ID: 968923331

View in Genome Browser
Species Human (GRCh38)
Location 4:3533817-3533839
Sequence TTGAGTTGTTTCAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968923327_968923331 6 Left 968923327 4:3533788-3533810 CCATCGTTTCATTTCTTTTTTTC No data
Right 968923331 4:3533817-3533839 TTGAGTTGTTTCAGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968923331 Original CRISPR TTGAGTTGTTTCAGGCAAGA GGG Intergenic
No off target data available for this crispr