ID: 968919699

View in Genome Browser
Species Human (GRCh38)
Location 4:3516124-3516146
Sequence CCTCCAGCTCCTTGTCCGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968919695_968919699 -9 Left 968919695 4:3516110-3516132 CCTTACCCGGAACGCCTCCAGCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG 0: 1
1: 0
2: 0
3: 31
4: 229
968919694_968919699 -1 Left 968919694 4:3516102-3516124 CCGTGTTTCCTTACCCGGAACGC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG 0: 1
1: 0
2: 0
3: 31
4: 229
968919690_968919699 26 Left 968919690 4:3516075-3516097 CCACAGGAGAGAGCTAGAAGGAG 0: 1
1: 0
2: 2
3: 27
4: 389
Right 968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG 0: 1
1: 0
2: 0
3: 31
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968919699 Original CRISPR CCTCCAGCTCCTTGTCCGTG AGG Exonic
900015186 1:143855-143877 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
900045454 1:502464-502486 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
900067652 1:744194-744216 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
900207776 1:1438942-1438964 CCAGCAGCTCCTTGGCCGCGGGG + Intronic
900397207 1:2458000-2458022 CCACCAGCCCCTTGCCTGTGCGG - Intronic
900644039 1:3700930-3700952 CCTCCAGCTCCTGGCCGGTGAGG + Intronic
901142033 1:7041204-7041226 GCTCCAGCTCCGGGGCCGTGTGG - Intronic
903949085 1:26983853-26983875 CTTCCAGCTCCTTGACATTGTGG - Intergenic
904349518 1:29895842-29895864 CCTCCAGCTCCATGACCACGCGG - Intergenic
907296868 1:53461068-53461090 CCTCAAGGACCTTGTCCTTGTGG + Intronic
907518576 1:55008583-55008605 AACCCAGCTCCTTGTCCGGGAGG - Exonic
909743855 1:79067984-79068006 CCTCCCTCTCCTTGTCAGTTAGG + Intergenic
912474029 1:109924455-109924477 CCTCCAGCTCCCTGCCCGTCTGG - Intronic
916661918 1:166930124-166930146 CCTCCAGCTGCTTCTCAGGGTGG - Intronic
917711471 1:177689334-177689356 CCTCCAGCCCCTGGTCCTGGTGG + Intergenic
918433307 1:184484560-184484582 CCTCCAGCTCCTTGGCCATCTGG - Intronic
918484731 1:185017090-185017112 CCATCAGCTGCTTGTCCTTGTGG - Intergenic
920097536 1:203496332-203496354 CCTCCACCTCTTTCTCTGTGAGG + Intronic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
922103015 1:222489588-222489610 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
922263336 1:223962076-223962098 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG + Intronic
924345176 1:243067090-243067112 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1062823155 10:549662-549684 CCTCCAGCACCTGGTCGGGGGGG - Intronic
1063888405 10:10603323-10603345 CCTCCAGTTCATTGTCCTTTTGG - Intergenic
1066731160 10:38437719-38437741 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1070843850 10:79506495-79506517 CCTGCAGCTCCTTGTCCTCCCGG - Intergenic
1071346378 10:84697885-84697907 GCTCCAGCTCCCTGTCTCTGGGG - Intergenic
1071564922 10:86666858-86666880 CCCCCAGCTCCCTGGCCCTGAGG + Intergenic
1071573706 10:86711462-86711484 CCTCCACCTCCCTCTCCGGGAGG + Intronic
1071953735 10:90734453-90734475 CCTCCAGCTCCTGGTCTTTGTGG - Intergenic
1075577217 10:123586015-123586037 TCTCCAGCTCCCTGGCTGTGTGG - Intergenic
1076002100 10:126920419-126920441 CTTCCAGCTCCTAGTCATTGTGG + Intronic
1076804074 10:132846513-132846535 CCAGCAGGTCCCTGTCCGTGTGG - Intronic
