ID: 968920655

View in Genome Browser
Species Human (GRCh38)
Location 4:3520832-3520854
Sequence CCACGTGGGCAGATCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968920655_968920660 3 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920660 4:3520858-3520880 TCCCCTAGCCCCGCTTCCCTAGG No data
968920655_968920675 23 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920675 4:3520878-3520900 AGGGGGGACTCGGCATCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 87
968920655_968920667 7 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920667 4:3520862-3520884 CTAGCCCCGCTTCCCTAGGGGGG No data
968920655_968920666 6 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920666 4:3520861-3520883 CCTAGCCCCGCTTCCCTAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 150
968920655_968920671 13 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920671 4:3520868-3520890 CCGCTTCCCTAGGGGGGACTCGG 0: 1
1: 0
2: 0
3: 4
4: 98
968920655_968920662 4 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920662 4:3520859-3520881 CCCCTAGCCCCGCTTCCCTAGGG 0: 1
1: 0
2: 1
3: 12
4: 168
968920655_968920664 5 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920664 4:3520860-3520882 CCCTAGCCCCGCTTCCCTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 136
968920655_968920674 22 Left 968920655 4:3520832-3520854 CCCTCTAGGATCTGCCCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 968920674 4:3520877-3520899 TAGGGGGGACTCGGCATCTGTGG 0: 1
1: 0
2: 1
3: 2
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968920655 Original CRISPR CCACGTGGGCAGATCCTAGA GGG (reversed) Intronic
902569778 1:17339764-17339786 CCACGTGGCCAGGTCTGAGATGG + Exonic
904888651 1:33761370-33761392 CTACATGGGCAGATCCCAGATGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907425216 1:54375157-54375179 CCCCGTGGTCAGAGCCTGGAGGG + Intronic
907569304 1:55468298-55468320 ACTCGTGGCCTGATCCTAGAGGG - Intergenic
907584581 1:55605697-55605719 CCACTGGGGCAGATCCTGGGAGG + Intergenic
915569810 1:156738422-156738444 CCACAGGTGGAGATCCTAGAAGG - Exonic
918389883 1:184048062-184048084 ACATGTGGGCAGATGCAAGAAGG - Intergenic
918999210 1:191807161-191807183 CAACGTGGGAAGATCCTTGGAGG + Intergenic
922571233 1:226635737-226635759 CAGCGTGGGCAGACCCTATAGGG + Intronic
1064519897 10:16190090-16190112 CCACATGGGCAGGGTCTAGAAGG - Intergenic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077306176 11:1869587-1869609 CCACGTGGGCCGCACCTAGCAGG + Intronic
1077887608 11:6397236-6397258 CCACGTGGTCTGCTCCTAGTGGG - Intronic
1084694277 11:70744469-70744491 TCCCGTAGGCAGATCCTAGCAGG - Intronic
1089195983 11:116694346-116694368 CCAAGAGGGCAGATCCAAGAGGG + Intergenic
1089195998 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1089202571 11:116733248-116733270 CCAGGTGGGCAGATACCAGGGGG - Intergenic
