ID: 968921601

View in Genome Browser
Species Human (GRCh38)
Location 4:3524997-3525019
Sequence CCACGCTGATCTGAAGATAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 278}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968921601_968921611 24 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921611 4:3525044-3525066 AGATGCAGCTGCGAACGAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 95
968921601_968921610 23 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921610 4:3525043-3525065 AAGATGCAGCTGCGAACGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 62
968921601_968921612 27 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921612 4:3525047-3525069 TGCAGCTGCGAACGAAGGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 94
968921601_968921604 -4 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921604 4:3525016-3525038 GTGGAGCTCGGCCAGCCTCACGG 0: 1
1: 0
2: 0
3: 13
4: 187
968921601_968921605 -3 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921605 4:3525017-3525039 TGGAGCTCGGCCAGCCTCACGGG 0: 1
1: 0
2: 1
3: 20
4: 150
968921601_968921606 0 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921606 4:3525020-3525042 AGCTCGGCCAGCCTCACGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 112
968921601_968921609 22 Left 968921601 4:3524997-3525019 CCTGTATCTTCAGATCAGCGTGG 0: 1
1: 0
2: 1
3: 12
4: 278
Right 968921609 4:3525042-3525064 GAAGATGCAGCTGCGAACGAAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968921601 Original CRISPR CCACGCTGATCTGAAGATAC AGG (reversed) Exonic
901284062 1:8062475-8062497 CCACGCTGGTCTCAAACTACTGG + Intergenic
901550427 1:9992290-9992312 CCAGGCTGATCTCAAAATCCTGG + Intergenic
903329789 1:22591428-22591450 CCAGGCTGATCTGAAACTCCTGG + Intronic
903463348 1:23534541-23534563 CCATGCTGATCTCAAGCTCCTGG - Intergenic
905083720 1:35350172-35350194 CCAAGCTGATCTGAAACTCCTGG + Intronic
905216755 1:36414047-36414069 CCACGCTGATCTCAAACTCCTGG - Intergenic
905469159 1:38178841-38178863 CCAGGCTGATCTCAATCTACTGG - Intergenic
908013471 1:59807584-59807606 CCAGGCTGATCTGAAACTCCTGG - Intergenic
908285673 1:62596597-62596619 CCATGCTGGTCTGGAAATACTGG - Intronic
908531528 1:65038845-65038867 CCACGCTGATCTCAAACTCCTGG + Intergenic
908739838 1:67316232-67316254 CCAGGGTGCTCTGAGGATACTGG + Intronic
909573522 1:77146450-77146472 CCAGGCTGATCTAAAACTACTGG - Intronic
909665748 1:78131044-78131066 CCAGGCTGATCTCAAAATCCTGG + Intronic
910225038 1:84927827-84927849 CCACGCTGATCTCAAAATCCTGG + Intronic
912882799 1:113434358-113434380 CCAGGCTGATCTGAAACTCCTGG - Intronic
912991639 1:114493492-114493514 CCAAGCTGATCTCAAAATCCTGG + Intronic
915072665 1:153284052-153284074 CCAGGCTGATCTGAAACTCCTGG - Intergenic
918220676 1:182433560-182433582 CCAGGCTGATCTCAAACTACTGG + Intergenic
918494974 1:185125374-185125396 CCAGGCTGATCTCAAACTACTGG + Intronic
919425024 1:197419570-197419592 CCAGGCTGATCTGAAACTCCTGG + Intronic
919965489 1:202519479-202519501 CCAGGCTGATCTCAAGCTCCTGG + Intronic
919971785 1:202585204-202585226 CCAGGCTGGTCTGAAGCTGCTGG + Exonic
923410966 1:233708639-233708661 CCAGGCTGATCTGAAACTGCTGG - Intergenic
1064283695 10:13973393-13973415 CCAGGCTGATCTCAAGCTCCTGG + Intronic
