ID: 968925451

View in Genome Browser
Species Human (GRCh38)
Location 4:3544869-3544891
Sequence GGCCTCTAGGATCCGCGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968925451_968925457 10 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925457 4:3544902-3544924 AGCATGGGTTTCCACTCACACGG No data
968925451_968925459 17 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925459 4:3544909-3544931 GTTTCCACTCACACGGTAGGTGG No data
968925451_968925455 -5 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925455 4:3544887-3544909 AGGCCAGGCAGAAGCAGCATGGG No data
968925451_968925454 -6 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925454 4:3544886-3544908 GAGGCCAGGCAGAAGCAGCATGG No data
968925451_968925458 14 Left 968925451 4:3544869-3544891 CCTGAACGCGGATCCTAGAGGCC No data
Right 968925458 4:3544906-3544928 TGGGTTTCCACTCACACGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968925451 Original CRISPR GGCCTCTAGGATCCGCGTTC AGG (reversed) Intergenic
No off target data available for this crispr