1076804091 10:132846592-132846614 CCAGCAGGTCCCTGTCCGTGTGG - Intronic
1076971780 11:138955-138977 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1077048896 11:557979-558001 CCTCCATCTCCTGGAGCGTGCGG + Exonic
1077429109 11:2507188-2507210 CATTTAGCTCCTTGTCCGTTTGG + Intronic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1078886263 11:15503196-15503218 CCTCCTTCTCCTTATCAGTGTGG + Intergenic
1082130531 11:48483483-48483505 CTTCCAGCTCCTTTTGAGTGAGG + Intergenic
1082564033 11:54654386-54654408 CTTCCAGCTCTTTGTGAGTGAGG + Intergenic
1082997054 11:59263036-59263058 CCTCAAGATCAGTGTCCGTGAGG + Intergenic
1083198836 11:61107260-61107282 CCTCCAGCTGCAGGTCAGTGGGG + Intronic
1083937452 11:65877499-65877521 CCTCCAGTTCCTTTTCCCCGTGG + Intergenic
1084287403 11:68141119-68141141 CCTCCTGCTCCTCATGCGTGTGG - Intergenic
1085406684 11:76267354-76267376 TCTCCAGCTCCTCTTCCTTGTGG + Intergenic
1086421199 11:86639209-86639231 CCTCCAGCTCCTTTTCAGACAGG - Intronic
1088986514 11:114914044-114914066 CATCCAGCACCTTGTTCCTGGGG + Intergenic
1091446174 12:545442-545464 CCTCCAGCTGCTGGCCAGTGTGG + Exonic
1092172997 12:6384877-6384899 CCTCCGGCTCCCTCTCAGTGAGG - Intronic
1096460755 12:51820541-51820563 CCTCCAGGTCCTTGTAGGAGAGG + Intergenic
1096611591 12:52805567-52805589 CCTCCAGCCCTGTGTCCATGGGG - Intergenic
1101526768 12:105538250-105538272 CATCCAGAACCTTGTCCCTGGGG - Intergenic
1101811646 12:108112827-108112849 ACCCCAGGTCCTTGTCCCTGGGG - Intergenic
1101837244 12:108304153-108304175 CCTCCAGCTCCTTCCCTGTAGGG + Intronic
1102183444 12:110930081-110930103 CCTCCACTTCCTTGACTGTGGGG + Intergenic
1104893407 12:132150839-132150861 TCTCCAGCTTTGTGTCCGTGGGG + Intronic
1105780656 13:23702705-23702727 CCTCCATCCCCTTGTTCCTGTGG - Intergenic
1106995921 13:35479217-35479239 CCTTCAGCTCCTTGTGTGAGGGG - Intronic
1107992987 13:45834616-45834638 CTTCCAGCTCAGTGTCTGTGGGG + Intronic
1112982105 13:105397604-105397626 GCTTCAGCTCCTTGACCTTGAGG - Intergenic
1113735223 13:112673736-112673758 CATCCAGGTCCTTGTGCTTGTGG + Intronic
1114528844 14:23382635-23382657 GTTCCAGCTCCCTGTCCCTGAGG + Intronic
1119407365 14:74407157-74407179 CCTCCTGCTCTTTCTCTGTGGGG + Exonic
1121109728 14:91303888-91303910 TCTCCGTCTCCTTGGCCGTGTGG + Exonic
1122367138 14:101200897-101200919 CTGCCAGATCCTTGTCCGTTTGG + Intergenic
1122586570 14:102811507-102811529 CCTTGAGCTCCTTGTAGGTGTGG - Intronic
1124465618 15:29936667-29936689 ACACCAGCTCCTTTTCCCTGGGG + Intronic
1125725440 15:41866103-41866125 CCTCCAGCTCCTGGCCCCTGAGG + Exonic
1125726718 15:41871901-41871923 CCTCCAGTTCCCGGTCCCTGTGG + Exonic
1126023894 15:44427605-44427627 CATCCGGGTCCCTGTCCGTGCGG + Exonic
1126798240 15:52277732-52277754 CGTGCAGCTCCCTGTCCCTGGGG - Intronic
1127319728 15:57831314-57831336 CTTCCAGCTCCTTCTCTGAGGGG - Intergenic
1131095960 15:89654612-89654634 CTTCCAGCTCCTGGTCTGGGAGG - Intronic
1132333407 15:101027718-101027740 GCTCCAGCTGCCTGTCCGTCAGG - Exonic
1133139437 16:3733386-3733408 CCTCGGGCTGCTTGTCGGTGGGG - Intronic
1133409660 16:5557880-5557902 CCTTCAGCTGTTTGTCGGTGTGG - Intergenic
1134015420 16:10884799-10884821 CTTCCTGCTCCTTCTCTGTGTGG + Intronic