1064312251 10:14221762-14221784 CCAGGCTGATCTCAAGCTCCTGG + Intronic
1064734024 10:18362036-18362058 CCAGGCTGATCTCAAGCTCCTGG + Intronic
1064906894 10:20356752-20356774 CCAGGCTGATCTCAAAATCCTGG - Intergenic
1065112867 10:22457037-22457059 CCAGGCTGATCTCAAAATCCTGG + Intergenic
1065679783 10:28217317-28217339 CCAGGCTGGTCTGAAGATCCTGG - Intronic
1065698803 10:28404686-28404708 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1067271699 10:44797094-44797116 CCAGGCTGATCTCAAAATCCTGG - Intergenic
1071597274 10:86937494-86937516 CCAGGCTGATCTGGAGCTCCTGG + Intronic
1071619009 10:87101697-87101719 CCAGGCTGATCTGAAACTCCTGG - Intronic
1073257344 10:102161439-102161461 CCAGGCTGATCTGAATTTCCTGG + Intronic
1074050677 10:109878676-109878698 CCAGGCTGATCTGAAACTCCTGG - Intronic
1074061090 10:109966201-109966223 CCAGGCTGATCTGAAACTCCTGG + Intergenic
1074673369 10:115820940-115820962 CCATGCTGTTCTGATGATAGTGG + Intronic
1077237847 11:1490688-1490710 CCAGGCTGATCTGAAACTCCTGG - Intronic
1077493600 11:2874049-2874071 CCAGGCTGGTCTGAAAATCCTGG + Intergenic
1079219439 11:18547068-18547090 ACAGTCTGAGCTGAAGATACAGG + Intronic
1083241952 11:61395183-61395205 CCAGGCTGGTCTGAAGCTCCTGG + Intronic
1083432742 11:62622806-62622828 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1085358836 11:75866308-75866330 CCAGGCTGATCTCAAGCTCCTGG - Intronic
1085586607 11:77714178-77714200 CCACGCTGATGTGAAACTGCTGG - Intronic
1085730096 11:78990304-78990326 CCAAGCTGAGCAGAAGAGACTGG - Intronic
1086085454 11:82949920-82949942 CCAGGCTGGTCTGAAGCTCCTGG - Intronic
1087165481 11:94998588-94998610 CCACGCCGATCTGCAGTTAGTGG + Exonic
1088135026 11:106544957-106544979 CCAGGCTGGTCTCAAGCTACTGG - Intergenic
1089934993 11:122355314-122355336 CCAGGCTGGTCTCAAGATGCTGG + Intergenic
1090222271 11:125038127-125038149 CCAGGCTGATCTGAAACTCCTGG + Intronic
1090287628 11:125513600-125513622 CCAGGCTGATCTGGAACTACTGG + Intergenic
1090851293 11:130572727-130572749 CTACACTGATGTGAAGACACTGG - Intergenic
1093446962 12:19271293-19271315 CCAGGCTGATCTCAAAATCCTGG - Intronic
1093549636 12:20392461-20392483 CCAGGCTGATCTTGAGCTACTGG - Intronic
1095423972 12:42055400-42055422 CCAGGCTGATCTGAAGCTCCTGG - Intergenic
1097062373 12:56295134-56295156 CCAGGCTGATCTCAAACTACTGG + Intronic
1098081544 12:66791274-66791296 ACACTCTGAACTGAAGATAGAGG - Intronic
1098593994 12:72249475-72249497 CCAGGCTGATCTGAAACTCCAGG - Intronic
1099881107 12:88467773-88467795 ACAGGCTGATCTGAAGATCAAGG + Intergenic
1100228784 12:92586350-92586372 CCAGGCTGGTCTGAAAATCCTGG - Intergenic
1100521341 12:95378895-95378917 CCAGGCTGATCTCAAACTACTGG + Intronic
1102023824 12:109701855-109701877 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1102156170 12:110730146-110730168 CCAAGCTGATCTGAAACTCCTGG - Intronic
1102441439 12:112966851-112966873 CCAGGCTGATCTGAAACTCCTGG + Intronic
1102676166 12:114660647-114660669 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1102875002 12:116442451-116442473 CCAGGCTGATCTCAAGCTGCTGG - Intergenic
1103366482 12:120387762-120387784 CCAGGCTGATCTCAAACTACTGG - Intergenic
1103727676 12:123006489-123006511 CCAGGCTGGTCTGAAGCTCCTGG - Intronic
