG - Intergenic
1193645670 X:84066228-84066250 CTGGGATTCCAGGCACCACTGGG - Intronic
1194315320 X:92369534-92369556 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1194499385 X:94660865-94660887 CAGGGTTACCAGGTATCACCTGG - Intergenic
1194852448 X:98886387-98886409 CTGGGTTAAAAGGTATTTCTGGG - Intergenic
1194954450 X:100162596-100162618 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1195127468 X:101822548-101822570 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1195710320 X:107768077-107768099 ATGGCTTTACAGTTATCTCTAGG + Intronic
1195844271 X:109209312-109209334 CTGGGGTTCCAGGCACCACTAGG + Intergenic
1196476477 X:116092212-116092234 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1196545760 X:116962596-116962618 CTGGCTTTCCAGGTGCCACTGGG + Intergenic
1197474765 X:126907768-126907790 CTGGTTTTCTAGTTATCTTTTGG - Intergenic
1197836281 X:130697211-130697233 CTAGGTGTCCAGGTATATATAGG - Intronic
1198645528 X:138802111-138802133 CTGGGTTTCCAGGTATCACTGGG + Intronic
1198753509 X:139959035-139959057 CTGGGCTTCCAGGTGCCACTGGG - Intronic
1198784512 X:140272920-140272942 CTGGGGTTCCAGGTGCCACTGGG + Intergenic
1199219772 X:145304779-145304801 CTGGGGTTCCCTGTATTTCTTGG + Intergenic
1199452245 X:147990012-147990034 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1199559308 X:149146319-149146341 GTGATTTTCCAGGTCTCTCTTGG - Intergenic
1200623368 Y:5481069-5481091 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1200953945 Y:8927165-8927187 CTGGGTTTCCAGGTGTGTTCAGG + Intergenic
1201236959 Y:11921195-11921217 TGGGGTTTCCAGGTGTCCCTAGG - Intergenic
1201237432 Y:11924564-11924586 TGGGGGCTCCAGGTATCTCTAGG - Intergenic
1201854038 Y:18521116-18521138 CTGGGGTTCCAGGTGCCACTGGG - Intergenic
1201879283 Y:18799268-18799290 CTGGGGTTCCAGGTGCCACTGGG + Intronic
1202096323 Y:21251312-21251334 CTGGGGTTCCAGGTTCCACTGGG + Intergenic
1202107556 Y:21386087-21386109 CTGGGCTTCCAGGTATGTTCAGG - Intronic
1202195962 Y:22298295-22298317 CTGGGCTTCCAGGTGTGTCCGGG - Intergenic