ID: 968919408

View in Genome Browser
Species Human (GRCh38)
Location 4:3514978-3515000
Sequence GTTCACCCGGGACCACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968919408_968919417 12 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919417 4:3515013-3515035 AAAGGACGGCGCCATACCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 23
968919408_968919423 29 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919423 4:3515030-3515052 CCGGGGCAGGACAGGCCTTGCGG 0: 1
1: 1
2: 3
3: 32
4: 296
968919408_968919413 -2 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919413 4:3514999-3515021 ACTGCAAGGACGCCAAAGGACGG 0: 1
1: 0
2: 0
3: 11
4: 111
968919408_968919419 21 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919419 4:3515022-3515044 CGCCATACCCGGGGCAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 69
968919408_968919416 11 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919416 4:3515012-3515034 CAAAGGACGGCGCCATACCCGGG 0: 1
1: 0
2: 0
3: 4
4: 31
968919408_968919415 10 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919415 4:3515011-3515033 CCAAAGGACGGCGCCATACCCGG 0: 1
1: 0
2: 0
3: 1
4: 40
968919408_968919412 -6 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919412 4:3514995-3515017 GTGAACTGCAAGGACGCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 76
968919408_968919418 16 Left 968919408 4:3514978-3515000 CCATCTTGTGGTCCCGGGTGAAC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 968919418 4:3515017-3515039 GACGGCGCCATACCCGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968919408 Original CRISPR GTTCACCCGGGACCACAAGA TGG (reversed) Intronic
900482827 1:2907630-2907652 ACTCACCTGGGACCACATGAGGG + Intergenic
901673178 1:10867537-10867559 GCGAACCCGGGAGCACAAGAAGG - Intergenic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
910067861 1:83174923-83174945 GTTCACCTGGGGCAACAAGATGG + Intergenic
918954600 1:191189303-191189325 GTTCACCCTGAACCTCAAAATGG - Intergenic
920096083 1:203487532-203487554 GTTCACCCTGGAACAGAAGGGGG - Exonic
1070510727 10:77158418-77158440 GTGCAGCCTGGACCACAAGGAGG + Intronic
1077274826 11:1699696-1699718 GTCCTCCAGGGACCACAAGGTGG + Intergenic
1082189143 11:49221289-49221311 GTTTACGCTGGACCACAAGGGGG - Intergenic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1086677378 11:89625399-89625421 GTTTACGCTGGACCACAAGGGGG + Intergenic
1089082981 11:115792947-115792969 GTTCAACTGTGACCACAGGATGG - Intergenic
1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG + Intronic
1097533285 12:60833409-60833431 CTTCAGCCTGGACAACAAGAGGG - Intergenic
1103165685 12:118768471-118768493 CTTCAGCCGGGACCCCAGGATGG - Intergenic
1104059068 12:125252597-125252619 GTTCACCCGGAACCCCTAGAAGG + Intronic
1104268767 12:127263149-127263171 GTCCACCTGGGACCACACAAAGG - Intergenic
1105067024 12:133209857-133209879 GATCACCCTGGATCCCAAGAGGG - Intergenic
1113009737 13:105750285-105750307 GGACACCTGGGACCACCAGAAGG + Intergenic
1121733462 14:96202347-96202369 GTTCAGCAAGGACCACAGGAGGG - Intergenic
1124403913 15:29377294-29377316 GTTTCCCAGGGACCACAAAATGG - Intronic