1105317815 13:19283538-19283560 CCACGCTGGTCTGAAATTCCTGG - Intergenic
1106268565 13:28132178-28132200 CCAGGCTGATCTGAAACTCCTGG + Intergenic
1107756221 13:43624953-43624975 CCAAGCTGATATGTAGATATTGG - Intronic
1107870285 13:44740052-44740074 CCAGGCTGATCTCAAACTACTGG + Intergenic
1109984688 13:69964249-69964271 CCAGGCTGGTCTGGAGCTACTGG + Intronic
1110907292 13:80907640-80907662 CCAGGCTGATCTTAAAATACTGG + Intergenic
1113788913 13:113017001-113017023 CCACGCTGTTCTCAGGATCCAGG + Intronic
1115436682 14:33382879-33382901 CCAGGCTGATTTGAAACTACTGG - Intronic
1116581480 14:46647864-46647886 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1117146582 14:52842050-52842072 CCAGGCTGGTCTGAAAATCCTGG + Intergenic
1117360823 14:54971975-54971997 CCAGGCTGGTCTGAAACTACTGG - Intronic
1118281568 14:64433622-64433644 CCAGGCTGATCTCAAGCTTCTGG + Intronic
1118574675 14:67230368-67230390 CCAGGCTGATCTCAAACTACTGG - Intergenic
1121149120 14:91614589-91614611 CCAGGCTGGTCTCAAGGTACTGG - Intronic
1121424692 14:93841475-93841497 CCACGCTGGTCTGAAGCTCCTGG - Intergenic
1121725161 14:96141940-96141962 CCAGGCTGATCTGAGGCTTCTGG + Intergenic
1123838920 15:24226140-24226162 CCACGCTGGTCTCAAATTACTGG - Intergenic
1124438767 15:29672195-29672217 CCAGGCTGATCTCAAACTACTGG + Intergenic
1124456856 15:29850926-29850948 CCAGGCTGATCTCAAACTACTGG - Intronic
1125429197 15:39579408-39579430 CCAAGCAGATCTGAAGATTCTGG - Intergenic
1125806360 15:42496916-42496938 CCATGCTGTTCTCATGATACTGG - Intronic
1125830051 15:42709184-42709206 CTAGGCTGATCTCAAAATACTGG - Intronic
1126331893 15:47541665-47541687 CCCCGATCATCTGTAGATACAGG - Intronic
1126635030 15:50771679-50771701 CCAGGCTGATCTTAAAATCCTGG - Intergenic
1126950846 15:53879370-53879392 CCACGCTGGTCTGAAACTCCTGG + Intergenic
1128176395 15:65560084-65560106 CCAGGCTGATCTTAAGATACTGG + Intronic
1128314301 15:66650631-66650653 CCACAATGGTCTGAAGATTCTGG + Intronic
1129371793 15:75101159-75101181 CCAGGCTGGTCTGAAAATCCTGG + Intronic
1132460987 16:54457-54479 CCAGGCTGATCTGAAACTCCTGG + Intronic
1133731242 16:8580275-8580297 CCACGCTGATCTCAAACTCCTGG - Intronic
1134407680 16:13976128-13976150 CCAGGCTGATCTCAAACTACTGG - Intergenic
1134514784 16:14878282-14878304 CCAGGCTGATCTCAAACTACTGG - Intronic
1134532301 16:14993039-14993061 CCAAGCTGATCTGAAACTCCTGG + Intronic
1134662695 16:15996331-15996353 CCAAGCTGATCTGAAATTCCTGG + Intronic
1134702461 16:16276940-16276962 CCAGGCTGATCTCAAACTACTGG - Intronic
1134965082 16:18435175-18435197 CCAGGCTGATCTCAAACTACTGG + Intronic
1134969369 16:18517710-18517732 CCAGGCTGATCTCAAACTACTGG + Intronic
1135333767 16:21583775-21583797 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1135533996 16:23278719-23278741 CCAGGCTGATCTTAAGCTCCTGG - Intronic
1135563001 16:23490982-23491004 CCACGCTGGTCTCAAACTACTGG - Intronic
1135789628 16:25381802-25381824 CCAGGCTGATCTGAAATTCCTGG + Intergenic
1135857138 16:26022176-26022198 CCAGGCTGATCTCAAAATCCTGG + Intronic
1136598264 16:31266371-31266393 CCAGGCTGATCTCAAGCTCCTGG - Intronic
1137284766 16:47006332-47006354 CCAGGCTGATCTCAAAATCCTGG + Intergenic