1135146944 16:19970819-19970841 CCTCCAGCTTCTTGTCTGAGAGG + Intergenic
1136588183 16:31201394-31201416 CCTCCAGCTCCATGTCCCTAGGG - Intergenic
1140806998 16:78541705-78541727 CCTCCAGGTCCTTATCTGTAAGG + Intronic
1142140873 16:88472171-88472193 CCTCCAGCCACTTGTGGGTGTGG - Intronic
1142448467 16:90158567-90158589 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1142459018 17:76722-76744 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1143027086 17:3947301-3947323 CCCCCACCTCCTTTTCAGTGAGG - Intronic
1143125319 17:4638216-4638238 CCTCCAGCTCCTTCTCCAGCTGG + Exonic
1143403185 17:6658893-6658915 CCTCCAGCTCCTTCTCCAGCTGG - Intergenic
1144521036 17:15952404-15952426 CCTCCATCTTCTTATCTGTGAGG - Intronic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1149567991 17:57653028-57653050 GCTCCAGAGCCCTGTCCGTGGGG - Intronic
1149842005 17:59973691-59973713 CTTCCAGCTCCTTGACGTTGTGG + Intergenic
1149877044 17:60245426-60245448 CTTCCAGCTCCTTGACATTGCGG + Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151828411 17:76536298-76536320 TCTCCAGCTTCTTCTCCCTGTGG - Intronic
1152113428 17:78370004-78370026 CCTGCAGCTCCTTGCTCGGGTGG + Intergenic
1152457616 17:80425309-80425331 CTTCCTGCTGCTTGTCCCTGGGG - Intronic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1153769409 18:8403116-8403138 CCTCAGGCTCCTGGTCAGTGTGG + Intronic
1155688605 18:28587242-28587264 CCTCCACCTCCTTATCAGTCTGG - Intergenic
1156483600 18:37451042-37451064 CCACCATCTCCATGTCCCTGGGG - Intronic
1157815919 18:50729500-50729522 CCGCCAGCCCCGTGGCCGTGGGG - Exonic
1158408851 18:57186688-57186710 CCTGCATCTCCCTGTCCCTGTGG - Intergenic
1160225773 18:77009667-77009689 CCTGCAGCTGCTTTTCCCTGGGG + Intronic
1160406055 18:78647024-78647046 TCCCCAGCTCCAGGTCCGTGAGG + Intergenic
1160619078 18:80157943-80157965 CCTCCCGCTGCTTCTCCTTGTGG - Exonic
1160648737 19:209235-209257 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1160683447 19:423100-423122 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683471 19:423161-423183 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683495 19:423222-423244 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683519 19:423283-423305 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683543 19:423344-423366 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683567 19:423405-423427 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683591 19:423466-423488 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683615 19:423527-423549 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683641 19:423588-423610 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1160683665 19:423649-423671 CCTCCAGCTCCTGGTCCTGGGGG + Intronic
1161029790 19:2052238-2052260 CCTCCAGCTTCAGGTCAGTGGGG - Intergenic
1161617194 19:5277970-5277992 CTTCCAGCTCCTTGACGCTGGGG - Intronic
1161747995 19:6073366-6073388 CTTCCAGCTCCTTGACGCTGGGG - Intronic
1162964829 19:14150845-14150867 CCACCAGCCCCTGGTCCATGAGG + Exonic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
1163204845 19:15794924-15794946 CCTTCAGCTCCTTGTTCCTGAGG - Exonic
1163206459 19:15807140-15807162 CCTTCAGCTCCTTGTTCCTGAGG + Exonic
1163726796 19:18927758-18927780 CCTCCAGCTTCTTCTCTGTGGGG - Exonic