1096239222 12:49950677-49950699 CCACGTGCCCAGATCCGGGATGG + Intergenic
1100571351 12:95845892-95845914 TCACGAGGGCAGATCCTTTATGG - Intergenic
1101370982 12:104130068-104130090 CCAACATGGCAGATCCTAGAAGG + Intronic
1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG + Intronic
1104784058 12:131438524-131438546 CAACTAGGGCAGGTCCTAGAAGG - Intergenic
1105505866 13:21009243-21009265 CCACGTGGTCAGCTCTTGGAAGG + Intronic
1112477422 13:99744571-99744593 CCACTTGTACAGGTCCTAGAGGG - Intronic
1114215830 14:20657174-20657196 CCAGGTGGGCAAAGCCTGGAAGG - Intergenic
1118323448 14:64766642-64766664 CCACCTGGGCTGAGCCTAGTAGG + Intronic
1122204551 14:100142058-100142080 CCACGTGGGAAGAGCATGGAGGG + Intronic
1122924220 14:104892334-104892356 CCCCCTGGGCACATCCTAGGGGG + Intronic
1124217189 15:27817071-27817093 CCAGGAGCGCAGAGCCTAGAGGG - Intronic
1125144850 15:36455172-36455194 CAACGTGGGCTAATCCTAGCAGG + Intergenic
1132155440 15:99492575-99492597 CAAGGTGGGCAGCTCCTGGAAGG + Intergenic
1132501788 16:287761-287783 GTACGTGGGCAAATCCCAGAGGG + Exonic
1132753161 16:1468286-1468308 CCGCCTTGGCAGATCCGAGAGGG + Intronic
1133357230 16:5145465-5145487 TCCCGTGGGCAGATCCTGGATGG - Intergenic
1138273511 16:55713266-55713288 CCATGTGGGGAGATCAGAGAGGG + Intergenic
1140449118 16:75055857-75055879 CCAACTGGGCACATCCTTGAAGG + Intronic
1141029993 16:80579262-80579284 CCATGTGGGTAGAACCAAGATGG + Intergenic
1141099313 16:81185464-81185486 GCACGTGGGCAGTTCCTCCAGGG - Intergenic
1141460814 16:84177783-84177805 CCACGTGGGCAGAGCTTGGCTGG - Exonic
1141772227 16:86096336-86096358 AGAGGTGGGCAGATCCTAGATGG + Intergenic
1141772251 16:86096424-86096446 AGAAGTGGGCAGAGCCTAGATGG + Intergenic
1145253790 17:21311754-21311776 CCAGGTGGGCAGGTCCCAGGTGG - Intronic
1147118212 17:38318770-38318792 CTGAGTGGGCAGATTCTAGATGG + Intronic
1151158133 17:72141755-72141777 CCAAGTGGGAAGATCCTTGCTGG - Intergenic
1151746295 17:76013645-76013667 CGAGGTGGGCAGATCTGAGATGG - Intronic
1152881930 17:82822540-82822562 CCTGGGGGCCAGATCCTAGAGGG + Intronic
1155374869 18:25145924-25145946 CCATGTTGTCATATCCTAGAAGG - Intronic
1161348014 19:3777640-3777662 CCAGCTGGGCAGATCCTCCATGG + Intergenic
1161588928 19:5119896-5119918 CCCCGTGGGCATCTCCTAGAAGG + Intronic
1163646905 19:18494772-18494794 CCACCTGGTCAGAGCCCAGAAGG - Intronic
1164044448 19:21523912-21523934 CCTTATGTGCAGATCCTAGATGG - Intronic
1165247072 19:34503879-34503901 CCACGTGGACACATCCTATGTGG + Exonic
925170822 2:1749416-1749438 CCAACTGAGCAGATTCTAGAAGG - Intergenic
927883290 2:26703914-26703936 ACTCGTGAGCAGATCCTGGAGGG + Intronic
937264550 2:120607731-120607753 CCCCGTGGGCAGAGCTCAGAGGG + Intergenic
938661526 2:133491763-133491785 CCACATGGGCAGAGCTGAGATGG + Intronic
939096299 2:137836998-137837020 CCCCATGGGCACATCCTCGATGG + Intergenic
940371713 2:152909399-152909421 TCACGAGGGCAGATCCTGCATGG + Intergenic