1139674215 16:68511748-68511770 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1139736563 16:68994792-68994814 CCACGCTGATCTCAAACTCCTGG + Intronic
1139863719 16:70047651-70047673 CCAAGCTGATCTGAAACTCCTGG - Intergenic
1140425698 16:74859482-74859504 CCAGGCTGATCTCAAGCTCCAGG + Intergenic
1140861795 16:79024779-79024801 CCAAGCTGATCTCAAAATCCTGG + Intronic
1143556616 17:7665836-7665858 CCAGGCTGATCTGAAACTCCTGG + Intronic
1146246017 17:31283699-31283721 CCAGGCTGATCTCAAGCTCCTGG + Intronic
1148850567 17:50552761-50552783 CCAGGCTGGTCTGAAACTACTGG + Intronic
1149745632 17:59095004-59095026 CCAGGCTGATCTGGAGCTCCTGG - Intronic
1150248641 17:63693999-63694021 CCACGCTGAGCTCAGGACACTGG - Exonic
1153205733 18:2698575-2698597 CCAGGCTGGTCTTAAGATCCTGG + Intronic
1157196107 18:45621473-45621495 CCACGCTGTTCTGAAACCACTGG + Intronic
1159108501 18:64029523-64029545 CCAGGATGATGTGAAGAAACTGG - Intergenic
1160036124 18:75303325-75303347 CCACGGTGATTTGAAGATGAGGG + Intergenic
1160593094 18:79955074-79955096 GCACCCTGCTCTGAAGAGACAGG + Intergenic
1161923921 19:7287057-7287079 CCAGGCTGATCTGAAACTCCTGG + Intronic
1163047376 19:14654160-14654182 CCAGGCTGATCTCAAACTACTGG + Intronic
1163059615 19:14751020-14751042 CCAGGCTGGTCTCAAGATCCTGG + Intronic
1163505081 19:17700825-17700847 CCAGGCTGATCTCAAAATCCTGG - Intergenic
1167002018 19:46751271-46751293 CCAGGCTGATCTGAAACTCCTGG + Intronic
1167840408 19:52112858-52112880 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1167921134 19:52784177-52784199 CCAGGCTGGTCTCAAGATCCTGG - Intronic
926685270 2:15693116-15693138 CCAGGCTGATCTCAAAATCCTGG - Intronic
927209531 2:20630476-20630498 CCAGGCTGATCTCAAGCTCCTGG + Intronic
927814943 2:26206986-26207008 CCAGGCTGATCTCAAAATTCTGG - Intronic
928479044 2:31662527-31662549 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
930489334 2:52048123-52048145 CCAAGCTGATCTGCAGACTCAGG + Intergenic
931519345 2:63078391-63078413 CCATGCTGTTCTGGAGATAGTGG + Intergenic
934080099 2:88460353-88460375 CCAGGCTGATCTGAAACTCCTGG + Intergenic
936505582 2:113103108-113103130 CCACTCTGATCTACTGATACAGG - Intergenic
936858746 2:116991167-116991189 CCACGCTGGTCTCAAAATCCTGG + Intergenic
941155408 2:161971786-161971808 CCATGCTTATCTGAAGAGAAGGG - Intronic
941926741 2:170903067-170903089 CCAGGCTGGTCTCAAGATCCTGG + Intergenic
943213394 2:184998847-184998869 CCAGGCTGATCTGGAGCTCCTGG - Intergenic
944415535 2:199475826-199475848 CCAGGCTGGTCTGAAAATTCTGG - Intergenic
944730152 2:202507596-202507618 CCAGGCTGATCTCAAGCTCCTGG + Intronic
945593474 2:211763508-211763530 GCACTATGATGTGAAGATACTGG - Intronic
947093723 2:226542856-226542878 CCAGGCTGATCTCAAGTTCCCGG + Intergenic
947100899 2:226620402-226620424 CCAGGCTGATCTCAAAATCCTGG - Intergenic
1169447321 20:5683235-5683257 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
1169470512 20:5881309-5881331 CCAGGCTGGTCTCAAGATCCTGG - Intergenic
1170663842 20:18367939-18367961 CCAGGCTGATCTGAAACTCCTGG + Intergenic
1171974006 20:31582375-31582397 CCAGGCTGGTCTCAAGTTACTGG - Intergenic
1173705727 20:45109045-45109067 CCAGGCTGGTCTCAAGCTACTGG - Intergenic
1173768364 20:45634901-45634923 CCAGGCTGATCTCAAGTTCCTGG + Intergenic