1164451612 19:28370895-28370917 CCTCCCGCTCCTGGTCCCTGAGG - Intergenic
1166091995 19:40515368-40515390 CCACCAGCTCCTGGACTGTGTGG - Exonic
1166560793 19:43731325-43731347 CCTCCCACTGCTTGTCCCTGTGG + Exonic
1167673999 19:50873490-50873512 TCTCCATCGCCTTGTCTGTGGGG + Exonic
1168354219 19:55691895-55691917 CCTCCAGCTGCTGATCCCTGGGG + Exonic
925331461 2:3062070-3062092 CCTCCATTTCCTTCTCGGTGAGG + Intergenic
925406150 2:3606485-3606507 CCTCGGCCTCCTGGTCCGTGAGG + Intronic
926891687 2:17644325-17644347 CCTCTAACTCCTTGTCCTGGGGG - Intronic
928124214 2:28604738-28604760 CATCCAGCTCCCTGTCCTGGCGG + Exonic
929671697 2:43880986-43881008 CCCCCACCTCCTTGTCACTGTGG + Intergenic
933676699 2:85063577-85063599 CCTCCTTCTCTTTGTCGGTGAGG + Intergenic
933817007 2:86076474-86076496 TCTCCAGCTCCTTGCTCCTGTGG + Intronic
934083782 2:88492232-88492254 CCTCCAGCTTCTGGCCCATGGGG + Intergenic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
934839623 2:97616729-97616751 CCTCCAGCTCCCGCACCGTGAGG + Intergenic
935181283 2:100693131-100693153 ACTCCAGCTCCTGGTGGGTGTGG + Intergenic
937882236 2:126877063-126877085 CCCCTTGCTCCTTGTCTGTGAGG + Intergenic
937987776 2:127646223-127646245 CCTCTAGCTGCTGGTCCGGGAGG - Exonic
944423741 2:199557757-199557779 CCTAAAGCTCCTTGTCGATGTGG - Intergenic
944630945 2:201623400-201623422 TCTCCAGCTCTTTGTCAGAGAGG - Exonic
946091074 2:217224480-217224502 CCTCCTGCTAGTTGTCAGTGAGG + Intergenic
946157043 2:217813784-217813806 CCCCCGGCTCCTGGTCCTTGAGG + Exonic
946809705 2:223510755-223510777 CCAACATCACCTTGTCCGTGTGG - Intergenic
947380386 2:229539894-229539916 CATCCAGCACCCTGTCCCTGCGG + Intronic
948428351 2:237902404-237902426 CCTCCATCTCCCTGTCCTTCTGG - Intronic
948814072 2:240500738-240500760 GCCCCAACTCCTTGTCCTTGAGG - Intronic
949027525 2:241773554-241773576 GCCCCAGCTCCTTGCCTGTGGGG - Intergenic
1172511432 20:35503808-35503830 CCTCCAGTTCCTGGTCCCTCTGG - Exonic
1174515129 20:51086061-51086083 CCTCCATCTCTTAGTCTGTGGGG - Intergenic
1175146030 20:56897036-56897058 CTTCCAGGTTCTTATCCGTGGGG + Intergenic
1175822145 20:61915793-61915815 TCTCCTGCACCTTGGCCGTGGGG + Intronic
1175998029 20:62820057-62820079 CTACCAGCTCCTTGGCCTTGTGG - Intronic
1176269067 20:64226083-64226105 GCTCCAGCTCCTTGTCTCAGTGG - Intronic
1177727795 21:24991555-24991577 CCTCGATCTCCTTGGCTGTGAGG - Intergenic
1184119562 22:42441165-42441187 CTTCCAGACCCTTCTCCGTGGGG + Intergenic
1184301566 22:43563809-43563831 CCTCCAGCTCCTTGGCTGGGTGG - Intronic
1184456855 22:44615884-44615906 TCTCCAGCTCCCTGTCCCTGTGG + Intergenic
1184824870 22:46943013-46943035 CCTCCAGCTCATTTCCCGTTTGG - Intronic
1184930943 22:47680947-47680969 CTGCCAGCTCCCTGTTCGTGAGG - Intergenic
950093795 3:10316158-10316180 CCTGCAGATCCTTGTCCGCAGGG + Intronic
950411263 3:12839368-12839390 CTTCCAGCTCCTTGACGTTGTGG + Exonic
950465979 3:13153886-13153908 CCTCCATCTCTTTGCACGTGTGG - Intergenic
950543240 3:13624720-13624742 CCTCCACCTGCCTGTCCTTGAGG + Intronic
952404230 3:32991307-32991329 CCTCCTGCTCCTTACCAGTGGGG + Intergenic
953023312 3:39129811-39129833 CCTCCAGATCCCTCTCCATGAGG - Intronic
953385288 3:42502684-42502706 CCGCCAGCTCTTTGCCCGCGCGG + Exonic