1135404033 16:22185340-22185362 GTTCACCAGGGAACACATGCAGG + Intronic
1137060606 16:35789232-35789254 CCTCACCTGGGAGCACAAGAGGG + Intergenic
1137688349 16:50402438-50402460 GTTCACTCAGGGCCACAGGAGGG - Intergenic
1139148035 16:64345862-64345884 GTTCTCAGGGGACCAGAAGAGGG - Intergenic
1139636565 16:68261718-68261740 ATACACCAGGGGCCACAAGAGGG + Intergenic
1140995833 16:80258840-80258862 TTTCACCCCAGACAACAAGAGGG + Intergenic
1143402379 17:6655000-6655022 GGTGCCCCGGGACCGCAAGAGGG - Intergenic
1146239472 17:31204644-31204666 GTGCACCTGGTACCACAATACGG + Intronic
1147260476 17:39207128-39207150 TTCCACCCTGGACCAGAAGATGG + Intergenic
1160795385 19:942874-942896 GTCCACCCAGAACCTCAAGATGG + Intronic
1162332506 19:10038934-10038956 GTTCACTGTGAACCACAAGATGG + Intergenic
1165658305 19:37551916-37551938 GCACACTTGGGACCACAAGAGGG - Intronic
1165716591 19:38049771-38049793 GTTCCCCCGAGAGCACAGGAGGG + Intronic
1167263290 19:48470648-48470670 GTTCAACATGGACCCCAAGAAGG + Exonic
1167908252 19:52680145-52680167 CTCCACCCTGGACAACAAGAGGG + Intronic
1168102338 19:54147997-54148019 GGTCACCCAGGTCCCCAAGAGGG + Intronic
929956858 2:46464642-46464664 GTTAAGCGGGGACCACAAGGGGG + Intronic
930401941 2:50901167-50901189 GTTCCCCTGAGCCCACAAGAGGG + Intronic
933815541 2:86065369-86065391 TTTCACCCGGGAGCACTATATGG - Exonic
941165937 2:162083012-162083034 GTTCAACCTGGAACACAAGCAGG - Intergenic
1170629271 20:18054416-18054438 GGGCTCCCAGGACCACAAGAAGG - Intronic
1171127039 20:22611385-22611407 GTTCACCAGGGAACTTAAGAGGG - Intergenic
1172605289 20:36209787-36209809 GTTCTCCCGGGATCTCAACAAGG + Exonic
1183650270 22:39149608-39149630 TTTCCCCCTGGACCACAGGAGGG - Intronic
1183904313 22:41028577-41028599 CTACAGCCTGGACCACAAGAGGG + Intergenic
1184090026 22:42288058-42288080 GTTCTCCTGGGAGCTCAAGAGGG - Intronic
950889065 3:16387207-16387229 GTCCACCCAGGGCCACAAGGAGG + Intronic
954139712 3:48598617-48598639 GTCCACCAGGGACCACCAGGGGG + Intergenic
968919408 4:3514978-3515000 GTTCACCCGGGACCACAAGATGG - Intronic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
970585507 4:17511103-17511125 GTTCCCCTGGGACCAGAAAAAGG - Intronic
977340338 4:95749818-95749840 GTTCTCCAGGGAGCACCAGAAGG - Intergenic
978158810 4:105521002-105521024 AATCACCCGACACCACAAGAGGG + Intergenic
982464401 4:155712501-155712523 GATCATCCTGGACCACAAGAAGG - Intronic
989258477 5:39392595-39392617 TTTCATCCGGGACAGCAAGACGG + Intronic
1015631407 6:135235647-135235669 ATTCATCCGGGACCCCCAGAGGG + Intergenic
1024323692 7:48092489-48092511 GTTCACCAGGGGCCAAATGAAGG - Intronic
1027276234 7:76559839-76559861 GTTCACCCGGGGCAACAAGATGG - Intergenic
1029539289 7:101173337-101173359 GCTCACCCGGGACGACCAGCTGG - Exonic
1029736618 7:102468992-102469014 GGTCATCCGAGCCCACAAGAAGG + Exonic
1059921657 9:119167227-119167249 GTTTCCCCGGGGCCACAGGAGGG + Exonic
1061654656 9:132079637-132079659 GGTCAACCGGGACCTCAAGTAGG - Exonic
1186635959 X:11405232-11405254 GGTCACCTGGGACCTCAAGGTGG - Intronic
1186636360 X:11409374-11409396 GTTCACTCAGGAGCACAAGCAGG + Intronic
1186889984 X:13950427-13950449 GTTTGCCAGGGACCAGAAGAGGG - Intergenic