1174630942 20:51956542-51956564 CCAGGCTGATCTTAAAATCCTGG + Intergenic
1176273362 20:64248033-64248055 TGATGCTGATCTGAAAATACCGG - Intergenic
1176894793 21:14363732-14363754 CCACGCTGGTCTCAAGTTCCTGG - Intergenic
1176914131 21:14604501-14604523 CCAAGCTGATCTGAAACTCCTGG - Intronic
1179536859 21:42058533-42058555 CCACGCTGATCTCAAGCTCTTGG + Intergenic
1181063454 22:20293287-20293309 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1182323283 22:29492258-29492280 CCAGGCTGATCTCAAAATCCTGG - Intergenic
1182551859 22:31104963-31104985 CCACGCTGACCTGTAGGTCCGGG - Exonic
1183246129 22:36694880-36694902 CCACGCCGATCTGAATACAGTGG - Intronic
949567389 3:5257581-5257603 CCAGGCTGGTCTCAAGATCCTGG + Intergenic
950595556 3:13977737-13977759 CCATTCTGATCTGTAGATATGGG - Intronic
952284327 3:31953613-31953635 CCAGGCTGATCTCAAGCTCCTGG + Intronic
952893301 3:38059098-38059120 CCCCACTGACCTGCAGATACAGG - Intronic
954884179 3:53857492-53857514 CCAGGCTGGTCTCAAAATACTGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955217891 3:56999594-56999616 CCAAGCTGATCTGAAGCTCCTGG - Intronic
956457763 3:69440593-69440615 CCAGGCTGATCTCAAGCTCCTGG - Intronic
956528030 3:70186483-70186505 CCAAGCTGATCTTAAAATATTGG + Intergenic
957997795 3:87712204-87712226 CCACGCTGTTCTCATGATAGTGG - Intergenic
960315323 3:116168989-116169011 CCAGGGTGATCTGAAAATTCTGG - Intronic
960615784 3:119594883-119594905 CCACGCTGATCTCAAACTTCTGG - Intergenic
961979620 3:131063232-131063254 CCAGGCTGGTCTGAAGCTCCTGG + Intronic
962271235 3:133979418-133979440 CCACGCTGACCACAAGATCCAGG - Intronic
963644304 3:147894811-147894833 CCATGCTGATCTGAAACTCCTGG - Intergenic
964071185 3:152635216-152635238 CCCAGCTGATCTGAAGCTCCTGG - Intergenic
965709419 3:171542183-171542205 CCAGGCTGGTCTCAAGCTACTGG + Intergenic
967378319 3:188829960-188829982 CCACGCTGGTCTGAAACTCCTGG - Intronic
968045398 3:195621174-195621196 CCACGCTGATCTGAACGTCCAGG - Intergenic
968064189 3:195749195-195749217 CCATGCTGATCTGAACGTCCAGG - Intronic
968326291 3:197819917-197819939 CCACGCTGGTCTGAAACTCCTGG + Intronic
968921601 4:3524997-3525019 CCACGCTGATCTGAAGATACAGG - Exonic
969799526 4:9552037-9552059 CCACGCTGGTCTGAAACTCCTGG - Intergenic
972220152 4:36945923-36945945 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
972944739 4:44240546-44240568 CCAGGCTGATCTCAAAATCCTGG + Intronic
974300115 4:60053346-60053368 CCAACCTGCTCTGAAGATTCTGG - Intergenic
975896729 4:79101728-79101750 CCACGCTGGTCTCAAAATCCTGG + Intergenic
977650785 4:99466754-99466776 CCAAGCTGGTCTGAAGCTCCTGG - Intergenic
978567062 4:110094341-110094363 CCAGGCTGGTCTGAAACTACTGG - Intronic
979802061 4:124922904-124922926 CCAGGCTGGTCTCAAAATACTGG + Intergenic
980006234 4:127545101-127545123 CCAGGCTGATCTCAAAATCCTGG - Intergenic
980608684 4:135127261-135127283 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
981444508 4:144820167-144820189 CCAAGCTGTTCAGATGATACTGG - Intergenic
981947316 4:150362890-150362912 CCAGGCTGATCTCAAGCTGCTGG - Intronic
982067431 4:151666639-151666661 CCAAGCTGATTTGGAGACACTGG - Intergenic
983356144 4:166660036-166660058 CCAGGCTGATCTCAAGGTCCTGG + Intergenic
983813685 4:172096302-172096324 CCAGGCTGGTCTCAAGATCCTGG + Intronic