955334876 3:58077115-58077137 ACTCCATCTCCATGCCCGTGTGG + Exonic
955581875 3:60431939-60431961 CCTACAGCTCCTTGGCAGTAGGG + Intronic
966531770 3:180989368-180989390 TCTCCAGCTTCTTGTCCGCACGG - Intronic
966914154 3:184575703-184575725 CCTCCACCTCCTAGACTGTGGGG - Intronic
967163140 3:186757122-186757144 CCGCCAGTTCCTTGTCTTTGGGG + Intergenic
968369113 3:198210880-198210902 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
968567594 4:1322404-1322426 CCTCCACCTCTTTGGCCGTCAGG - Exonic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
970205120 4:13648142-13648164 CTTCCTGCTCCTTGACCTTGTGG + Intergenic
970609093 4:17709119-17709141 CCTGCAGCTCCTCGGCCTTGCGG + Exonic
970831186 4:20341519-20341541 CCTGCTGCTCCTGGTTCGTGTGG - Intronic
971494808 4:27252278-27252300 CCTCCTCCTCCTTGACCCTGAGG - Intergenic
974109833 4:57512467-57512489 ACTCCAGCTCCTAGTCACTGTGG + Intergenic
976539972 4:86263009-86263031 CCTCCAGCTCCCTACCTGTGTGG + Intronic
979257539 4:118620589-118620611 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
979330811 4:119419958-119419980 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
983516420 4:168661636-168661658 CCCTCAGCTCCTTGTTTGTGTGG + Intronic
985570174 5:640586-640608 TCACCAGCTCCTTGTGTGTGTGG - Exonic
992645034 5:78803911-78803933 CCTCCAGCTCCTTGCCTGCAGGG - Intronic
997189027 5:131913205-131913227 CCTCCAGCTGCTTTTGAGTGAGG + Intronic
997318937 5:132962626-132962648 CCTCCAGCTGCCTGTGCTTGGGG - Intronic
997510497 5:134450549-134450571 CCTCCAGCTCGTGGTCTATGTGG - Intergenic
999326571 5:150647963-150647985 CTTTCAGATCCTTCTCCGTGAGG - Exonic
999382076 5:151128285-151128307 CCTTCACCTCCTTGTCTGAGAGG - Intronic
999595867 5:153203625-153203647 TCTCCAGCTACATGTCTGTGTGG + Intergenic
1000361543 5:160452347-160452369 CCTCCTGCTACTTTTCCTTGGGG + Intergenic
1000393519 5:160749378-160749400 CCCCCAGCTCCTTCTTCCTGTGG - Intronic
1002728389 5:181316465-181316487 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1003397788 6:5767979-5768001 CCTTCAGCTCCATGTGCCTGTGG + Intronic
1004451625 6:15753162-15753184 CCTCCACCTCCTTGGCTGGGAGG - Intergenic
1005370126 6:25123646-25123668 CCTCCAGCTCCATGTCTGGAAGG - Intergenic
1005776754 6:29141438-29141460 CTTCCAGCTCCTTGTCCCACTGG + Intergenic
1005966592 6:30730983-30731005 CCTCCAGCTCCTTCTCCCGCCGG + Exonic
1007330148 6:41100821-41100843 CCTCCAGCCCCTTCTCCCCGGGG + Intergenic
1007355001 6:41308312-41308334 CTTCCAGCTCCTTGACGTTGTGG + Intergenic
1010495934 6:76533487-76533509 CCTCTGGCTGCTTTTCCGTGGGG + Intergenic
1017106635 6:150894365-150894387 TCTCCAGCTCTCTGTCTGTGAGG + Intronic
1017129975 6:151099762-151099784 CTTCCAGCTCCTTGACGTTGTGG - Intronic
1017239231 6:152148336-152148358 GCTCCAGCTCCCTGTCTGAGAGG + Exonic
1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG + Intronic
1019180091 6:170181276-170181298 CCTCCAGCTCCTCTTCCCAGCGG + Intergenic
1019345080 7:525718-525740 CCTCCAGCCCCTTCTCCATGAGG - Intergenic
1020066747 7:5194182-5194204 CCTCCACCTCCATATCCCTGTGG - Intronic
1021153614 7:17181898-17181920 GCTCAAGCACCTTGTCAGTGAGG + Intergenic
1022113283 7:27244101-27244123 CCTGCAGCTCCTTTTCCTTTGGG - Intronic