946432447 2:219632866-219632888 CCAGGAGGGCAGCTCCTAGGGGG - Exonic
1175921778 20:62453542-62453564 GCAGGTGGGCAGAGCCTCGAGGG + Intergenic
1176018954 20:62952962-62952984 CCACGTGGGACGATGCTAGGTGG + Intronic
1176077859 20:63256736-63256758 CCATGTGGGAAGACCCTAGTCGG + Intronic
1176114310 20:63424401-63424423 CCACGGAGGCAGCTCCGAGAGGG + Intronic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1179996320 21:44976043-44976065 CCTCGGGGGCAGCTCCCAGACGG - Intronic
1180228276 21:46411420-46411442 CCTCGTGGGCAGGCCCTACAGGG + Exonic
1184331482 22:43830616-43830638 CCACATGGGCAGGTACTAGCTGG + Intronic
949342445 3:3044620-3044642 GGACGTGGGCAGTTCCAAGATGG + Intronic
950491171 3:13305880-13305902 CCAAGTGGGCAGAGCCTGGCAGG + Intergenic
956448009 3:69344847-69344869 CCACAGGGGCAGTTCCAAGATGG + Intronic
961637448 3:128342307-128342329 GCACATGGGCAGATCCCAGCTGG - Intronic
962460121 3:135604229-135604251 CCCGGTGGGCAGTTCCAAGATGG + Intergenic
967874737 3:194260102-194260124 CCACGGGGGCAGATCCCTCATGG + Intergenic
968133934 3:196208372-196208394 CCACGTGGGCGGATACGCGATGG + Exonic
968701715 4:2060676-2060698 CAAGGTGGGCAGATCCTGGCAGG - Intronic
968920655 4:3520832-3520854 CCACGTGGGCAGATCCTAGAGGG - Intronic
969807939 4:9625372-9625394 TCCCGTGGGCAGATCCTGGATGG + Intergenic
988716842 5:33836820-33836842 CAAGGTGGCCAGAGCCTAGAGGG + Intronic
991690101 5:69217633-69217655 ACACGTGGGTGGATCCTAGTAGG + Intergenic
1002319366 5:178365851-178365873 CCACATGGGGAGCTCCTCGAGGG + Intronic
1002636731 5:180612404-180612426 AGAGGTGGGCAGAGCCTAGATGG + Intronic
1002639634 5:180624674-180624696 CCATGTGGGCAGATCCCAGGTGG - Intronic
1003687215 6:8315759-8315781 CCACGGGGGCAGGGCCAAGATGG - Intergenic
1018164948 6:161084669-161084691 CCTCATGGTGAGATCCTAGAAGG + Intronic
1018865676 6:167745473-167745495 CCATGTGGGCAGCTCCAAGCTGG + Intergenic
1019063254 6:169273586-169273608 TCACGGGGGCAGATCCTTCATGG + Intergenic
1025859716 7:65315263-65315285 CCAGGTGTGCAGATTTTAGATGG - Intergenic
1027172816 7:75884879-75884901 CAAGGTGGGCAGATCATATAAGG + Intronic
1037774582 8:21824993-21825015 CCACATGGGCAGAGCCTTGAGGG - Intergenic
1040379235 8:46856288-46856310 CCATGTGGGCAGAGCCAAGCAGG - Intergenic
1047446758 8:124927054-124927076 GCACGTGGCCAGAACCCAGAGGG + Intergenic
1057908338 9:98999353-98999375 GCAGGTGGGCAGATCCTGGTTGG - Intronic
1061842543 9:133367695-133367717 CCTCTGGGGCAGATCCTATAGGG + Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1062115456 9:134805883-134805905 CCCCGTGGGCAGACCCTCAAGGG + Intronic
1189773612 X:44450427-44450449 CCAAGTGGGCAAACCCTTGATGG + Intergenic
1189812941 X:44797751-44797773 CCAGGTGGGCAGATCCTCTGAGG + Intergenic
1192993635 X:76488675-76488697 CCAAGGGGGCAGTTCCAAGATGG - Intergenic
1195577693 X:106468806-106468828 CCACAGGGGCAGAGCCTGGATGG + Intergenic
1199987140 X:152960820-152960842 CAACATGGGCAGGGCCTAGAGGG + Intronic