984160310 4:176244701-176244723 CCAGGCTGATCTCAAACTACTGG - Intronic
984455874 4:179967085-179967107 CCAGGCTGATCTGAAACTCCTGG - Intergenic
987319684 5:16756889-16756911 CCAGGCTGATCTCAAAATTCTGG - Intronic
988119670 5:26944439-26944461 CCAGGCTGATCTGAAACTCCTGG - Intronic
988132558 5:27122835-27122857 CCAAGCTGATCTGAAACTGCTGG - Intergenic
988590612 5:32545647-32545669 CCACGCTTATCTGGAGCCACAGG - Intronic
988694717 5:33609581-33609603 CCAGGCTGATCTCAAAATCCTGG + Intronic
990849927 5:60191383-60191405 CCATGCTGATCTCATGATAGTGG + Intronic
992095811 5:73361546-73361568 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
993353231 5:86875774-86875796 CCAGGGTGATCTGAAACTACTGG - Intergenic
994371537 5:98972942-98972964 CTACGCTGATCTAAAGTTATTGG + Intergenic
995240134 5:109876241-109876263 CCACACTGATCTGAAGCCAAAGG - Intergenic
998041504 5:138953564-138953586 CCAGGCTGCTCTGCAGACACAGG - Intronic
999158608 5:149476508-149476530 CCAGGCTGGTCTGAAGCTCCTGG - Intergenic
999736961 5:154520070-154520092 CCATGCCAATCTGAAGATAGGGG + Intergenic
1000139580 5:158388979-158389001 CCAGGCTGCTATGAAGATAATGG - Intergenic
1000513561 5:162212758-162212780 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1000550291 5:162653518-162653540 CCACCCTGTTGAGAAGATACAGG - Intergenic
1000573427 5:162944360-162944382 CCAGACTGATCTGAAGCTTCTGG + Intergenic
1001373886 5:171235801-171235823 CCAGGCTGATCTCAAGCTACTGG + Intronic
1002454983 5:179340875-179340897 CCACGCTGCCCAGGAGATACTGG + Intronic
1002525502 5:179813541-179813563 CCACGCTGGTCTGAAGCTCCTGG - Intronic
1004721991 6:18275781-18275803 CCACGCTGATCTTAAACTCCTGG - Intergenic
1005884651 6:30087612-30087634 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
1008493671 6:52111430-52111452 CCAGGCTGATCTGAAACTGCTGG + Intergenic
1013394309 6:109719126-109719148 CCAGGCTGATCTCAAGCTCCTGG + Intronic
1015553072 6:134432404-134432426 CCAGGCTGGTCTGAAACTACTGG + Intergenic
1017772867 6:157656543-157656565 CCAGGCTGGTCTGAAGCTCCTGG + Intronic
1019717635 7:2547314-2547336 CCAGGCTCACCTGAAGATACTGG + Exonic
1020442566 7:8234011-8234033 CCAGGCTGATCTGAAACTCCTGG - Intronic
1020663550 7:11010862-11010884 CCAGGCTGATCTGAAACTCCTGG + Intronic
1021114590 7:16733456-16733478 CCATGCTGGTCTGAAACTACTGG + Intergenic
1022026223 7:26450243-26450265 CCAGGCTGATCTTAAAATACTGG + Intergenic
1022056874 7:26745722-26745744 CCAGGCTGATCTCAAATTACTGG + Intronic
1022168671 7:27800505-27800527 CCAGGCTGATCTCAAACTACTGG - Intronic
1022327766 7:29347574-29347596 CCATGCTGTTCTGATGATAGTGG - Intronic
1022595519 7:31709938-31709960 CCAGGCTGATCTGGAGCTCCTGG - Intergenic
1023811307 7:43914290-43914312 CCAGGCTGATCTCAAGCTCCTGG - Intronic
1024358032 7:48437770-48437792 CCAGGCTGATCTCAAGACCCAGG - Intronic
1025061457 7:55812002-55812024 CCACGCTGGTCTCAAGCTCCTGG + Intronic
1026511188 7:71028567-71028589 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1026619470 7:71937686-71937708 CCAGGCTGATCTCAAACTACTGG + Intronic
1026644553 7:72156371-72156393 GCACCATGGTCTGAAGATACAGG - Intronic
1026759628 7:73116788-73116810 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
1026879773 7:73901077-73901099 CCAGGCTGGTCTCAAGATCCTGG + Intergenic