1023399523 7:39781864-39781886 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1024072461 7:45797653-45797675 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1024987789 7:55210553-55210575 CCTCCAAGTCCATGTCCTTGTGG - Exonic
1026078941 7:67200057-67200079 CCGCGAGCTCCTTGTGGGTGGGG - Intronic
1026554124 7:71391354-71391376 ACTCCAGCTCCTTGACCGCAGGG + Intronic
1026697881 7:72611882-72611904 CCACGAGCTCCTTGTGGGTGGGG + Intronic
1029607174 7:101606069-101606091 CCTCCAGCTCCAAGCCCCTGGGG + Intergenic
1032049853 7:128641358-128641380 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1032069383 7:128794487-128794509 CCTCCAGCTCTGTCTCCGTGAGG - Exonic
1032543619 7:132724457-132724479 CCTCCAGCCCCTTCTCCATGTGG + Intronic
1033579075 7:142715394-142715416 CCCCCAGCTCCTTGGCTATGTGG + Intergenic
1034115558 7:148580634-148580656 CTTCCAGCTCCTTGACATTGTGG - Intergenic
1034692076 7:153021880-153021902 CCTCCAGGTCCCTGTCCTTAGGG - Intergenic
1035236227 7:157499266-157499288 CCTCCAGCTCGTGGACCCTGTGG - Intergenic
1037763434 8:21757047-21757069 CCTCCAGCTCCTGGCCCTAGGGG + Intronic
1038336531 8:26650195-26650217 CCTCCACCTCCTCATCTGTGAGG - Intronic
1039890696 8:41683528-41683550 CCTCAAGCTCCTTGTCTTAGGGG - Intronic
1040915170 8:52561755-52561777 CCTTAAGCTCCATGTCAGTGAGG + Intronic
1042338142 8:67650470-67650492 CCTCCTCCTCCTTGACAGTGGGG - Intronic
1043926551 8:86043340-86043362 CTTCCAGCTCCTTGGCGTTGTGG - Intronic
1044738781 8:95304603-95304625 CCACCTTCTCCTTGTCCTTGGGG + Intergenic
1045412229 8:101930533-101930555 CCTCCAGCTCCTTGACCACAGGG + Intronic
1048311535 8:133326233-133326255 CTTCCAGCTCCTTGACATTGTGG - Intergenic
1049269487 8:141686664-141686686 CCTCGAGCTGGATGTCCGTGAGG - Intergenic
1050027371 9:1349839-1349861 CTTCCAGCTCCTGGTCATTGTGG - Intergenic
1051837878 9:21361505-21361527 CCACCAGGGCCTTGTCTGTGTGG - Intergenic
1051845850 9:21450289-21450311 CCACCAGGGCCTTGTCTGTGTGG + Intergenic
1053315439 9:37047071-37047093 CTTCCAGCTCCTTGACGTTGTGG - Intergenic
1053381250 9:37651054-37651076 CCGCTAGGTCCTTGTCCGCGCGG + Intronic
1056796307 9:89661009-89661031 CCTTCAGCTTCTTGTCCTTGAGG - Intergenic
1057164483 9:92914991-92915013 CCTCCAGCTCCTTCTCCAGCTGG - Intergenic
1057218280 9:93241742-93241764 CTGGCAGCTCCTTGTCCATGGGG + Intronic
1058886378 9:109324451-109324473 CCTCCACCTCCTACTCCTTGGGG - Intergenic
1060939445 9:127535211-127535233 CCTCCAGGGCCTGCTCCGTGAGG - Intronic
1060952426 9:127612557-127612579 CCTGAGGCTCCTGGTCCGTGGGG + Intronic
1062630461 9:137460956-137460978 CTGCCCGCTCCTTGTCCTTGTGG - Intronic
1062753454 9:138273564-138273586 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1203575965 Un_KI270745v1:8343-8365 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1185705026 X:2260399-2260421 CCTCCATCTCCATCTCCATGTGG + Intronic
1185871721 X:3670282-3670304 CCTCCAGCATCTTATCCATGGGG + Intronic
1188676988 X:32953576-32953598 TCTCAAGCTCCTTGTAAGTGGGG - Intronic
1189307433 X:39997448-39997470 CCTCCAGCTCCTCTTCATTGCGG + Intergenic
1195295396 X:103471729-103471751 CCTCCAGATCTTTGTCCCAGAGG + Intergenic
1198528475 X:137525636-137525658 TCCCCAGCTCCTTGCCCCTGAGG - Intergenic
1200792242 Y:7309880-7309902 CCTCCAGCATCTTATCCATGGGG - Intergenic