1027087782 7:75276685-75276707 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1027560365 7:79720684-79720706 CCAGGCTGGTCTGAAGCTGCTGG + Intergenic
1028281892 7:88940558-88940580 CCAGGCTGATCTCAAGCTCCTGG - Intronic
1028989258 7:97032589-97032611 GCACGCTGATCTGCAGGGACTGG - Intergenic
1029393891 7:100293831-100293853 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1029473252 7:100767686-100767708 CCAGGCTGATCTCGAGATCCTGG + Intronic
1029910658 7:104143907-104143929 CCAGGCTGATCTGAAACTCCTGG - Intronic
1030041561 7:105455632-105455654 CCAGGCTGATCTCAAGCTCCTGG + Intronic
1033212522 7:139470580-139470602 CCAGGCTGATCTCAAAATCCTGG - Intronic
1034634951 7:152559850-152559872 CCAGGCTGATCTCAAACTACTGG + Intergenic
1035478603 7:159162855-159162877 CCAGGCTGATCTGAAATTCCTGG - Intergenic
1036092829 8:5687152-5687174 CCATGCTGTTCTCATGATACTGG + Intergenic
1036553528 8:9836923-9836945 CCAGGCTGGTCTCAAGCTACTGG - Intergenic
1037705935 8:21315130-21315152 CCACGCTGGTCTTAAGCTCCTGG + Intergenic
1037843532 8:22262782-22262804 CCAAGCTGATCTCAAAATCCTGG + Intergenic
1038731631 8:30133124-30133146 CCAGGCTGATCTGAAACTCCTGG + Intronic
1039318932 8:36406779-36406801 CCAGGCTGTTCTGAAAATCCTGG - Intergenic
1039332882 8:36558646-36558668 CCACACTGGTCTCAAAATACTGG + Intergenic
1039487927 8:37926450-37926472 CCACGCTCATCTCAAGTTTCTGG + Intergenic
1042593089 8:70417196-70417218 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1043388688 8:79770514-79770536 CCAGGCTGATCTGGAGCTCCTGG - Intergenic
1045007873 8:97931910-97931932 CCAGGCTGATCTGAAACTCCTGG + Intronic
1047557000 8:125942489-125942511 CCACCCTTATCTGAAGATGATGG - Intergenic
1048348458 8:133596303-133596325 CCAGGCTGATCTTAAGCTCCTGG + Intergenic
1049133464 8:140871587-140871609 CCAGGCTGATCTCAAGCTCCTGG - Intronic
1049137065 8:140912417-140912439 CCAGGCTGATCTCAAGCTCCTGG - Intronic
1052315763 9:27115287-27115309 CCAGGCTGATCTGAAACTCCTGG - Intronic
1055110779 9:72557159-72557181 CCAGGCTGGTCTCAAGCTACTGG - Intronic
1055155758 9:73061135-73061157 CCAAGCTGATCTCAAGCTCCTGG + Intronic
1055947090 9:81701396-81701418 CCAGGCTGATCTGAAATTCCTGG + Intergenic
1056874260 9:90312796-90312818 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1058838748 9:108884869-108884891 CCACGCTGGTCTGAAACTCCTGG - Intronic
1059962179 9:119576329-119576351 CCAGGCTGATCTGAAACTCCTGG - Intergenic
1061292387 9:129658598-129658620 CCAGGCTGATCTCAAGCTCCTGG - Intergenic
1061688954 9:132308927-132308949 CCAGGCTGGTCTGAAGCTCCTGG - Intronic
1185970201 X:4654224-4654246 CCAGGCTGATCTGAAACTCCAGG - Intergenic
1185987678 X:4853970-4853992 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
1187909743 X:24100482-24100504 CCAGGCTGGTCTGAAGCTCCTGG - Intergenic
1190737456 X:53264973-53264995 CCAGGCTGATCTGAAACTCCTGG + Intronic
1196369286 X:114957687-114957709 CCACGCTGATCTCAAACTCCAGG - Intergenic
1199782282 X:151073592-151073614 CCAGGCTGATCTCAAAATCCCGG + Intergenic
1201965046 Y:19723389-19723411 CCAGGCTGATCTCAAGCTTCTGG - Intronic
1202301104 Y:23415280-23415302 CCAGGCTGATCTCAAGCTCCTGG + Intergenic
1202569707 Y:26255318-26255340 CCAGGCTGATCTCAAGCTCCTGG - Intergenic